Vol. 275, Issue 1, R203-R211, July 1998
Expression of
2-macroglobulin by the
interaction between hepatocytes and endothelial cells in
coculture
Mark A.
Talamini1,
Michael P.
McCluskey1,
Timothy G.
Buchman3, and
Antonio
De Maio1,2
Departments of 1 Surgery and
2 Physiology, Johns Hopkins
University School of Medicine, Baltimore, Maryland 21287; and
3 Department of Surgery,
Washington University School of Medicine, St. Louis, Missouri 63110
 |
ABSTRACT |
The interaction between distinct cell types
within the liver seems to be important in regulating hepatic function.
However, these interactions have not been well characterized because of difficulty in reproducing the hepatic environment in an ex vivo model.
In the present study a coculture system of hepatocytes and endothelial
cells was established to investigate the communication between
parenchymal and nonparenchymal cells. Freshly isolated rat hepatocytes
were placed onto a monolayer of primary aortic rat endothelial cells.
Analysis of the proteins secreted into the extracellular medium after
pulse labeling with radioactive amino acids revealed the presence of a
180,000-apparent molecular weight glycoprotein, BBB-180, which was not
detected in the extracellular medium of hepatocytes or endothelial
cells when they were cultured separately. This glycoprotein was
identified as 
2-macroglobulin after sequencing of the proteolytic peptides derived from the purified
protein. This finding was confirmed by Northern and Western blotting,
immunoprecipitation, and RT-PCR. The expression of
2-macroglobulin required direct
contact between hepatocytes and viable endothelial cells. These
findings suggest that endothelial cells modulate hepatocyte gene
expression by direct cellular interactions.
acute phase; liver; cellular communication
| |
INTRODUCTION |
THE LIVER IS THE CENTRAL organ for the synthesis of
serum components and for the clearance of toxic substances. This organ consists of four different cell types: hepatocytes (Hep), endothelial cells, Kupffer cells, and Ito cells. Although Hep execute the majority
of hepatic functions, nonparenchymal cells also play an important
independent role. For example, Kupffer cells act as phagocytes within
the liver and secrete inflammatory mediators such as cytokines.
Endothelial cells are the first cell type in the liver to be exposed to
blood-borne pathogens and toxins. In addition, they secrete a variety
of mediators such as interleukins (IL) 1, 2, and 6, tumor necrosis
factor, prostaglandin E2,
prostacyclin, and angiotensin-converting enzyme, which could modify Hep
function (18).
Because the interaction between Hep and nonparenchymal cells is
believed to modulate liver function, cultures of primary Hep alone may
imprecisely mimic the hepatic intercellular environment. Previous
attempts to mimic this environment have used cocultures of Hep and
Kupffer cells (39), Ito cells (25, 34), hepatic endothelial cells (16),
hepatic epithelial cells (6, 11), human dermal fibroblasts (35), and
3T3 fibroblasts (22). These studies demonstrated prolonged maintenance
of specific hepatic functions by Hep when cultured in conjunction with
another cell type. For example, synthesis of albumin has been sustained
for weeks in Hep coculture systems, an increase compared with the dramatic decline in the expression of albumin seen in long-term primary
cultures of Hep alone (6, 16). Two potential mechanisms have been
proposed to explain these findings:
1) intercellular communication
mediated by gap junctions (11, 34) and
2) synthesis of extracellular
matrices (6, 16, 25). In the present study we have characterized the
interaction between Hep and aortic endothelial cells (AEC) in a
coculture system. The major feature of this coculture system was the
expression of 2-macroglobulin
(2-M) induced by the direct
association between these two cell types. Our studies suggest that
endothelial cells can modulate Hep gene expression by cell-cell
contact.
| |
EXPERIMENTAL PROCEDURES |
Animals.
Adult male Sprague-Dawley rats (Charles River Laboratories, Wilmington,
MA) weighing 175-275 g were utilized for the isolation of
endothelial cells and Hep. Animals were housed in a climate-controlled facility (25°C, 55% relative humidity) on a 12:12-h light-dark cycle with no twilight. Animals were provided water and standard rat
chow ad libitum. Before surgery, animals were anesthetized with
pentobarbital sodium (5 mg/100 g body wt ip). Animal studies were
conducted according to protocols reviewed and approved by the
Institutional Animal Care and Use Committee and adhered to guidelines
promulgated by the National Institutes of Health.
Endothelial cell isolation and culture.
Endothelial cells were isolated from rat aorta by a modification of the
explant technique described by McGuire and Orkin (27). Briefly, a 30-mm
segment of aorta was aseptically obtained from an anesthetized rat. The
aorta was washed three times with prewarmed (37°C) RPMI 1640 medium. Sections of aorta ~2 mm2
were placed on petri dishes previously coated with type I rat tail
collagen (Sigma Chemical, St. Louis, MO) with the lumen side of the
section in contact with the collagen. To facilitate attachment by
reducing buoyancy, each section of aorta was moistened with one drop of
RPMI 1640 medium and incubated for 24 h at 37°C in a humidified
incubator with 5% CO2. After the
initial 24-h incubation, fresh RPMI 1640 medium (2 ml) was added and
replaced every 24 h. Sections of aorta were removed from culture after
4 days. Explanted cells were cultured in Primaria tissue
culture flasks (Falcon, Lincoln Park, NJ) and passaged after
achieving 90% confluency.
AEC were maintained in RPMI 1640 medium (Life Technologies,
Gaithersburg, MD) supplemented with 10% heat-inactivated fetal bovine
serum (Hyclone, Logan, UT), 10 IU/ml penicillin, 10 µg/ml streptomycin (Life Technologies), and 50 µg/l endothelial mitogen (Biomedical Technologies, Stroughton, MA) at 37°C in a humidified incubator with 5% CO2. Cells were
assayed to ensure the presence of differentiated endothelial cell
features by treatment with the fluorescent probe acetylated low-density
lipoprotein (Di-I-Ac-LDL). For the preparation of cocultures, AEC were
used between passages 2 and
6.
Hep isolation and coculture preparation.
Rat Hep were isolated according to Wanson et al. (38). After a midline
laparotomy on anesthetized rats the liver was perfused, by cannulation
of the portal vein, in a nonrecirculating fashion with Hanks' balanced
salt solution (HBSS) containing 0.125 mM EGTA, (15 min, 33 ml/min) then
with plain HBSS (5 min, 33 ml/min). The liver was then excised from the
anesthetized animal and perfused (20 min, 20 ml/min) with HBSS
containing 3 mM CaCl2 and 0.05% collagenase D (Boehringer Mannheim, Indianapolis, IN). All perfusates were bubble oxygenated and maintained at 37°C. Glisson's capsule was teased apart in a sterile petri dish containing William's E
medium. The total cell suspension was gravity filtered through a
75-µm and then a 53-µm polyamide nylon mesh (Nitex, Tetko,
Briarcliff Manor, NY). Cells were then washed twice with William's E
medium by centrifugation (50 g, 5 min). Cells resuspended in William's E medium were mixed with an equal
volume of Percoll solution (Sigma Chemical) in PBS and centrifuged at
80 g for 10 min. The cell pellet (Hep)
was resuspended in William's E medium. Hep isolated under such
conditions demonstrated a viability >90%, with no visible contamination from other cell types.
Freshly isolated Hep were cultured alone onto type I rat tail collagen
or onto a monolayer of AEC at a density of 1.6 × 106 cells/35-mm culture dish. Hep
alone or in coculture were maintained in William's E medium (Life
Technologies) supplemented with 10% heat-inactivated fetal bovine
serum, 10 mM glucose, 12.5 U/l insulin, 1 nM dexamethasone, 10 IU/ml
penicillin, 10 µg/ml streptomycin, and 50 mg/l
gentamicin and buffered with 4 mM HEPES and 0.03% NaHCO3 at 37°C in a humidified
incubator with 5% CO2.
Metabolic labeling.
Cell cultures were labeled with 20 µCi/ml of
[35S]methionine-[35S]cysteine
(1,000 Ci/mmol; Translabel, ICN Biomedicals, Costa Mesa, CA) in minimal
essential medium (ICN Biomedicals) supplemented with 2 mM
L-glutamine, 2 mM sodium
pyruvate, and 1× nonessential amino acids (all from Life
Technologies). Cell cultures were metabolically labeled for 20 h at
37°C in a humidified incubator with 5%
CO2. Extracellular medium was
collected and centrifuged at 15,400 g for 2 min, and the supernatant was stored at 
20°C.
SDS-PAGE and protein blotting.
Proteins were separated in 7.5% polyacrylamide slab gels by use of
Laemmli's buffer system (23). Gels were fixed [10%
methanol-10% acetic acid (vol/vol)] for 1 h and subjected to
fluorography (Amplify, Amersham Radiochemical Center, Arlington
Heights, IL). Alternatively, unfixed gels were transferred onto
nitrocellulose membrane filters (Hybond-ECL, Amersham) with use of 15.6 mM Tris and 120 mM glycine, pH 8.3 (13), at constant current (200 mA)
for 3 h. Blots were used for immunostaining as previously described
(9). A rabbit polyclonal antibody against human
2-M (Sigma Chemical) was
utilized, and 125I-labeled protein
A (10 µCi, 100 mCi/mg, ICN Biomedicals) was used as secondary
antibody. Blots were exposed to X-ray films (XOMAT XAR-5, Eastman
Kodak, Rochester, NY) with use of intensifying screens at
80°C.
Immunoprecipitation.
Extracellular medium from metabolically labeled cells was
immunoprecipitated as previously described (10). Briefly, samples (50 µl) were mixed with 400 µl of immunoprecipitation buffer (50 mM
Tris · HCl, pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.1%
hemoglobin, 0.1% Triton X-100, and 0.02%
NaN3) and precleared by
incubation with protein A coupled to sepharose [40 µl, 50%
solution (vol/vol) in PBS] for 4 h at 4°C. The precleared
supernatants were incubated with a 1:2 dilution of rabbit polyclonal
antibody specific for human 2-M
(Sigma Chemical) for 16 h at 4°C and further incubated with protein
A-sepharose [40 µl, 50% solution (vol/vol) in PBS]. The
resulting pellet was washed three times with immunoprecipitation buffer
(500 µl), then three times with 50 mM Tris · HCl,
pH 7.5, 300 mM NaCl, 5 mM EDTA, 0.1% Triton X-100, and 0.02%
NaN3 (500 µl). The final pellet
was resuspended in electrophoresis sample buffer (50 mM
Tris · HCl, pH 6.9, 3% lauryl sulfate, 17%
glycerol, 5% 2-mercaptoethanol), boiled, and analyzed by SDS-PAGE
(7.5% PAGE).
Protein purification.
The extracellular medium from cocultures was fractionated by sequential
affinity chromatography on immobilized wheat germ agglutinin (WGA) and
concanavalin A (Con A). The material bound to Con A was specifically
eluted with
-methyl-D-mannopyranoside. The eluted fraction was concentrated, separated by SDS-PAGE, and transferred onto a nitrocellulose membrane filter. The protein pattern
in the blot was visualized by staining with Ponceau S (9). After
localization of BBB-180, the band was excised and digested with
trypsin, and the resulting tryptic peptides were analyzed by
microsequencing.
RNA isolation and Northern blot analysis.
Total RNA (15 µg), isolated by the acid guanidinium
thiocyanate-phenol-chloroform method (4), was separated in
formaldehyde-agarose gels and transferred onto modified nylon membranes
(Gene Screen Plus, NEN Research Products, Boston, MA). A plasmid
containing the full-length sequence of rat
2-M (pRLa2M/29J; American Type Tissue Collection, Rockville, MD) was used as a probe. The cDNA probe
was radiolabeled by the random primer method (12) with use of
-deoxy-[32P]ATP and
-deoxy-[32P]CTP
(ICN Pharmaceuticals), as previously described (2). Blots were washed
and exposed to X-ray films with use of intensifying screens at
80°C.
RT-PCR.
Total RNA (0.25, 0.125, 0.05, and 0.01 µg) was utilized to synthesize
cDNA with use of RT (Superscript, Bethesda Research Laboratories,
Bethesda, MD) and oligo(dT) primer (42°C, 15 min; 99°C, 5 min;
5°C, 5 min). The resulting cDNA was amplified by PCR with
Taq polymerase and the following
primers: downstream primer (common to all macroglobulin
genes, GTGAGCTCCACGAAGAAGGGCTGG) and upstream primer specific for
2-M (GTCAGGGCCAAATACAAGGAT), 1-macroglobulin
(1-M, CACACACAGGCAGATCATTCT),
and 1-inhibitor III
(1-I3, CCATTCCTCTTGCACAGCAGA).
PCR conditions were as follows: 95°C for 1 min, 65°C for 1 min,
and 72°C for 2 min; 30 cycles. PCR products were resolved in a 1%
agarose gel, stained by ethidium bromide, and transferred onto a
modified nylon membrane. Membranes were probed with the same PCR
primers radiolabeled with
[
-32P]ATP (10 µCi, 4,500 Ci/mmol; ICN Biomedicals) and T4 kinase. Blots were washed
at high stringency and exposed to X-ray films (XOMAT XAR-5) with use of
intensifying screens at 80°C.
| |
RESULTS |
Morphology of Hep and AEC coculture.
Freshly isolated rat Hep were seeded onto confluent monolayers of AEC.
Under these conditions, Hep spread rapidly, forming cordlike
structures. Less fat deposition (by visual microscopic estimate)
occurred in Hep-AEC cocultures than in Hep grown on a collagen matrix
(Fig. 1). Hep in coculture with AEC
maintained a differentiated morphology for 
2 wk, whereas Hep on a
collagen matrix dedifferentiated within 5 days of culture.
View larger version (92K):
[in this window]
[in a new window]
|
Fig. 1.
Phase-contrast photomicrograph of hepatocyte (Hep)-aortic endothelial
cell (AEC) cocultures. Freshly isolated rat Hep were placed onto a
monolayer of AEC and grown in coculture for 24 h (C). For comparison,
photomicrographs of AEC (E) alone and Hep (H) on rat tail collagen
matrix are presented.
|
|
Protein synthesis.
To evaluate whether the interaction of Hep and AEC modified gene
expression, Hep and AEC in coculture, Hep on a collagen matrix, and AEC
alone were pulse labeled with
[35S]methionine-[35S]cysteine
(20 h, 37°C). Radiolabeled proteins in the extracellular medium
were analyzed by SDS-PAGE and fluorography. The electrophoretic pattern
of newly synthesized secreted proteins by cocultures was different from
the combination of the secreted proteins by Hep and AEC grown
separately. The most remarkable difference was the presence of a
180,000-apparent molecular weight protein, BBB-180, in the
extracellular medium of cocultures. This band was not observed in the
extracellular medium derived from Hep or AEC grown alone (Fig.
2).
View larger version (97K):
[in this window]
[in a new window]
|
Fig. 2.
Fluorogram of electrophoretic pattern of newly synthesized proteins in
extracellular medium of Hep-AEC cocultures, Hep, and AEC. AEC, AEC-Hep
cocultures, and Hep were metabolically labeled for 20 h at 37°C
with
[35S]methionine-[35S]cysteine
(20 µCi/ml), and equal volumes of extracellular medium were
electrophoresed in a 7.5% polyacrylamide slab gel and prepared for
fluorography. Arrow, protein of 180,000 apparent molecular weight
(i.e., BBB-180).
|
|
Coculture of Hep with other cell types and different extracellular
matrices.
We tested whether the expression of BBB-180 could be sustained by cell
types other than AEC. Isolated Hep were grown on monolayers of
pulmonary endothelial cells (PEC), skin fibroblasts, a hepatic epithelial cell line (clone 9), and a normal kidney epithelial cell
line (NRK). Presence of BBB-180 was analyzed in the extracellular medium by SDS-PAGE and fluorography after pulse labeling with [35S]methionine-[35S]cysteine.
BBB-180 was observed in the extracellular medium of Hep grown on PEC
(Fig. 3) as well as on skin fibroblasts or
clone 9 (not shown), but not when Hep were grown on NRK (Fig. 3). We also tested whether various extracellular matrices (purified type I and
type IV collagen, Engelbreth-Holm-Swarm gel, fibronectin, laminin, and
Matrigel) could sustain the expression of BBB-180 by Hep. BBB-180 was
not observed in Hep grown on any of these matrices (Fig.
4).
View larger version (134K):
[in this window]
[in a new window]
|
Fig. 3.
Fluorogram of electrophoretic pattern of newly synthesized proteins in
extracellular medium of cocultures of Hep and pulmonary endothelial
cells (PEC) or normal kidney epithelial cells (NRK cell line). Freshly
isolated rat Hep were placed alone on rat tail collagen matrix or onto
monolayers of PEC or NRK cells. After 24 h of culture, cells
(duplicates) were metabolically labeled (20 h, 37°C) with
[35S]methionine-[35S]cysteine
(20 µCi/ml) and extracellular medium was analyzed by SDS-PAGE and
fluorography. Arrow, BBB-180.
|
|
View larger version (81K):
[in this window]
[in a new window]
|
Fig. 4.
Fluorogram of extracellular medium obtained from rat Hep maintained on
different matrices. Freshly isolated rat Hep were placed on a monolayer
of AEC (Hep/AEC), rat tail collagen matrix
(a and
b), type IV collagen
(c), Engelbreth-Holm-Swarm matrix
(d), fibronectin
(e), laminin
(f), and Matrigel
(g). As a control, AEC grown alone were also
analyzed. After 24 h, cells were metabolically labeled (20 h, 37°C)
with
[35S]methionine-[35S]cysteine
(20 µCi/ml), and extracellular medium was analyzed by SDS-PAGE and
fluorography. Arrow, BBB-180.
|
|
Identification of BBB-180.
BBB-180 was further purified and characterized. First, BBB-180 was
identified to be a glycoprotein. Extracellular medium obtained from
metabolically labeled cocultures was analyzed for interaction with Con
A and WGA. The majority of the glycoproteins in the extracellular medium were found to bind to Con A and WGA. However, BBB-180 bound specifically to Con A but not to WGA. We took advantage of this finding
by purifying BBB-180 by sequential affinity chromatography on
immobilized WGA and Con A. Glycoproteins bound to immobilized Con A
were eluted with
-methyl-D-mannopyranoside and
separated by SDS-PAGE. The SDS gel was transferred onto a
nitrocellulose membrane filter and stained with Ponceau S. BBB-180 was
excised and digested with trypsin, and the tryptic peptides were
microsequenced. Two resulting sequences were used to search the gene
bank and found to match the reported sequence of
2-M (Fig.
5). To substantiate these observations,
extracellular medium obtained from Hep cocultured with AEC or Hep or
AEC grown alone were blotted onto nitrocellulose membrane filters and
probed first with a polyclonal antibody specific for human
2-M and
125I-labeled protein A as
secondary antibody. A signal corresponding to a 180,000-apparent
molecular weight protein was detected in the sample corresponding to
the extracellular medium of cocultures. Such a band was not detected in
the extracellular medium of Hep or AEC grown alone (Fig.
6A). In
addition, a radiolabeled cDNA probe for rat
2-M was used to hybridize
Northern blots containing total RNA isolated from cocultures. Again,
only RNA samples isolated from cocultures contained sequences
complementary to the cDNA probe (Fig.
6B).
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 5.
Amino acid comparison of peptides derived from BBB-180 and
2-macroglobulin
(2-M) sequence. Two tryptic
peptides were obtained from purified BBB-180 (T51 and T38). Amino acid
sequences of these peptides were used to search gene bank, and both
peptide sequences matched 2-M
sequence. Vertical bars, amino acid identities; *, acceptable
differences. Percent homology is shown on
right.
|
|
View larger version (25K):
[in this window]
[in a new window]
|
Fig. 6.
Identification of 2-M by
Western and Northern blotting. Extracellular medium of Hep-AEC
cocultures or Hep and AEC grown alone was separated by SDS-PAGE and
transferred onto nitrocellulose filters. Blots were probed with a
rabbit polyclonal antibody against human
2-M and
125I-labeled protein A as
secondary antibody. Presence of antigen was visualized after
autoradiography (A). Total RNA (15 µg) isolated from Hep-AEC cocultures and Hep and AEC grown alone was
electrophoresed in agarose-formaldehyde gels and transferred onto
modified nylon membranes. Blots were hybridized with a
32P-labeled cDNA of rat
2-M, washed, and exposed to
X-ray films (B).
|
|
The experiments described above strongly suggested that BBB-180 was
2-M. However, the
2-M gene has a high degree of
homology with other two genes:
1-M and
1-I3. These three proteins have a similar molecular weight, making it impossible to distinguish them
with confidence by one-dimensional gel electrophoresis (20-22). Thus the excised band corresponding to BBB-180, used as the source for
proteolytic fragments, could have contained
1-M and/or
1-I3 in addition to
2-M. To resolve this ambiguity,
an RT-PCR analysis was performed using a primer common to all three
macroglobulin genes (downstream primer) and a set of upstream primers
independent and specific for each of the
2-M,
1-M, and
1-I3 genes. Total RNA (between
0.01 and 0.25 µg) isolated from cocultures and Hep grown alone was
used to synthesize cDNA with use of oligo(dT). The cDNA was divided and
used in three separate reactions. Each reaction contained the common
downstream primer and an upstream primer specific for
2-M,
1-M, or
1-I3. The PCR products were separated on an agarose gel and visualized by staining with ethidium bromide (Fig. 7). The gels were also
transferred onto nylon membranes and hybridized with the radiolabeled
common primer or with the radiolabeled primer specific for
2-M (Fig. 7). When the primer specific for 2-M was included
in the PCR reaction, a PCR product of ~1 kb was obtained from RNA
isolated from cocultures. The size of this PCR product matched the
expected size on the basis of the sequence of
2-M mRNA. A comparatively weak
signal was observed when samples of Hep grown alone were used (Fig. 7).
When primers specific for 1-M
or 1-I3 were included in the
reaction, amplified DNA of equal intensity was observed in RNA samples
isolated from cocultures and Hep grown alone. In this experiment we
showed that the quantity of DNA amplified by PCR was proportional to
the initial concentration of RNA used in the RT reaction. In other
words, our conditions for RT-PCR were within the linear range of
amplification.
View larger version (28K):
[in this window]
[in a new window]
|
Fig. 7.
Identification of 2-M by RT-PCR
amplification. Total RNA was isolated from Hep-AEC cocultures (C) or
Hep grown alone (H). RNA was reverse transcribed using an oligo(dT) as
a primer and RT. cDNA was amplified using a 3' primer common to
all macroglobulin sequences and a 5' primer specific for
2-M,
1-macroglobulin
(1-M), and
1-inhibitor III
(1-I3) as follows: denaturation
at 94°C for 1 min, annealing at 60°C for 1 min, extension at
72°C for 2 min; 45 cycles. PCR products were analyzed by ethidium
bromide staining (EtBr) or by Southern blot hybridization with
5'-radiolabeled primers specific for
2-M or common primer. PCR
products were of expected size (1 kb). To show that RT-PCR analysis was
in linear range of detection, different concentrations of total RNA
were used: 0.25 µg (a), 0.125 µg
(b), 0.05 µg
(c), 0.01 µg
(d).
|
|
Expression of 2-M
requires cell-cell contact.
To test whether the expression of
2-M (BBB-180) was induced by a
soluble factor present in the extracellular medium or by the contact
between the cell types, AEC and Hep were grown together but separated
by a nitrocellulose membrane filter. This model allowed the passage of
proteins between compartments but eliminated direct cell contact. Two
conditions were tested: Hep grown on the filter with AEC on the bottom
of the well and the reverse. Cells were metabolically labeled by
addition of
[35S]methionine-[35S]cysteine
to the medium. The extracellular medium (top and bottom) was
immunoprecipitated with use of the antibody specific for human 2-M. In addition, total RNA was
isolated from each cell culture layer and individually analyzed by
Northern blot-hybridization. For comparison, Hep-AEC cocultures or Hep
or AEC alone were also tested. By immunoprecipitation or Northern
blotting, 2-M could be detected
only when AEC and Hep were in contact in a coculture system (Fig.
8). This result was further corroborated by
experiments in which extracellular medium from AEC or cocultures
(conditioned medium) obtained at 4, 8, 20, and 30 h after culture
initiation was added to Hep on collagen matrix. Addition of conditioned
medium did not induce the expression of
2-M by Hep (Fig.
9).
View larger version (46K):
[in this window]
[in a new window]
|
Fig. 8.
Cultures of Hep and AEC grown together but separated by membrane
filter. AEC and Hep were grown independently or separated by a
nitrocellulose filter with Hep on top (Hep on AEC) or AEC on top (AEC
on Hep). Cells on top (T) and bottom (B) were separated and
metabolically labeled with
[35S]methionine-[35S]cysteine.
Extracellular medium was analyzed by immunoprecipitation with use of an
antibody against human 2-M.
Cells were also lysed, and total RNA was analyzed by Northern blotting
with 32P-labeled cDNA of rat
2-M.
|
|
View larger version (104K):
[in this window]
[in a new window]
|
Fig. 9.
Effect of conditioned medium on expression of
2-M by Hep. Extracellular
medium of AEC (d, f, h, and
j) or Hep-AEC cocultures
(e, g, i, and
k) was collected at 4 h
(d and
e), 8 h
(f and
g), 20 h
(h and
i), and 30 h
(j and
k) and added to freshly isolated Hep
and further incubated for 24 h. Then Hep, in presence of conditioned
medium, were labeled with
[35S]methionine-[35S]cysteine
(20 h, 37°C), and secreted proteins were analyzed by SDS-PAGE and
fluorography. As controls, AEC grown alone
(a) or in cocultures with Hep
(b) as well as Hep grown alone
(c) were used. Arrow,
2-M.
|
|
Expression of 2-M in
cocultures requires viable AEC.
AEC were fixed by incubation with Formalin at 37 or 4°C, methanol
at 37 or 4°C, and paraformaldehyde at 37°C. Freshly isolated Hep were added on top of the fixed AEC. In each case, Hep were attached
to the fixed AEC. Cocultures were metabolically labeled with
[35S]methionine-[35S]cysteine,
and the extracellular medium was analyzed by SDS-PAGE and fluorography.
The electrophoretic pattern of secreted proteins by Hep on fixed AEC
was identical to the pattern of proteins secreted by Hep grown alone
(Fig.
10A),
except for AEC incubated with Formalin at 4°C. In this instance,
the presence of 2-M was
detected in the extracellular medium (Fig.
10A). AEC incubated with Formalin at
4°C are metabolically active, as demonstrated by
pulse-labeling experiment results, in contrast to AEC incubated with
Formalin at 37°C (Fig. 10B).
These data indicate that the expression of 2-M requires the contact of Hep
with viable AEC.
View larger version (66K):
[in this window]
[in a new window]
View larger version (84K):
[in this window]
[in a new window]
|
Fig. 10.
Cocultures of rat Hep on fixed AEC. A:
monolayers of AEC were fixed by incubation with 0.5% Formalin (Form)
at 37°C (2 h) or 4°C (10 min), 100% methanol (MeOH) at
37°C (10 min) or 4°C (10 min), and 3.5% paraformaldehyde
(Para) at 37°C (5 min). Freshly isolated rat Hep were placed alone
on rat tail collagen matrix (Hep) or placed onto monolayers of unfixed
AEC (Hep/AEC) or onto fixed AEC. Unfixed AEC were included as a
control. After 24 h, cells were metabolically labeled (20 h, 37°C)
with
[35S]methionine-[35S]cysteine
(20 µCi/ml), and extracellular medium was analyzed by SDS-PAGE and
fluorography. Arrow, 2-M.
B: AEC were fixed with Formalin at 4 or 37°C and used in cocultures with rat Hep or maintained alone.
Hep on unfixed AEC and AEC and Hep grown alone were used as controls.
Cells were metabolically labeled (20 h, 37°C) with
[35S]methionine-[35S]cysteine
(20 µCi/ml), and extracellular medium was analyzed by SDS-PAGE and
fluorography.
|
|
| |
DISCUSSION |
In the present study we have characterized the interaction between
freshly isolated rat Hep and AEC in a coculture system. Rat AEC were
used as a source of endothelial cells because they are stable in
primary cultures and available in large quantities. However, the
interaction between AEC and Hep may not perfectly reflect the liver
environment. The most remarkable characteristic of this coculture
system is the synthesis of a 180,000-apparent molecular weight
glycoprotein, BBB-180, which was not expressed by Hep or AEC grown
separately. This glycoprotein was identified as
2-M
after sequencing of tryptic peptides obtained from the purified
protein. Further analysis by immunoprecipitation, Western and Northern
blotting, and an RT-PCR supported the preceding finding. The expression
of 2-M by this coculture system
showed cell-type specificity. Thus PEC and skin fibroblasts, but not
kidney epithelial cells, were capable of inducing the expression of rat
2-M. The expression of
2-M in this coculture system
requires cell contact or at least close proximity. However, fixation of
AEC specifically abolished the expression of
2-M in coculture, even when
attachment of Hep to AEC (similar to that seen in cocultures) was
observed. This latter finding suggests that AEC do not act as simple
adhesion substrates for Hep. These observations taken together suggest that the expression of 2-M
requires the contact of Hep with metabolically active AEC.
2-M is a large multimeric
protein complex of ~720,000 molecular weight formed by four identical
subunits, each of 180,000 molecular weight (24, 32). The principal role
of 2-M is the clearance of
circulating proteases. Complexes of
2-M and proteases are taken up
by specific cell surface receptors on macrophages and other phagocytic
cells (37). Studies have also shown that 2-M is important in cell growth
regulation (3, 5, 14). In addition,
2-M seems to play an important
role as a scavenger of some cytokines, including IL-1, IL-2,
transforming growth factors-
1 and -2, platelet-derived growth
factor-, and nerve growth factor- (5, 7, 14). The interaction of
these cytokines with 2-M has a
negative impact on the regulation of growth and other cytokine-related functions. For example, the association of
2-M and transforming growth
factor-1 increases the
inducible form of nitric oxide synthase in macrophage cell lines,
causing cell death (26). 2-M
may also regulate cellular functions independently of cytokines by
direct interaction with macrophages (28, 29). In this case, 2-M has been found to affect
superoxide anion generation and prostaglandin
E2 synthesis (21). Levels of
2-M in the circulation can be
increased several hundredfold in rats by the administration of
inflammatory agents such as turpentine and Freund's adjuvant (15, 24,
32). Consequently, 2-M is
considered to be an acute-phase protein in rodents.
Previous studies have shown that transcription of rat
2-M gene is stimulated by the
exogenous addition of IL-6. The binding of IL-6 to its receptor on the
Hep surface triggers the activation of Stat 3, which binds to the IL-6
response element in the promoter region of the
2-M gene (20, 33). A similar
mechanism has been proposed for the expression of -fibrinogen, which
is also induced by IL-6 (41). Our studies do not suggest that the
expression of 2-M in Hep-AEC
coculture is due to the presence of a soluble factor such as IL-6.
However, we cannot discard the possibility that AEC may be expressing a
membrane-bound form of IL-6 that is inducing the expression of
2-M in the coculture system. In either case, there is no evidence whether the expression of
2-M is modulated in Hep-AEC
cocultures via the IL-6 response element or an alternative mechanism.
Although 2-M is an acute-phase
protein in rodents, it is not an acute-phase protein in humans. In
fact, 2-M is constitutively expressed in humans. It is possible that
2-M may be expressed by a
mechanism different from the extracellular presence of IL-6. Prolactin
has been observed to induce the expression of
2-M in rat ovarian granulosa
cells by activation of Stat 5, which binds to the IL-6 response element
(8). Activated Stat 5 has also been detected in Hep nuclei of
unstimulated rats (33). 2-M is
constitutively expressed in Sertoli cells of the testis (1) and
pulmonary cells (30). The expression of rat
2-M in cultures of Sertoli
cells is increased by the addition of dexamethasone (42).
2-M is also expressed in rat
brain; in this case, it seems to be regulated by IL-6 (19). All these
observations suggest that the expression of
2-M may be regulated by more
than one mechanism.
One mechanism that may regulate the expression of
2-M in Hep-AEC cocultures is
the interaction of specific cell surface proteins ("receptors").
The fact that fixed AEC did not sustain the expression of
2-M but permitted the
attachment of Hep suggests that the putative plasma membrane protein or
receptor needs to form clusters on the cell surface or it
is coupled to a signal transduction mechanism. In either case,
metabolically active AEC are required for the expression of
2-M. Another possibility is
that the expression of 2-M is
mediated by gap junctions. Recent studies have shown that cocultures of
Hep and Ito cells preserved several of the most characteristic Hep
functions. In these experiments, Hep and Ito cells were found to be
coupled by gap junctions, as demonstrated by dye transfer experiments
(34). However, no information is available regarding the role of gap
junctional cellular communication in the preservation of hepatic
functions in this coculture model. Ito cells are known to be rich in
gap junctions composed of connexin 43 (17). This connexin is also
abundant in NRK cells (31). Our experiments using this cell line did
not support the expression of
2-M in cocultures with Hep.
Analysis of Xenopus oocytes
transfected with different connexin genes have shown no communication
between gap junctions formed by connexin 43 (present in AEC) and
connexins 32 or 26, which are present in Hep (40). Similar observations have been made in human mammary cells transfected with connexin 43 and
26 genes (36). Consequently, the presence of connexin 43 may not be
sufficient for the expression of
2-M, although we cannot discard
the possibility that it may play a role. Perhaps a secondary molecule
or signal in addition to connexin 43 is necessary for the expression of
2-M. Cellular communication via
gap junctions has also been observed between Hep and hepatic epithelial
cells (11). Other studies have indicated that Hep and hepatic
endothelial cells are coupled by gap junctions (16). Thus further
studies are needed to evaluate the role of gap junctions in Hep-AEC
coculture.
In summary, the data presented in this investigation demonstrate that
the interaction of Hep with endothelial cells induces the expression of
2-M. The expression of this
gene seems to be mediated or enhanced by cell-cell contact between
these cell types. Endothelial cells may modulate Hep gene expression by
the direct physical interaction between different cell types.
Perspectives
The interaction between cells within a organ is a complex and not
well-understood phenomenon that seems to play a major role in the
modulation of gene expression. We have presented evidence suggesting
that endothelial cells could modify gene expression in the Hep by
direct cell contact. Although this may not be a novel mechanism, the
genes that are upregulated in the Hep (e.g., 2-M) are traditionally
expressed in response to soluble factors such as IL-6, which are part
of the inflammatory response. It is possible that this is not a
contradictory observation but, rather, a complementary one. Thus the
association of endothelial cells with Hep may be necessary to prolong
the expression of 2-M after the
transient interaction of IL-6 with the liver. This robust expression of
2-M may serve to neutralize the
inflammatory response, since
2-M is a major cytokine
scavenger. The importance of this observation is based on recent
evidence suggesting that an overwhelming inflammatory response is
detrimental for the organism. It is also possible that the interaction
between endothelial cells and Hep is an alternative for the expression
of 2-M. This protein is not
considered an acute-phase reactant in humans. Consequently, the contact
between endothelial cells and Hep that we have reproduced in our
coculture system may be a reflection of the mechanism operating in
human liver. Regardless of the mechanism and importance of the
expression of 2-M by Hep, the
take-home lesson from our study is that direct cellular contact may be
as important as other classical mechanisms for the modulation of gene
expression.
| |
ACKNOWLEDGEMENTS |
We thank Georg H. Fey for helpful suggestions and the members of
the De Maio laboratory for critically reading the manuscript.
| |
FOOTNOTES |
This work was supported by the Johns Hopkins Clinician Investigator
Award (M. A. Talamini) and The Robert Garrett Research Foundation (A. De Maio). T. G. Buchman was supported by National Institute of General
Medical Sciences Career Development Award GM-00581.
Address for reprint requests: M. A. Talamini, The Johns Hopkins
University School of Medicine, 720 Rutland Ave., Ross 746, Baltimore,
MD 21205.
Received 20 November 1997; accepted in final form 19 March 1998.
| |
REFERENCES |
1.
Bauer, J.,
P. J. Gerbicke-Haerter,
U. Ganter,
I. Richter,
and
W. Gerok.
Astrocytes synthesize and secrete 2M-macroglobulin synthesis in rat liver and brain.
Adv. Exp. Med. Biol.
240:
199-205,
1988[Medline].
2.
Beck, C. S.,
and
A. De Maio.
Stabilization of protein synthesis in thermotolerant cells during heat shock. Association of heat shock protein-72 with ribosomal subunits of polysomes.
J. Biol. Chem.
269:
21803-21811,
1994[Abstract/Free Full Text].
3.
Borth, W.
Biology of 2-macroglobulin, its receptor, and related proteins.
Ann. NY Acad. Sci.
737:
267-272,
1994[Medline].
4.
Chomczynski, P.,
and
N. Sacchi.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:
156-159,
1987[Medline].
5.
Chu, C. T.,
and
S. V. Pizzo.
2-Macroglobulin, complement, and biologic defense: antigens, growth factors, microbial proteases, and receptor ligation.
Lab. Invest.
71:
792-812,
1994[Medline].
6.
Clement, B.,
C. Guguen-Guillouzo,
J.-C. Campion,
D. Glaise,
M. Bourel,
and
A. Guillouzo.
Long-term co-culture of adult human hepatocytes with rat liver epithelial cells: modulation of albumin secretion and accumulation of extracellular material.
Hepatology
4:
373-380,
1984[Medline].
7.
Crookston, K. P.,
D. J. Webb,
B. B. Wolf,
and
S. L. Gonias.
Classification of 2-macroglobulin-cytokine interactions based on affinity of noncovalent association in solution under apparent equilibrium conditions.
J. Biol. Chem.
269:
1533-1540,
1994[Abstract/Free Full Text].
8.
Dajee, M.,
A. V. Kazansky,
B. Raught,
G. M. Hocke,
G. H. Fey,
and
J. S. Richards.
Prolactin induction of the 2-macroglobulin gene in rat ovarian granulosa cells: Stat 5 activation and binding to the interleukin-6 response element.
Mol. Endocrinol.
10:
171-184,
1996[Abstract/Free Full Text].
9.
De Maio, A.
Protein blotting and immunoblotting using nitrocellulose membranes.
In: Protein Blotting: A Practical Approach, edited by B. Dunbar. New York: Oxford University Press, 1994, p. 11-32.
10.
De Maio, A.,
and
T. G. Buchman.
Molecular biology of circulatory shock. IV. Translation and secretion of HepG2 cell proteins are independently attenuated during heat shock.
Circ. Shock
34:
329-335,
1991[Medline].
11.
Diener, B.,
N. Beer,
H. Dürk,
M. Traiser,
D. Utesch,
R. Wieser,
and
F. Oesch.
Gap junctional intercellular communication of cultured rat liver parenchymal cells is stabilized by epithelial cells and their isolated plasma membranes.
Experientia
50:
124-126,
1994[Medline].
12.
Feinberg, A. P.,
and
B. Vogelstein.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem.
132:
6-13,
1983[Medline].
13.
Gershoni, J. M.,
and
G. E. Palade.
Electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to a positively charged membrane filter.
Anal. Biochem.
124:
396-405,
1982[Medline].
14.
Gonias, S. L.,
J. LaMarre,
K. P. Crookston,
D. J. Webb,
B. B. Wolf,
M. B. Lopes,
H. L. Moses,
and
M. A. Hayes.
2-Macroglobulin and the 2-macroglobulin receptor-LRP: a growth regulatory axis.
Ann. NY Acad. Sci.
737:
273-290,
1994[Medline].
15.
Gordon, A. H.
The -macroglobulins of rat serum.
J. Biochem.
159:
643-650,
1976.
16.
Goulet, F.,
C. Normand,
and
O. Morin.
Cellular interactions promote tissue-specific function, biomatrix deposition and junctional communication of primary cultured hepatocytes.
Hepatology
8:
1010-1018,
1988[Medline].
17.
Greenwel, P.,
J. Rubin,
M. Schwartz,
E. Hertzberg,
and
M. Rojkind.
Liver fat-storing cell clones obtained from a CCl4-cirrhotic rat are heterogeneous with regard to proliferation, extracellular matrix components, interleukin-6 and connexin 43.
Lab. Invest.
69:
210-216,
1993[Medline].
18.
Hashimoto, Y.,
S. Hirohata,
T. Kashiwado,
K. Itoh,
and
H. Ishii.
Cytokine regulation of hemostatic property and IL-6 production of human endothelial cells.
Inflammation
16:
613-621,
1992[Medline].
19.
Higuchi, M.,
T. Ito,
Y. Imari,
T. Iwaki,
M. Hattori,
S. Kohsaka,
Y. Niho,
and
Y. Sakaki.
Expression of the 2-macroglobulin-encoding gene in rat brain and cultured astrocytes.
Gene
141:
155-162,
1994[Medline].
20.
Hocke, G. M.,
M.-Z. Cui,
J. A. Ripperger,
and
G. H. Fey.
Regulation of the rat 2-macroglobulin gene by interleukin-6 and leukemia inhibitor factor.
In: Acute Phase Proteins. Molecular Biology, Biochemistry, and Clinical Applications, edited by A. Mackiewicz,
I. Kushner,
and H. Baumann. Boca Raton, FL: CRC, 1993.
21.
Hoffman, M.,
S. R. Feldman,
and
S. V. Pizzo.
2-Macroglobulin fast forms inhibit superoxide production by activated macrophages.
Biochim. Biophys. Acta
760:
421-423,
1993.
22.
Kuri-Harcuch, W.,
and
T. Mendoza-Figueroa.
Cultivation of adult rat hepatocytes on 3T3 cells: expression of various liver differentiated functions.
Differentiation
41:
148-157,
1989[Medline].
23.
Laemmli, V. K.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:
680-685,
1970[Medline].
24.
Lonberg-Holm, K.,
D. L. Reed,
R. C. Roberts,
R. R. Herber,
M. C. Hillman,
and
R. M. Kutney.
Three high molecular weight protease inhibitors of rat plasma isolation characterization and acute phase changes.
J. Biol. Chem.
262:
438-445,
1987[Abstract/Free Full Text].
25.
Loreal, O.,
F. Lavavasseur,
C. Fromaget,
D. Gros,
A. Guillouzo,
and
B. Clement.
Cooperation of Ito cells and hepatocytes in the deposition of an extracellular matrix in vitro.
Am. J. Pathol.
143:
538-544,
1993[Abstract].
26.
Lysiak, J. J.,
I. M. Hussaini,
D. J. Webb,
W. F. Glass,
M. Allietta,
and
S. L. Gonias.
2-Macroglobulin functions as a cytokine carrier to induce nitric oxide synthesis and cause nitric oxide-dependent cytotoxicity in the RAW 264.7 macrophage cell line.
J. Biol. Chem.
270:
21919-21927,
1995[Abstract/Free Full Text].
27.
McGuire, P. G.,
and
R. W. Orkin.
Isolation of rat aortic endothelial cells by primary explant techniques and their phenotypic modulation by defined substrata.
Lab. Invest.
57:
94-105,
1987[Medline].
28.
Misra, U. K.,
C. T. Chu,
G. Gawdi,
and
S. V. Pizzo.
The relationship between low density lipoprotein-related protein-2-macroglobulin (2M) receptors and the newly described 2M signaling receptor.
J. Biol. Chem.
269:
12541-12547,
1994[Abstract/Free Full Text].
29.
Misra, U. K.,
C. T. Chu,
D. S. Rubenstein,
G. Gawdi,
and
S. V. Pizzo.
Receptor recognized 2-macroglobulin methylamine elevates intracellular calcium, inositol phosphates and cyclic AMP in murine peritoneal macrophages.
Biochem. J.
290:
885-891,
1993.
30.
Mosher, D. F.,
and
D. A. Wing.
Synthesis and secretion of 2-macroglobulin by cultures of human fibroblasts.
J. Exp. Med.
143:
462-467,
1976[Abstract/Free Full Text].
31.
Musil, L. S.,
and
D. A. Goodenough.
Biochemical analysis of connexin 43 intracellular transport, phosphorylation, and assembly into gap junctional plaques.
J. Cell Biol.
115:
1357-1374,
1991[Abstract/Free Full Text].
32.
Northemann, W.,
B. R. Shiels,
T. A. Braciak,
R. W. Hanson,
P. C. Heinrich,
and
G. H. Fey.
Structure and acute-phase regulation of the rat 2-macroglobulin gene.
Biochemistry
27:
9194-9203,
1988[Medline].
33.
Ripperger, J. A.,
S. Fritz,
K. Richter,
G. M. Hocke,
F. Lottspeich,
and
G. H. Fey.
Transcription factors Stat3 and Stat5b are present in rat liver nuclei late in acute phase response and bind interleukin-6 response elements.
J. Biol. Chem.
270:
29998-30006,
1995[Abstract/Free Full Text].
34.
Rojkind, M.,
P. M. Novikoff,
P. Greenwel,
J. Rubin,
L. Rojas-Valencia,
A. Campos de Ceballo,
R. Stockert,
D. Spray,
E. L. Hertzberg,
and
A. W. Wolkoff.
Characterization and functional studies on rat liver fat-storing cell line and freshly isolated hepatocyte coculture system.
Am. J. Pathol.
146:
1508-1520,
1995[Abstract].
35.
Takezawa, T.,
M. Yamazaki,
Y. Mori,
T. Yonaha,
and
K. Yoshizato.
Morphological and immuno-cytochemical characterization of a heterospheroid composed of fibroblasts and hepatocytes.
J. Cell Sci.
101:
495-501,
1992[Abstract/Free Full Text].
36.
Tomasetto, C.,
M. J. Neveu,
J. Daley,
P. K. Horan,
and
R. Sager.
Specificity of gap junction communication among human mammary cells and connexin transfectants in culture.
J. Cell Biol.
122:
157-167,
1993[Abstract/Free Full Text].
37.
Van Leuven, F.,
L. Stas,
L. Raymakers,
L. Overbergh,
B. DeStrooper,
C. Hilliker,
K. Loret,
E. Fias,
L. Umans,
S. Torrekens,
L. Serneels,
D. Moechars,
and
H. Van den Berghe.
Molecular cloning and sequencing of the murine 2-macroglobulin receptor cDNA.
Biochim. Biophys. Acta
1173:
71-74,
1993[Medline].
38.
Wanson, J. C.,
P. Drochmans,
R. Mosselmans,
and
M. F. Ronveaux.
Adult rat hepatocytes in primary monolayer culture: ultrastructural characteristics of intercellular contacts and cell membrane differentiations.
J. Cell Biol.
74:
858-877,
1977[Abstract/Free Full Text].
39.
West, M. A.,
G. A. Keller,
B. J. Hyland,
F. B. Cerra,
and
R. L. Simmons.
Further characterization of Kupffer cell-macrophage-mediated alterations in hepatocyte protein synthesis.
Surgery
100:
416-422,
1985.
40.
White, T. W.,
D. L. Paul,
D. A. Goodenough,
and
R. Bruzzone.
Functional analysis of selective interactions among rodent connexins.
Mol. Biol. Cell
6:
459-470,
1995[Abstract].
41.
Zhang, Z.,
N. L. Fuentes,
and
G. M. Fuller.
Characterization of the IL-6 responsive elements in the -fibrinogen gene promoter.
J. Biol. Chem.
270:
24287-24291,
1995[Abstract/Free Full Text].
42.
Zwain, I.,
J. Grima,
M. Stahler,
L. Saso,
J. Cailleau,
G. Verhoeven,
C. Bardin,
and
C. Cheng.
Regulation of Sertoli cells 2-macroglobulin and clusterin (SGP-2) secretion by peritubular myoid cells.
Biol. Reprod.
48:
180-187,
1993[Abstract].
Am J Physiol Regul Integr Compar Physiol 275(1):R203-R211
0002-9513/98 $5.00
Copyright © 1998 the American Physiological Society
Top
Abstract
Introduction
