|
|
||||||||
-MSH and its receptors in regulation of tumor necrosis
factor-
production by human monocyte/macrophages
Departments of 1 Physiology and 5 Anesthesiology and Pain Management, University of Texas Southwestern Medical Center at Dallas, Dallas, Texas 75235-9040; 2 Astra Hassle, 431 83 Molndal, Sweden; 3 Department of Surgery, University of Michigan Medical Center, Ann Arbor, Michigan 48109-0682; and 4 Third Division of Internal Medicine, IRCCS Ospedale Maggiore, Milan, Italy 20122
| |
ABSTRACT |
|---|
|
|
|---|
The
hypothesis that macrophages contain an autocrine circuit based on
melanocortin [ACTH and
-melanocyte-stimulating hormone (
-MSH)] peptides has major implications for
neuroimmunomodulation research and inflammation therapy. To test this
hypothesis, cells of the THP-1 human monocyte/macrophage line were
stimulated with lipopolysaccharide (LPS) in the presence and absence of
-MSH. The inflammatory cytokine tumor necrosis factor (TNF)-
was
inhibited in relation to
-MSH concentration. Similar inhibitory
effects on TNF-
were observed with ACTH peptides that contain the
-MSH amino acid sequence and act on melanocortin receptors. Nuclease protection assays indicated that expression of the human melanocortin-1 receptor subtype (hMC-1R) occurs in THP-1 cells; Southern blots of
RT-PCR product revealed that additional subtypes, hMC-3R and hMC-5R,
also occur. Incubation of resting macrophages with antibody to hMC-1R
increased TNF-
concentration; the antibody also markedly reduced the
inhibitory influence of
-MSH on TNF-
in macrophages treated with
LPS. These results in cells known to produce
-MSH at rest and to
increase secretion of the peptide when challenged are consistent with
an endogenous regulatory circuit based on melanocortin peptides and
their receptors. Targeting of this neuroimmunomodulatory circuit in
inflammatory diseases in which myelomonocytic cells are prominent
should be beneficial.
melanocortin peptides; melanocortin receptors; inflammation; autocrine regulation; neuroimmunomodulation; THP-1 cells; melanocortin-1 receptor antibody;
-melanocyte-stimulating hormone
| |
INTRODUCTION |
|---|
|
|
|---|
THE NEUROIMMUNOMODULATORY peptide
-melanocyte-stimulating hormone (
-MSH), a tridecapeptide derived
from proopiomelanocortin, has remarkable anti-inflammatory effects. The
peptide is antipyretic, and it inhibits all major forms of inflammation
(2, 3, 13). The mechanisms by which its anti-inflammatory influences
occur are not fully known, but they involve direct actions of the
peptide on its receptors in peripheral inflammatory cells; indirect
actions on peripheral inflammation induced by stimulation of
-MSH
receptors within the brain, receptors that give rise to descending
anti-inflammatory pathways; and modulation of brain inflammation via
local action of the peptide on its receptors in glial cells. One avenue
to improvement of understanding of one of the actions of
-MSH in peripheral inflammation is to determine whether the peptide alters inflammatory cell activity by mimicking autocrine regulatory events that occur normally in the cells.
There is initial evidence that both murine (18) and human (17)
monocyte/macrophages have autocrine circuits, based on
-MSH and its
receptors, that modulate their production of inflammatory agents,
thereby limiting local inflammatory processes. In murine macrophages,
-MSH inhibits inflammatory nitric oxide (NO) production by
inhibiting expression of inducible NO synthase (18). These cells
contain mRNA for both the melanocortin (
-MSH- and ACTH-like) receptor MC-1R and for the proopiomelanocortin precursor of
-MSH, and they secrete immunoassayable
-MSH when stimulated with
lipopolysaccharide (LPS) or interferon (IFN)-
plus tumor necrosis
factor (TNF)-
. Cells of the THP-1 human monocyte/macrophage line
make little NO but secrete neopterin, a marker of macrophage activation
(17).
-MSH inhibits neopterin production induced by coculture of
THP-1 cells with IFN-
and TNF-
. These observations raise the
hypothesis that macrophages of human origin contain an endogenous
autocrine anti-inflammatory circuit that depends on the neuropeptide
-MSH and specific melanocortin receptors. This hypothesis was the
focus of the present research.
| |
METHODS |
|---|
|
|
|---|
Cell
line. THP-1 cells were obtained from
the American Type Culture Collection and maintained in stationary
suspension in RPMI 1640 with 7% fetal bovine serum (FBS), 100 U/ml of
penicillin, and 100 µg/ml of streptomycin at 37°C in a humidified
atmosphere of 5% CO2-95% air.
Cells in log phase growth were incubated in RPMI 1640-2% FBS at 5 × 106/ml in 100-mm plastic
Petri dishes with 16 nM phorbol 12-myristate 13-acetate for 48 h to
induce differentiation into macrophages. Nonadherent cells were
aspirated, and adherent cells were released by vigorous pipetting of
cells incubated in Hanks' balanced salt solution without
Ca2+ and
Mg2+ at 4°C. Characteristics
of monocyte differentiation were confirmed by analysis of
cytocentrifuge smears using Wright-Giemsa stain and stain for
endogenous peroxidase activity. Cell viability (>95%) was assayed by
Trypan blue exclusion. The LPS used to promote TNF-
production was
derived from Salmonella
typhosa (Difco Laboratories, no.
0901). For RT-PCR studies, the cells were grown in RPMI 1640 with 10%
FBS in 75-cm2 flasks.
Peptides.
-MSH-(1
13) and
ACTH-(1
24) and -(1
39) were obtained from Sigma Chemical (St. Louis,
MO). The peptides, dissolved in media, were introduced into cell
cultures at the times indicated.
TNF-
and
-MSH
determinations. Concentrations of TNF-
in
supernatants were determined from analysis of L929 fibroblast
cytotoxicity with recombinant human TNF-
(R&D Systems, Minneapolis,
MN) as control and for production of standard curves. Triplicate
samples were incubated overnight with L929 cells in medium containing 100 µg/ml cyclohexamide (Sigma Chemical) in 96-well plates. The TNF-
concentrations were determined with reference to intensity at
550 nm in an ELISA plate reader (BT 2000, Fisher-Biotech). The L929
assay was confirmed to be specific for TNF-
in separate experiments
in which cytotoxicity was blocked completely by TNF-
antibodies.
Each plate contained standards.
-MSH was measured using a commercial
radioimmunoassay kit (Eurodiagnostica, Malmo, Sweden). The sensitivity
of the assay is 0.5 pg/ml. There is no significant cross-reactivity
with related proopiomelanocortin peptides (<0.05%).
S1 nuclease protection assay. Human
melanocortin-1 receptor (hMC-1R) plasmid (Bluescript SK) contained the
951-bp gene encoding the receptor. The plasmid was linearized with
Nar I, yielding a 544-bp fragment.
32P-labeled riboprobe was
transcribed using the Ambion (Austin, TX) MAXIscript protocol and T3
polymerase. The labeled transcript was precipitated with 25 µg tRNA
and twice with ammonium acetate-ethanol. The pellets were dried, and 50 µl of both Tris-EDTA (pH 8.0) and loading buffer were added. The
sample was heated to 95°C for 3-4 min and then subjected to
electrophoresis on a 5% polyacrylamide gel at 50 A for 1 h. The
location of the full-length RNA transcript was determined by
audioradiography; the region was excised and then eluted for 1 h at
65°C in 350 µl elution buffer.
-Actin (Ambion) probe was
included as an internal control to assess the integrity of the RNA; SP6
was used to generate a 240-bp fragment. RNA was isolated from THP-1
cells by guanidinium thiocyanate-phenol-chloroform extraction.
Twenty-five micrograms of RNA were combined with 8 × 105 cpm high-specific-activity
hMC-1R riboprobe, and 1 × 104 cpm low-specific-activity
-actin riboprobe. The samples were then precipitated with ammonium
acetate-ethanol, resuspended in 10 µl hybridization buffer, heated at
95°C for 4 min, and incubated overnight at 45°C in a heating
block. Two hundred microliters of digestion buffer containing 250 U/µl of RNase were added, and the samples were incubated at 37°C
for 1 h. The protected fragments were precipitated, dissolved in 10 µl of loading buffer, heated to 95°C for 4 min, and fractionated
on a 5% polyacrylamide gel. The protected fragments were visualized by
exposure to Kodak X-OMAK film at 70°C with two intensifier screens.
Human melanoma 92.1 used as a positive control for hMC-1R was provided
by Dr. Jerry Niederkorn of the University of Texas Southwestern Medical
Center at Dallas.
RT-PCR and Southern blots for hMC-3R and
hMC-5R. Total RNA (200 µg) was isolated from THP-1
cells by guanidinium thiocyanate-phenol-chloroform extraction. Genomic
DNA was digested with DNase (Promega, Madison, WI) in RT buffer for 30 min at 37°C. The DNase was inactivated by phenol-chloroform
extraction. cDNA was produced using Moloney murine leukemia virus RT
(BRL, Gaithersburg, MD). In some tubes, the RT was omitted to control
for amplification from contaminating cDNA or genomic DNA. Portions of
the cDNA were used for PCR with primer pairs specific for the human
MC-3R and MC-5R isoforms. The hMC-3R forward and reverse primers were
(5' to 3') GTCTACTCGGAGAGCAAAATGG and
TATCCCAAGTTCATGCCGTTGC, respectively. The hMC-5R forward primer was
GGAAGCTTTCTTTGGTAGGCTG, and the reverse primer was
GGTCTAGAGCCACAGAGAGGAG. The primers were chosen in regions of low
similarity among known MC receptors. PCR mixtures contained 1 µM
primers, 1.5 mM Mg2+, 200 µM
dNTPs, 1× reaction buffer, 1 U
Taq DNA polymerase (Promega), and 5 µl cDNA in 20 µl. The PCR profile consisted of 35 cycles of
94°C for 45 s, 60°C for 45 s, and 72°C for 75 s followed by a 5-min final extension at 72°C. The 461-bp hMC-3R and the 1,100-bp hMC-5R were size-fractionated by agarose gel electrophoresis, transferred to nylon filters, and probed with a
32P-random-primed probe
corresponding to the 1,078- and 1,097-bp coding regions of the hMC-3
and hMC-5 receptors, respectively. The blot was hybridized at 68°C
overnight and stringently washed in a final solution of 0.1× SSC
and 0.1% SDS at 68°C for 1 h. The blots were exposed to Kodak
X-OMKR-5 film with one intensifying screen for 2 h at
70°C.
hMC-1R antibody. Polyclonal antibodies specific for hMC-1R were developed and tested in previous research (21). Antisera were raised in rabbits by immunization with peptides that had been synthesized according to the amino acid sequence predicted from the hMC-1R cDNA previously cloned by Chhajlani and Wikberg (6). The peptides were selected to be substantially different from any sequences found in other melanocortin receptors. The antisera immunostained COS-7 cells that expressed hMC-1 but not control cells; malignant melanoma tissues, known to contain hMC-1R, were strongly stained with the antisera whereas melanocytes in normal skin were not. Freeze-dried antisera were reconstituted with pyrogen-free water and diluted with medium before being added to cell cultures. Control experiments were performed with rabbit IgG of the same dilution.
Statistical analysis. Numerical data were analyzed using one-way ANOVA procedures followed by Dunnett's test for multiple comparisons of group means. Two-tail probability <0.05 was considered significant.
| |
RESULTS |
|---|
|
|
|---|
-MSH inhibits TNF-
production by macrophages. THP-1 monocytes secreted
TNF-
at rest, and this production increased when the cells were
converted to macrophages. TNF-
production was increased further by
incubation of the macrophages with LPS. The latter increased production
was inhibited to control values by
-MSH at
10
12 and
10
11 M and to near control
values by lower concentrations of the peptide (Fig.
1). Although there was little difference in
the overall magnitude of the effects of concentrations of the peptide,
the inhibitory effect on TNF-
production was monotonically related to
-MSH concentration. It is notable that the potency of
-MSH in
inhibiting TNF-
in these experiments was substantially greater than
its inhibitory effects on neopterin production by THP-1
monocyte/macrophages noted in previous research (17).
|
ACTH molecules that contain the
-MSH-(1
13) amino acid sequence also inhibit
TNF-
production.
-MSH-(1
13) is
believed to have arisen earlier in evolution than ACTH, and its amino
acid sequence is included within ACTH. To learn whether the larger ACTH
molecule that occurs within the brain and pituitary
[ACTH-(1
39)] or the amino acid sequence that is
responsible for ACTH bioactivity [ACTH-(1
24)] share the
anti-TNF-
effect of
-MSH, the influences of concentrations of all
three peptides were tested in separate experiments (Fig.
2). Comparable basal rates of TNF-
production, and induced increases in TNF-
with LPS, allowed
comparisons of the data in terms of percent inhibition by the peptides.
Regarding sensitivity, an
-MSH concentration of
10
17 M was effective,
whereas slightly greater concentrations of the ACTH molecules were
required to cause substantial inhibition. With the higher
concentrations of all three peptides, the maximum magnitude of the
inhibitory effect was similar: a reduction of ~60% below the control
TNF-
value obtained when the cells were incubated with LPS and
without any peptide.
|
Melanocortin receptor expression in THP-1
cells. The inhibitory effects of melanocortin peptides
described above must stem from activation of melanocortin receptors.
There was evidence of three melanocortin receptor subtypes in these
cells: hMC-1R, -3R, and -5R. S1 nuclease protection assays of RNA from
THP-1 cells repeatedly revealed positive signals for hMC-1R mRNA (Fig. 3). This evidence supports our earlier
observation (17) of transcripts for this receptor in THP-1 cells
obtained using probes hybridized to Southern blots of RT-PCR product.
Transcription of the MC-1R subtype is thus abundant enough in
macrophages to be detected with nuclease protection assays. To test the
idea that the
-MSH receptors MC-3R and hMC-5R, known to occur in
brain tissue (9) and elsewhere, are likewise expressed in macrophages,
RNA of THP-1 cells was subjected to RT-PCR and Southern analysis.
Repeated analyses revealed detectable signals at 431 bp, consistent
with the size of the cDNA for the hMC-3R (Fig.
4), and substantial signals at 1,100 bp,
consistent with cDNA for hMC-5R.
|
|
hMC-1R antibody promotes TNF-
and
inhibits
-MSH activity. Production of
TNF-
by resting THP-1 cells increased with increasing concentrations
of hMC-1R antibody (Fig. 5). This increase
is presumed to reflect blockade of an autocrine TNF-
regulatory
circuit based on endogenous production of
-MSH. Production of
-MSH by THP-1 cells at rest was established previously (17).
However, these observations were repeated in the present experiments by
measuring
-MSH production by unstimulated THP-1 cells (2 × 106/ml) over 24 h. Unstimulated
production of
-MSH averaged 10 pg/ml over five determinations. From
the data of Fig. 1, two concentrations of
-MSH,
10
14 and
10
13 M, were selected for
tests with hMC-1R antibody. As in experiments above, both
concentrations of peptide inhibited TNF-
production when no antibody
was added. However, this inhibition was progressively reduced with
increasing concentrations of hMC-1R antibody. Indeed, the greatest
concentration of antibody caused not only a reversal of the inhibitory
effect of
-MSH but also an enhancement of TNF-
production,
presumably the result of its anti-hMC-1R activity against receptors
that are required for control of TNF-
production by endogenously
produced
-MSH.
|
| |
DISCUSSION |
|---|
|
|
|---|
The results are consistent with the hypothesis that
monocyte/macrophages have an autocrine mechanism for modulating release of the inflammatory cytokine TNF-
. This circuit is based on the neuropeptide
-MSH, perhaps other melanocortins, and endogenous melanocortin receptors. The present data and prior evidence indicate that
-MSH is important to monocyte/macrophage regulation of three proinflammatory agents: NO (18), neopterin (17), and TNF-
(present
results). Support for an autocrine modulation was obtained from
nuclease protection assays and Southern analyses, which indicated that
human macrophages express melanocortin receptors hMC-1R, -3R, and -5R.
It is likely that one or more of these receptor subtypes participate in
regulating TNF-
in macrophages. The hMC-1R may be of particular
importance because antibodies to this receptor promoted TNF-
in
resting macrophages, decreased the inhibitory effect of
-MSH, and
enhanced TNF-
production in those cells stimulated with LPS. THP-1
monocyte/macrophages produce
-MSH essential to an autocrine circuit;
the peptide is produced by resting cells, and its concentration is
increased when the cells are stimulated with LPS and/or inflammatory
cytokines (17). Thus all factors required for autocrine modulation via
-MSH appear to occur in human macrophages: TNF-
is modulated by
-MSH, the cells express melanocortin receptor mRNA and produce the
-MSH neuropeptide, and anti-hMC-1R antibodies promote TNF-
in
resting cells and reduce the inhibitory effect of
-MSH on TNF-
in
stimulated cells. This conjectured autocrine circuit, first proposed in
human cells to control neopterin (17), may have a reverse counterpart in melanoma cells known to bear hMC-1R and to produce the peptide (14).
In melanoma cells, melanocortins increased release of immunoreactive
-MSH. Transfection of hMC-1R DNA into IGR3 cells increased
-MSH
release, which was further increased by melanocortin peptides that
compete for binding with
-MSH. The importance of such a promotional
or enhancing influence on
-MSH release was not established, although
-MSH is important to melanogenesis and proliferation of melanocytes
and melanoma cells.
In tests of the inhibitory effects of
-MSH and ACTH molecules, the
similarity in effects on TNF-
was notable. It is known that
macrophages produce immunoreactive ACTH-(1
24) (15); this proopiomelanocortin derivative may share in autocrine regulation of
macrophage activity. Phagocytosis of latex beads by peritoneal macrophages was inhibited by ACTH-(1
24) (10), which supports the
functional significance of melanocortin receptors to control of
macrophage activity. Because all of the melanocortin receptor subtypes
identified so far bind and react to ACTH molecules (19), any one of the
subtypes, all or a combination, or perhaps melanocortin receptors yet
to be discovered, may be responsible for the reaction to ACTH molecules
found in these experiments. With regard to those receptors for which we
found evidence in the present experiments,
-MSH was previously
observed to be more effective than ACTH in inducing cAMP in cells
transfected with cDNA for hMC-1R (6). However, the peptides were
equivalent in inducing cAMP in L cells transfected with cDNA for hMC-3R
(9). In COS-7 cells transfected with hMC-5R DNA, binding of
-MSH and
ACTH-(1
39) was equivalent, although affinity for melanocortin
peptides was much lower than for hMC-1R in prior studies (5). From
these observations, MC-1R, -3R, and -5R could all contribute to the
equivalence in TNF-
inhibition caused by
-MSH-(1
13),
ACTH-(1
24), and ACTH-(1
39), with perhaps a predominant contribution
of hMC-3R and hMC-5R. Our observations highlight the importance of
hMC-1R in macrophages but leave unexplained the precise contribution of
each receptor subtype to the overall anti-inflammatory circuit in
macrophages. Such an explanation can be determined with application of
antibodies to specific receptor subtypes, singly and in combination.
In the history of research on peptide receptors it is common to
initially find one receptor subtype in a specific cell type and to
subsequently discover that other subtypes occur in the same cells. For
example, in the case of opioid receptors, the µ-receptor was the
first to be described and the discovery of other subtypes followed, so
that now multiple opioid receptors are known in the same cells. A
similar history may be in progress with regard to melanocortin
receptors. So far five receptor subtypes have been described and others
are likely to be discovered. The present results indicate that multiple
melanocortin receptor subtypes exist in the same macrophages. It should
be noted that our results differ from those of Bhardwaj et al. (1), who
observed evidence for only MC-1R in human peripheral blood mononuclear
cells. The reasons for this difference are not clear but likely lie in
the difference between the cell types. If, as our evidence suggests, there are different receptor subtypes in macrophages, what functional significance might they have? All respond to
-MSH, so the reason is
not likely to stem from differences in response to this ligand. If the
receptor subtypes induce different second messengers they could mediate
divergent signals, but the evidence indicates that all of the receptor
subtypes induce intracellular cAMP. MC-3R, however, also signals
through inositol trisphosphate (11). Other signaling pathways may also
be activated by melanocortin receptor (19). Also, at this point there
is no evidence that any receptor subtype has a unique role in function
that is not shared by the others. To study such a possibility will
require blockade of all receptor subtypes but one in a cell type.
The evidence of an autocrine circuit in host cells that is based on a
neuropeptide and its receptors is a further example of the commonality
of peptide signal mechanisms present in the nervous system, endocrine
system, and in peripheral inflammatory cells.
-MSH is an ancient
peptide, and its amino acid sequence has been highly conserved in
evolution; the peptide is ubiquitous in the animal kingdom, and its
amino acid sequence is observed in tissues of modern animals (hagfish,
lamprey) that originated during the Pennsylvanian period of the
Paleozoic era (8). This conservation of amino acid sequence over eons
and across phyla, together with the marked capacity of
-MSH to
modulate inflammation, an ancient host reaction, suggests that the
peptide developed very early to modulate inflammatory responses and
that it has continued to be incorporated in similar functions over
evolution. Support for this idea comes from the consistency of the
anti-inflammatory effect of the peptide on stimulation of its receptors
in different cell/tissue types.
-MSH modulates peripheral
inflammation via direct actions on host cells such as macrophages (17,
18) and neutrophils (4). The peptide modulates inflammation within the
brain (16), likely by acting on microglia (7) and astrocytes (20).
Furthermore, through actions on neuronal receptors,
-MSH induces
signals in descending anti-inflammatory pathways that modulate
inflammatory processes in the periphery (12). It is likely that the
peptide acts via all these mechanisms in intact organisms. Prominence
of melanocortins in a macrophage autocrine circuit suggests that the
peptides have come to be incorporated in local anti-inflammatory
systems that represent a "layer" of melanocortin control over
inflammation, one layer of a multilayered control system.
| |
ACKNOWLEDGEMENTS |
|---|
This research was supported by National Institute of Neurological Disorders and Stroke Grant NS-10046; IX Progetto AIDS (9403-30), Progetto Sclerosi Multipla (96/J/T9), Istituto Superiore di Sanita', Italy; and NATO Collaborative Research Grant No. CGR. 950556.
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: J. M. Lipton, Univ. of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75235-9040 (E-mail: jlipto{at}mednet.swmed.edu).
Received 10 August 1998; accepted in final form 12 January 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Bhardwaj, R.,
E. Becher,
K. Mahnke,
M. Hartmeyer,
T. Schwarz,
T. Scholzen,
and
T. A. Luger.
Evidence for the differential expression of the functional alpha-melanocyte-stimulating hormone receptor MC-1 on human monocytes.
J. Immunol.
158:
3378-3384,
1997[Abstract].
2.
Catania, A.,
and
J. M. Lipton.
The neuropeptide alpha-melanocyte-stimulating hormone: a key component of neuroimmunomodulation.
Neuroimmunomodulation
1:
93-99,
1994[Medline].
3.
Catania, A.,
and
J. M. Lipton.
-Melanocyte stimulating hormone in the modulation of host reactions.
Endocr. Rev.
14:
564-576,
1993
4.
Catania, R.,
N. Rajora,
F. Capsoni,
F. Minonzio,
R. A. Star,
and
J. M. Lipton.
The neuropeptide
-MSH has specific receptors on neutrophils and reduces chemotaxis in vitro.
Peptides
17:
675-679,
1996[Medline].
5.
Chhajlani, V.,
R. Muceniece,
and
J. E. Wikberg.
Molecular cloning of a novel human melanocortin receptor.
Biochem. Biophys. Res. Commun.
195:
866-873,
1993[Medline].
6.
Chhajlani, V.,
and
J. E. S. Wikberg.
Molecular cloning and expression of the human melanocyte stimulating hormone receptor cDNA.
FEBS Lett.
309:
417-420,
1992[Medline].
7.
Delgado, R.,
A. Carlin,
L. Airaghi,
M. T. Demitri,
L. Meda,
D. Galimberti,
P. L. Baron,
J. M. Lipton,
and
A. Catania.
Melanocortin peptides inhibit production of proinflammatory cytokines and nitric oxide by activated microglia.
J. Leukoc. Biol.
63:
740-745,
1998[Abstract].
8.
Eberle, A. N.
The Melanotropins. Basel: Karger, 1988.
9.
Gantz, I.,
Y. Konda,
T. Tashiro,
Y. Shimoto,
H. Miwa,
G. Munzert,
S. J. Watson,
J. Del Valle,
and
T. Yamada.
Molecular cloning of a novel melanocortin receptor.
J. Biol. Chem.
268:
8246-8250,
1993
10.
Ichinose, M.,
M. Sawada,
and
T. Maeno.
Suppression of phagocytosis by adrenocorticotropic hormone in murine peritoneal macrophages.
Immunol. Lett.
42:
161-165,
1994[Medline].
11.
Konda, Y.,
I. Gantz,
J. Del Valle,
Y. Shimoto,
H. Miwa,
and
T. Yamada.
Interaction of dual intracellular signaling pathways activated by the melanocortin-3 receptor.
J. Biol. Chem.
269:
13162-13166,
1994
12.
Lipton, J. M.,
and
A. P. Catania.
Antiinflammatory influence of the neuroimmunomodulator
-MSH.
Immunol. Today
18:
140-145,
1997[Medline].
13.
Lipton, J. M.,
G. Ceriani,
A. Macaluso,
D. McCoy,
K. Carnes,
J. Biltz,
and
A. Catania.
Antiinflammatory effects of the neuropeptide
-MSH in acute, chronic, and systemic inflammation.
Ann. NY Acad. Sci.
741:
137-148,
1994[Medline].
14.
Loir, B.,
B. Bouchard,
R. Morandini,
V. Del Marmol,
R. Deraemaecker,
J. C. Garcia-Borron,
and
G. Ghanem.
Immunoreactive alpha-melanotropin as an autocrine effector in human melanoma cells.
Eur. J. Biochem.
244:
923-930,
1997[Medline].
15.
Lyons, P. D.,
and
J. E. Blalock.
The kinetics of ACTH expression in rat leukocyte subpopulations.
J. Neuroimmunol.
53:
103-112,
1995.
16.
Rajora, N.,
G. Boccoli,
D. Burns,
S. Sharma,
A. P. Catania,
and
J. M. Lipton.
-MSH modulates local and circulating TNF
in experimental brain inflammation.
J. Neurosci.
17:
2181-2186,
1997
17.
Rajora, N.,
G. Ceriani,
A. Catania,
R. A. Star,
M. T. Murphy,
and
J. M. Lipton.
-MSH production, receptors, and influence on neopterin in a human monocyte/macrophage cell line.
J. Leukoc. Biol.
59:
248-253,
1996[Abstract].
18.
Star, R. A.,
N. Rajora,
J. Huang,
R. C. Stock,
A. Catania,
and
J. M. Lipton.
Evidence of autocrine modulation of macrophage nitric oxide synthase by alpha-melanocyte-stimulating hormone.
Proc. Natl. Acad. Sci. USA
92:
8016-8020,
1995
19.
Tatro, J. B.
Receptor biology of the melanocortins, a family of neuroimmunomodulatory peptides.
Neuroimmunomodulation
3:
259-284,
1997.
20.
Wong, K. Y.,
N. Rajora,
A. P. Catania,
and
J. M. Lipton.
A mechanism of antiinflammatory action of
-MSH peptides within the brain: modulation of TNF-
production by human glioma cells.
Neuroimmunomodulation
4:
37-41,
1997[Medline].
21.
Xia, Y.,
V. Skoog,
R. Muceniece,
V. Chhajlani,
and
J. E. S. Wikberg.
Polyclonal antibodies against human melanocortin MC1 receptor and malignant melanoma cells.
Eur. J. Pharmacol.
288:
277-283,
1995[Medline].
This article has been cited by other articles:
![]() |
A. Laviano, A. Inui, D. L. Marks, M. M. Meguid, C. Pichard, F. Rossi Fanelli, and M. Seelaender Neural control of the anorexia-cachexia syndrome Am J Physiol Endocrinol Metab, November 1, 2008; 295(5): E1000 - E1008. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Pierroz, M. Ziotopoulou, L. Ungsunan, S. Moschos, J. S. Flier, and C. S. Mantzoros Effects of Acute and Chronic Administration of the Melanocortin Agonist MTII in Mice With Diet-Induced Obesity Diabetes, May 1, 2002; 51(5): 1337 - 1345. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Barcellini, G. Colombo, L. La Maestra, G. Clerici, L. Garofalo, A. T. Brini, J. M. Lipton, and A. Catania {alpha}-Melanocyte-stimulating hormone peptides inhibit HIV-1 expression in chronically infected promonocytic U1 cells and in acutely infected monocytes J. Leukoc. Biol., November 1, 2000; 68(5): 693 - 699. [Abstract] [Full Text] |
||||
![]() |
L. Airaghi, L. Garofalo, M. G. Cutuli, R. Delgado, A. Carlin, M. T. Demitri, S. Badalamenti, G. Graziani, J. M. Lipton, and A. Catania Plasma concentrations of {alpha}-melanocyte-stimulating hormone are elevated in patients on chronic haemodialysis Nephrol. Dial. Transplant., August 1, 2000; 15(8): 1212 - 1216. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. T. Iida, H. Shimano, Y. Kawakami, H. Sone, H. Toyoshima, S. Suzuki, T. Asano, Y. Okuda, and N. Yamada Insulin Up-regulates Tumor Necrosis Factor-alpha Production in Macrophages through an Extracellular-regulated Kinase-dependent Pathway J. Biol. Chem., August 24, 2001; 276(35): 32531 - 32537. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |