INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

LIMITATION OF ISCHEMIC injury by pharmacological strategies has important clinical relevance. A number of studies have demonstrated that infusion of catecholamines or induction of the release of endogenous catecholamines induces immediate cardioprotection by ₁-adrenoceptor-mediated mechanisms (4, 5, 9, 14, 18, 22, 23, 28, 38, 39). We have previously observed that norepinephrine (NE) induces delayed cardioprotection against postischemic dysfunction in rats at 24 h after administration and that this delayed adaptive response is also mediated by ₁-adrenoceptors (24). Therefore, it is likely that administration of NE to an intact animal induces two myocardial adaptive responses that are adrenoceptor dependent but temporally distinct (early and delayed).

Cardiac ₁-adrenoceptors are coupled with protein kinase C (PKC) isozymes through phospholipase activities (36, 37). Recent studies have indicated that PKC likely plays an important role in ischemic preconditioning (14, 28, 30, 35, 39, 42). Our previous studies have shown that the immediate cardioprotection induced by the ₁-adrenoceptor agonist phenylephrine in the isolated rat heart could be blocked by the specific PKC inhibitor chelerythrine (3, 28). It is unknown whether in vivo induction of myocardial adaptation by NE is dependent on PKC.

Cardiac gene expression and de novo protein synthesis may be involved in the delayed myocardial adaptation induced by NE (24, 27). The delayed myocardial adaptation induced by lipopolysaccharide is preceded by altered expression of heat shock protein 70, myosin heavy chain (MHC), and sarcomeric -actin in the myocardium (26). We have observed that in vivo NE treatment induces the overexpression of heat shock protein 70 mRNA in the rat heart (24). It is likely that the delayed myocardial adaptation induced by NE involves reprogramming of cardiac expression of heat shock protein 70 as well as MHC and sarcomeric -actin. Indeed, noradrenergic receptors regulate the expression of -MHC and skeletal -actin isogenes in cultured neonatal rat cardiac myocytes (17). The in vivo effects of NE on the expression of MHC and sarcomeric -actin isogenes in the mature myocardium remain to be defined.

PKC isozymes redistribute in subcellular compartments upon activation, and the involvement of a certain isozyme appears to be stimulus specific (3, 11, 28, 30). Studies using neonatal rat cardiac myocyte culture have demonstrated that a PKC- isozyme translocates into the nucleus in response to the stimulation by phorbol ester or NE (11, 29). Furthermore, a PKC- isozyme has been implicated as an important factor involved in the noradrenergic regulation of expression of -MHC and skeletal -actin isogenes in cultured neonatal rat cardiac myocytes (16, 17). Although mature rat myocardium may not express PKC-II (7, 8), the presence of PKC-I isozyme in adult rat heart or cardiac myocytes has been suggested by several studies (40, 41, 44). However, the subcellular distribution of PKC-I in the mature myocardium is not clear. It is possible that, in the intact heart, intranuclear translocation of PKC-I transduces the adaptation signal to genes after NE treatment. Examination of the response of this PKC isozyme to NE and its relationship with the expression of fetal MHC and sarcomeric -actin isogenes is important to explore the mechanisms underlying the delayed myocardial adaptation to ischemia.

We hypothesized that in vivo NE treatment may induce bimodal cardioprotection against postischemic dysfunction, which is regulated by ₁-adrenoceptors and PKC and is associated with reprogramming of cardiac gene expression. The purposes of this study were to examine 1) whether in vivo NE treatment induces an early and a delayed myocardial adaptive response; 2) the roles of ₁-adrenoceptors and PKC in NE-induced myocardial adaptive responses; 3) the relationship between the delayed myocardial adaptive response and the expression of fetal sarcomeric -actin and MHC isogenes; and 4) whether the expression of fetal sarcomeric -actin and MHC isogenes is preceded by PKC-I redistribution.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Animals. Male Sprague-Dawley rats, body weight 300-350 g (Sasco, Omaha, NE), were acclimated in a quarantine room and maintained on a standard pellet diet for 2 wk before initiation of the experiments. One hundred and eight animals were used in this study. All animal experiments were approved by the Animal Care and Research Committee, University of Colorado Health Sciences Center. All animals received humane care in compliance with the Guide for the Care and Use of Laboratory Animals [Department of Health, Education, and Welfare Publication no. National Institutes of Health (NIH) 85-23, revised 1985, Office of Science and Health Reports, DRR/NIH, Bethesda, MD 20205].

Chemicals and reagents. NE was purchased from Sanofi Winthrop Pharmaceuticals (New York, NY). Chelerythrine was obtained from LC Laboratories (Woburn, MA). Oligonucleotide probes to rat cardiac -actin (GGGAGATGGGAGAGGGCCTCAGAGGATTCC, complementary to nucleotides 39-68 of 3'-untranslated region; see Refs. 21 and 43) and rat skeletal -actin (AGAGAGAGCGCGTACACAGACGCGGTGCGC, complementary to nucleotides 1-30 of 3'-untranslated region; see Refs. 21 and 43) were synthesized by the Department of Biochemistry of Colorado State University and have been demonstrated to be specific to their corresponding mRNA species (26). Oligonucleotide probes to rat -MHC and rat -MHC were obtained from Oncogene Science (Uniondale, NY). cDNA complimentary to 28S rRNA was purchased from American Type Culture Collection (Rockville, MD). Radioactive nucleotides were purchased from DuPont NEN Research Products (Boston, MA). T4 polynucleotide kinase, DNase, and DNA polymerase were obtained from New England Biolabs (Boston, MA). Tissue freezing medium was purchased from Triangle Biomedical Sciences (Durham, NC). A rabbit polyclonal antibody against PKC-I was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). It is raised against PKC-I epitope EFAGFSYTNPEFVINV (corresponding to amino acids 656-671) and does not cross-react with other PKC isozymes. Indocarbocyanine (Cy3)-labeled goat anti-rabbit IgG was purchased from Jackson ImmunoResearch Laboratories (West Grove, PA). Fluorescein-labeled wheat germ agglutinin was purchased from Molecular Probes (Eugene, OR). All other chemicals and reagents were purchased from Sigma Chemical (St. Louis, MO).

Experimental protocols. To examine whether in vivo NE treatment induces temporally bimodal myocardial adaptation to ischemia, 32 rats were treated with NE (25 µg/kg iv), and 8 rats were treated with normal saline (0.4 ml iv). Eight NE-treated and two saline-treated animals were killed at 30 min, 1 h, 4 h, or 24 h after treatment, and isolated hearts were subjected to global ischemia-reperfusion (I/R) via a Langendorff apparatus. The effects of ₁-adrenoceptor antagonism and PKC inhibition on myocardial adaptation were assessed by pretreatment of two groups of animals (12 each) with the ₁-adrenoceptor antagonist prazosin (dissolved in 5% ethanol; 0.25 mg/kg ip, 10 min) and the specific PKC inhibitor chelerythrine (dissolved in distilled water; 2.0 mg/kg iv, 5 min) followed by NE treatment. Six animals from each group were killed 30 min or 24 h after NE treatment. Isolated hearts were subjected to I/R. Two additional groups of rats (8 each) were treated with prazosin or chelerythrine, without subsequent NE treatment, and served as agent controls. Four animals from each group were killed at 35-40 min or 24 h after treatment. Isolated hearts were subjected to I/R.

To examine the effects of NE on cardiac mRNAs encoding skeletal -actin, cardiac -actin, -MHC, and -MHC, nine rats were treated with NE (25 µg/kg iv), and three rats were treated with normal saline (0.4 ml iv). Three NE-treated rats and a saline-treated rat were killed at 4, 6, and 24 h after treatment. Hearts were rapidly excised, and coronary vessels were flushed by retrograde perfusion with 10 ml of cold PBS. Ventricular tissue was frozen in liquid nitrogen and stored at 70°C for Northern analysis of cardiac -actin, skeletal -actin, -MHC, and -MHC mRNAs.

A group of six rats was treated with NE (25 µg/kg iv), and another group of four rats was treated with normal saline (0.4 ml iv). Three NE-treated rats and two saline-treated rats were killed at 10 or 30 min after treatment for the examination of PKC-I subcellular distribution in ventricular myocardium. Hearts were rapidly excised, and coronary vessels were flushed by retrograde perfusion with 10 ml of cold PBS. Ventricular myocardium were embedded in tissue freezing medium, frozen in dry ice-cooled isopentane, and stored at 70°C for immunofluorescent localization of PKC-I.

Measurement of hemodynamics. The effect of NE on hemodynamics, with or without pretreatment, was examined in 16 anesthetized rats. Hemodynamic measurement was carried out as described previously (24). Briefly, rats were anesthetized (50 mg/kg of pentobarbital sodium ip) and heparinized (200 units of heparin sodium ip). The right femoral artery was cannulated with PE-50 tubing (Becton Dickinson, Parsippany, NJ). Heart rate and arterial pressure were continuously recorded with a computerized pressure amplifier/digitizer (Maclab/8, AD Instrument, Cupertino, CA, and Macintosh Quadra 800, Apple Computer, Cupertino, CA). After 20 min of equilibration, four rats were treated with NE (25 µg/kg iv), and four rats were treated with normal saline (0.4 ml iv). Heart rate and arterial pressure were monitored for 30 min after treatment. The effects ₁-antagonism and PKC inhibition on NE-induced hemodynamic changes were examined by administration of prazosin (0.25 mg/kg ip, 10 min) and chelerythrine (2.0 mg/kg iv, 5 min) to two groups of animals (4 each) before NE treatment.

Isolated heart perfusion. Isolated hearts were perfused by the isovolumetric Langendorff technique as described previously (24, 27). Rats were anesthetized (50 mg/kg of pentobarbital sodium ip) and heparinized (300 units of heparin sodium ip). Hearts were rapidly excised in oxygenated, ice-cold perfusate and perfused through aortic root. The isolated perfusion was carried out in nonrecirculating mode at a constant pressure of 70 mmHg with Krebs-Henseleit solution containing (in mM) 5.5 glucose, 119 NaCl, 25 NaHCO₃, 1.2 CaCl₂, 4.7 KCl, 1.17 MgSO₄, and 1.18 KH₂PO₄. Perfusate was saturated with a gas mixture of 92.5% O₂-7.5% CO₂, achieving PO₂ of ~450 mmHg, PCO₂ ~40 mmHg, and pH 7.4. A water-filled latex balloon was inserted through the left atrium in the left ventricle. The volume of the balloon was adjusted to achieve a left ventricular end-diastolic pressure of 5-10 mmHg during the initial equilibration, after which no further change was made in the balloon volume. Pacing wires were fixed to the right atrium, and all hearts were paced at 350 beats/min (6.0 Hz, 3.0 V). After 15 min of equilibration, hearts were subjected to 25 min of normothermic global ischemia followed by 40 min of reperfusion. During ischemia, hearts were placed in an organ bath chamber (37°C) without pacing. Left ventricular developed pressure (LVDP) and left ventricular end-diastolic pressure were continuously recorded with a pressure transducer connected to the computerized pressure amplifier/digitizer (Maclab/8, AD Instrument and Macintosh Quadra 800, Apple Computer).

RNA extraction and Northern analysis. Total RNA was extracted with the previously described method (24-26). After homogenization of the ventricular tissue in guanidinium thiocyanate solution, total RNA was subsequently extracted by phenol and chloroform. RNA samples (10 µg) were size separated by electrophoresis on denatured 1% agarose gel, and then Northern blotting was carried out by vacuum transfer (Stratagene Cloning Systems, La Jolla, CA) on a nylon membrane in 1.5 M of sodium chloride/1.5 M of sodium citrate, pH 7.0. Cross-linking was performed with an ultraviolet cross-linker (Stratagene Cloning Systems). Cardiac -actin, skeletal -actin, -MHC, and -MHC mRNAs were detected with oligonucleotide probes complementary to the rat messengers. The oligonucleotides were labeled with [-³²P]ATP by 5'-end labeling, and hybridization was performed overnight at 65°C. A cDNA probe labeled with [-³²P]CTP by nick translation was applied to detect 28S rRNA, and hybridization was performed overnight at 42°C. After hybridization, membranes were washed with 0.3 M sodium chloride-0.3 M sodium citrate-0.1% SDS, pH 7.0, for 30 min at 65°C (for membranes probed with oligonucleotide probes) or 55°C (for membranes probed with cDNA) and then with 0.15 M sodium chloride-0.15 M sodium citrate-0.1% SDS, pH 7.0, for 10 min at room temperature. Autoradiography was accomplished with Kodak X-Omat films at 70°C. For each experiment, hybridization was performed sequentially on the same membrane, and the hybridized probe was stripped off by boiling the membrane in distilled water. Densitometric measurement was carried out with a computerized laser densitometer (Molecular Dynamics, Sunnyvale, CA), and the density of each band of interest was normalized against its corresponding 28S rRNA band.

Immunofluorescent staining. Immunofluorescent localization of PKC-I was performed with the indirect immunofluorescence technique as described previously (28). Transverse sections (5 µm thick) of ventricular myocardium were cut with an IEC cryotome (Minotome Plus, Needham Heights, MA) and then dried at room temperature for 2 h. Sections were treated with a mixture of 30% methanol and 70% acetone at 20°C for 10 min and washed with PBS. Next, the sections were fixed in PBS-buffered 4% paraformaldehyde at room temperature for 20 min and washed with PBS. Unless indicated, all incubations were performed at room temperature. To block nonspecific binding sites, sections were incubated for 30 min with 10% goat serum in PBS. Sections were then incubated for 90 min with a rabbit polyclonal antibody against PKC-I (5 µg/ml in PBS containing 1% BSA). After three washes with PBS, sections were incubated for 45 min with Cy3-labeled goat anti-rabbit IgG (1:250 dilution with PBS containing 1% BSA). After thorough washes with PBS, sections were counterstained with fluorescein-labeled wheat germ agglutinin (5 µg/ml, for cell surface staining) and bis-benzimide (2.5 µg/ml, for nuclear staining). The sections were then mounted with aqueous anti-quenching media. To ascertain the specificity of this antibody for immunofluorescent staining, adjacent sections were incubated with antibody neutralized with PKC-I peptide or nonimmune rabbit IgG (5 µg/ml in PBS containing 1% BSA) in replacement of the primary antibody and then processed in identical conditions. Microscopic observation and photography were performed with a Leica DMRXA microscope.

Statistical analysis. Hemodynamic parameters, indexes of cardiac function, and RNA band density were expressed as means ± SE. Differences between groups were assessed by ANOVA and were considered significant with P < 0.05 verified by Bonferroni/Dunn post hoc test.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Effects of NE on hemodynamics in anesthetized rats. No significant changes in hemodynamic parameters were observed in anesthetized, saline-treated rats over a period of 30 min. Intravenous administration of NE caused an increase in mean arterial pressure that lasted <5 min (Fig. 1). Although increased heart rate was observed from 1 to 5 min after injection of NE, the differences in heart rate from saline control values were not significant. The influences of prazosin and chelerythrine on NE-induced hemodynamic changes are presented in Fig. 1. The ₁-adrenoceptor antagonist prazosin decreased the basal mean arterial pressure and abolished NE-induced elevation of mean arterial pressure. PKC inhibition by chelerythrine resulted in a transient decrease in basal mean arterial pressure. Chelerythrine also shortened the duration of NE-induced elevation of mean arterial pressure.

View larger version (20K): [in this window] [in a new window]   Fig. 1.   Effects of 1-adrenoceptor antagonism and protein kinase C (PKC) inhibition on norepinephrine (NE)-induced hemodynamic changes. Rats were anesthetized (50 mg/kg of pentobarbital sodium ip), and the right femoral artery was cannulated for hemodynamic measurement. Prazosin (Praz; 0.25 mg/kg iv, 10 min) and chelerythrine (Chel; 2.0 mg/kg iv, 5 min) were administered before NE (25 µg/kg iv, at time 0) treatment. Values represent mean arterial pressure (MAP). NE induced a transient increase in MAP. Prazosin decreased basal MAP and abolished NE-induced MAP elevation. Chelerythrine caused a transient decrease in basal MAP and shortened the duration of NE-induced MAP elevation. Data are presented as means ± SE; n = 4 rats in each group; * P < 0.05 vs. saline control.

Time course of NE-induced cardioprotection against postischemic dysfunction. LVDP recovered to 42.4 ± 3.2 mmHg in the combined saline control group after I/R. Treatment with NE 30 min before heart isolation resulted in a 50% improvement in postischemic myocardial contractility (LVDP 63.4 ± 4.8 mmHg after I/R, P < 0.05 vs. saline control, Fig. 2). The myocardial adaptive response vanished at 1 h post-NE treatment (LVDP 48.8 ± 7.5 mmHg after I/R, P > 0.05 vs. saline control). However, cardiac resistance to postischemic dysfunction was present again at 4 and 24 h after NE treatment (LVDP 70.6 ± 3.8 and 64.9 ± 5.2 mmHg, respectively, after I/R, both P < 0.05 vs. saline control, Fig. 2).

View larger version (19K): [in this window] [in a new window]   Fig. 2.   Time course of NE-induced cardioprotection against postischemic dysfunction. Rats were treated with NE (25 µg/kg iv) or normal saline (control; 0.4 ml iv). Hearts were isolated and subjected to global ischemia-reperfusion (25/40 min) at 30 min, 1 h, 4 h, and 24 h after treatment. Left ventricular developed pressure (LVDP) was assessed before ischemia (baseline) and at the end of reperfusion (postischemic). Treatment with NE 30 min, 4 h, or 24 h before heart isolation improved postischemic LVDP recovery. However, postischemic LVDP recovery was not improved at 1 h after NE treatment. Data are means ± SE; n = 8 hearts in each group. * P < 0.05 vs. saline control.

Effects of ₁-adrenoceptor antagonism and PKC inhibition on the early adaptive response. Two groups of rats were treated with prazosin and chelerythrine, respectively, before NE treatment, and their hearts were subjected to I/R 30 min after NE treatment. As shown in Fig. 3, the early myocardial adaptive response was abolished by a pretreatment with either prazosin or chelerythrine (LVDP 47.0 ± 8.7 and 48.1 ± 8.0 mmHg, respectively, after I/R, both P > 0.05 vs. saline control). Neither of these two agents affected postischemic LVDP when they were administered alone 35-40 min before heart isolation.

View larger version (21K): [in this window] [in a new window]   Fig. 3.   Effects of 1-adrenoceptor antagonism and PKC inhibition on NE-induced early myocardial adaptation. Rats were treated with prazosin (0.25 mg/kg ip, 10 min) or chelerythrine (2.0 mg/kg iv, 5 min) before NE treatment (25 µg/kg iv). Hearts were isolated 30 min after NE treatment and subjected to global ischemia-reperfusion (25/40 min). LVDP was assessed before ischemia (baseline) and at the end of reperfusion (postischemic). The early cardiac functional resistance to ischemia-reperfusion was abolished by either 1-adrenoceptor antagonism or PKC inhibition. Data are presented as means ± SE; n = 8 in saline and NE 30 min groups; n = 6 in blockade + NE groups; n = 4 in blockade alone groups. * P < 0.05 vs. saline control.

Effects of ₁-adrenoceptor antagonism and PKC inhibition on the delayed adaptive response. Effects of prazosin and chelerythrine on the delayed myocardial adaptive response were examined by treatment with these agents before NE treatment. Cardiac resistance to postischemic dysfunction was assessed 24 h after NE treatment. As shown in Fig. 4, a pretreatment with prazosin or chelerythrine also abolished the delayed myocardial adaptive response (LVDP 51.4 ± 3.4 and 49.5 ± 14.2 mmHg, respectively, after I/R, both P > 0.05 vs. saline control), whereas neither of these two agents affected postischemic LVDP when they were administered alone 24 h before heart isolation.

View larger version (22K): [in this window] [in a new window]   Fig. 4.   Effects of 1-adrenoceptor antagonism and PKC inhibition on NE-induced delayed myocardial adaptation. Rats were treated with prazosin (0.25 mg/kg ip, 10 min) or chelerythrine (2.0 mg/kg iv, 5 min) before NE treatment (25 µg/kg iv). Hearts were isolated 24 h after NE treatment and subjected to global ischemia-reperfusion (25/40 min). LVDP was assessed before ischemia (baseline) and at the end of reperfusion (postischemic). NE-induced delayed cardiac functional resistance to ischemia-reperfusion was abolished by prior 1-adrenoceptor antagonism or PKC inhibition. Data are presented as means ± SE; n = 8 in saline and NE 24 h groups; n = 6 in blockade + NE groups; n = 4 in blockade alone groups. * P < 0.05 vs. saline control.

Expression of -actin and MHC mRNAs in the NE-treated heart. In saline-treated hearts, cardiac -actin and -MHC mRNAs were the major isoforms constitutively expressed in ventricular myocardium. Skeletal -actin and -MHC mRNAs were present but in much lower levels (Fig. 5A). In vivo NE treatment resulted in a concordant increase in skeletal -actin and -MHC mRNAs (Fig. 5A). A twofold increase in skeletal -actin mRNA was observed at 4 h after administration of NE, and the maximal change occurred at 24 h with a 3.5-fold increase over control (Fig. 5B). -MHC mRNA level increased maximally (4.5-fold) at 4 h after administration of NE, and a 2.7-fold increase was still present at 24 h (Fig. 5B).

View larger version (86K): [in this window] [in a new window]   Fig. 5.   Expression of -actin and myosin heavy chain (MHC) isoform mRNAs in ventricular myocardium. A: representative Northern blot showing that skeletal -actin and -MHC mRNAs increased at 4, 6, and 24 h after NE treatment. B: densitometric data are expressed as density (after normalization to 28S rRNA band) relative to saline control (expressed as time 0) and are presented as means ± SE. The maximal increase in -MHC mRNA occurred at 4 h, and skeletal -actin mRNA peaked at 24 h; n = 3 hearts for each time point examined.

PKC-I subcellular distribution

View larger version (73K): [in this window] [in a new window]   Fig. 6.   Localization of PKC-I in the myocardium. PKC-I was detected by indirect immunofluorescent technique with a rabbit polyclonal antibody against PKC-I and Cy3-labeled goat anti-rabbit IgG (red). Cell surface was outlined by counterstaining with fluorescein-labeled wheat germ agglutinin (green). In ventricular myocytes of saline-treated rats (A and C), PKC-I is concentrated in the perinuclear region (arrowheads). Ten minutes after NE treatment, PKC-I has translocated into the nuclei (arrowheads) of myocytes (B and D). A and B show crosscutting myocardium, and C and D show longitudinal myocardium. M, myocytes; bar = 10 µm.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The results of this study demonstrate that in vivo NE treatment induced temporally bimodal myocardial functional adaptation to a subsequent ischemic insult in rats. The early myocardial adaptive response was manifested at 30 min after NE treatment but had abated by 1 h. The delayed myocardial adaptive response was present at 4 and 24 h after NE treatment. Both the early and delayed responses were abolished by prior ₁-adrenoceptor antagonism or PKC inhibition. Furthermore, the results demonstrate that in vivo NE treatment resulted in transient intranuclear translocation of PKC-I isozyme in cardiac myocytes and induced the expression of skeletal -actin and -MHC mRNAs in the mature ventricular myocardium. From these results, we conclude that NE induces a bimodal pattern of myocardial protection via mechanisms dependent on ₁-adrenoceptors and PKC. We interpret the expression of mRNAs encoding fetal isoforms of contractile proteins to be a marker of myocardial remodeling that may be essential for the delayed myocardial adaptation.

Previous studies by our laboratory (4, 22, 28) and others (5, 14, 38, 39) have demonstrated that treatment of isolated hearts with NE or a specific ₁-adrenergic agonist shortly before ischemia increases cardiac resistance to postischemic dysfunction or reduces infarct size. We have observed that in vivo NE treatment induces delayed cardioprotection against postischemic dysfunction in rats and that the delayed cardioprotection is dependent on protein synthesis (24, 27). The present study tested the hypothesis that in vivo NE treatment induces temporally bimodal myocardial adaptation to ischemia. By examining the time course of NE-induced cardiac resistance to postischemic dysfunction, we demonstrated that there were two distinct phases of cardioprotection post-NE treatment. Cardiac resistance to postischemic dysfunction was present at 30 min but was not evident at 1 h after NE treatment. Hearts regained resistance to ischemia at 4 h post-NE treatment, and the resistance persisted up to 24 h. The early phase of cardioprotection appeared to be a rapid but transient response. In contrast, the delayed adaptation appeared to require hours to develop and persisted for a longer period of time. Repeated transient myocardial ischemia has been shown to induce bimodal cardioprotection against prolonged I/R in animal models (13, 20), and this phenomenon has recently been confirmed in human ventricular myocytes in vitro (2). The role of endogenous NE in ischemic preconditioning remains unclear although ischemic stress has been shown to provoke the release of endogenous NE (34). NE is an endogenous catecholamine and a therapeutic agent and may have appeal for pharmacological reduction of I/R injury.

Both the early and delayed adaptive responses are dependent on ₁-adrenoceptors. It is now known that PKC is activated by hormones and neurotransmitters, and it plays a central role in the ₁-adrenoceptor signaling pathway (36, 37). The PKC family comprises a group of isozymes (7, 31), and specific roles for several individual PKC isozymes have been implicated in mammalian cardiac myocytes (15, 17). We have reported that infusion of phenylephrine translocates PKC- isoenzymes in the isolated rat heart and that the immediate protective effect of phenylephrine in the isolated rat heart can be abolished by the PKC inhibitor chelerythrine (28). In the present study, PKC inhibition by chelerythrine is evident by its influence on basal mean arterial pressure and NE-caused pressure elevation. Cardiac resistance to ischemia was not present at 30 min or 24 h after NE treatment if rats had been treated with chelerythrine. These results indicate that both the early and delayed myocardial adaptive responses induced by NE are sensitive to PKC inhibition.

Intravenous NE caused a rapid and transient increase in mean arterial pressure. Prazosin blunted the pressure increase while chelerythrine shortened its duration. Possibly, NE-induced systemic hemodynamic change is one of the factors involved in the activation of PKC and induction of myocardial adaptation, and the abrogation of the protection by prazosin and chelerythrine may be partly due to their influences on the pressure increase. However, the transient increase in blood pressure is unlikely the single important factor in the activation of PKC and induction of myocardial adaptation, since NE and selective ₁-adrenergic agonists also activate PKC and induce myocardial protection in isolated hearts or cardiac muscle preparations (9, 28). Moreover, direct activation of PKC has been reported to protect the heart independent of hemodynamic variables (6). Although it remains to be determined whether stimulation of PKC by ₁-adrenoceptor is solely through receptor-linked signals or includes a contribution from the pressure effects, it is likely that PKC transduces the ₁-adrenergic signal for the induction of the bimodal myocardial adaptation. The early myocardial adaptive response may involve PKC-mediated metabolic changes, whereas the delayed myocardial adaptive response may require PKC-regulated gene expression.

We have previously shown that in vivo NE treatment induces heat shock protein 70 mRNA in ventricular myocardium via the ₁-adrenoceptor (24). The results of the present study show that in vivo NE treatment also induced the expression of skeletal -actin and -MHC mRNAs in ventricular myocardium. The expression of skeletal -actin and -MHC mRNAs was temporally associated with the delayed adaptive response. This altered cardiac gene program shares similarity to that associated with the delayed myocardial adaptation induced by lipopolysaccharide preconditioning, i.e., increased expression of mRNAs encoding heat shock protein 70 and -MHC (26). Interestingly, there is a sustained increase in skeletal -actin mRNA in NE-treated hearts but not in lipopolysaccharide-treated hearts (26). Perhaps, the expression of heat shock protein 70 and -MHC mRNAs is regulated by cardiac response to stress, whereas the expression of skeletal -actin mRNA is not. NE-induced hemodynamic change may serve as a stress signal to induce the expression of heat shock protein 70 and -MHC mRNAs. Furthermore, there is a difference in the time required for the maximal in vivo induction of skeletal -actin and -MHC mRNAs in the myocardium in our study. -MHC mRNA level peaked at 4 h after NE treatment, whereas skeletal -actin mRNA level peaked at 24 h. It may be that maximal transcription of the skeletal -actin isogene requires an additional factor, and this factor itself is induced by NE. It is clear that the fetal isoform of MHC utilizes ATP more efficiently for contractile function (1), and the fetal rat heart is resistant to ischemia (32). Moreover, the heat shock protein 70 family is involved in the folding, assembly, and stabilization of newly synthesized cellular proteins and in processing proteins denatured during stress (33). It is likely that myocardial molecular remodeling, i.e., increased expression of skeletal -actin, -MHC, and heat shock protein 70 mRNAs, plays an important role in the development of the delayed myocardial adaptation.

The delayed myocardial adaptation may involve a PKC isozyme that translocates into the nuclei and regulates gene expression. Transcriptional activation of heat shock protein 70 genes requires phosphorylation of the heat shock factors, implicating a regulatory role for protein kinases (19). Indeed, inhibition of PKC with staurosporine downregulates heat-induced expression of heat shock protein 70 in human colon carcinoma HT-29 cells (12), and direct activation of PKC in human epidermoid A 431 cells with phorbol 12-myristate 13-acetate activates heat shock factor-1 and induces the expression of heat shock protein 70 genes (10). However, the PKC isozyme that regulates cardiac heat shock protein 70 gene transcription remains unknown. In the cultured neonatal rat cardiac myocytes, PKC-I isozyme has been shown to translocate into the nucleus after NE stimulation (11, 29), and NE-stimulated in vitro expression of skeletal -actin and -MHC isogenes by rat neonatal cardiac myocytes is related to the activation of a PKC- isozyme (16, 17). In this study, injection of NE to intact adult rats induced intranuclear translocation of PKC-I in cardiac myocytes at 10 min after the treatment. An increase in fetal isoforms of sarcomeric -actin and MHC mRNA was observed in ventricular myocardium at 4-24 h. It is likely that PKC-I transduces the signal for the in vivo transcription of the fetal cardiac contractile protein isogenes, permitting cardiac remodeling in this intact adult rat model. Further studies are necessary to determine the role of PKC-I isozyme in the altered cardiac gene expression and myocardial adaptation.

Perspectives