|
|
||||||||
Departments of 1 Surgery and 2 Molecular Genetics, Biochemistry and Microbiology, Howard Hughes Medical Institute, University of Cincinnati, 45267; and the Shriners Burns Institute, Cincinnati, Ohio 45529
| |
ABSTRACT |
|---|
|
|
|---|
Recent
studies suggest that sepsis stimulates ubiquitin-dependent protein
breakdown in skeletal muscle. In this proteolytic pathway,
ubiquitinated proteins are recognized, unfolded, and degraded by the
multicatalytic 26S protease complex. The 20S proteasome is the
catalytic core of the 26S protease complex. The role of the 20S
proteasome in the regulation of sepsis-induced muscle proteolysis is
not known. We tested the hypothesis that sepsis increases 20S
proteasome activity and the expression of mRNA for various subunits of
this complex. Proteolytic activity of isolated 20S proteasomes,
assessed as activity against fluorogenic peptide substrates, was
increased in extensor digitorum longus muscles from septic rats. The
proteolytic activity was inhibited by specific proteasome blockers.
Northern blot analysis revealed an approximately twofold increase in
the relative abundance of mRNA for the 20S
-subunits RC3 and RC9 and
the
-subunit RC7. However, Western blot analysis did not show any
difference in RC9 protein content between sham-operated and septic
rats. The increased activity and expression of the 20S proteasome in
muscles from septic rats lend further support for a role of the
ubiquitin-proteasome-pathway in the regulation of sepsis-induced muscle proteolysis.
subunits; ubiquitin; proteolysis
| |
INTRODUCTION |
|---|
|
|
|---|
A PROMINENT metabolic consequence of sepsis is the catabolic response in skeletal muscle, characterized by a substantial increase in protein breakdown, in particular myofibrillar protein breakdown (16). The increased protein breakdown results in release of amino acids from muscle tissue. A large portion of these amino acids are used by the liver for acute phase protein synthesis and gluconeogenesis (30). Other amino acids, particularly glutamine, are taken up by enterocytes and cells of the immune system and serve as an important source of energy for these cells (25, 36). Thus the catabolic response in skeletal muscle may be beneficial to the organism, at least during the early phase of sepsis. In severe and protracted sepsis, however, continued muscle protein breakdown results in muscle wasting and fatigue, which may impair recovery and lead to an increased risk for thromboembolic and pulmonary complications if ambulation is delayed and respiratory muscles are affected. Increased knowledge of the mechanisms regulating muscle proteolysis during sepsis therefore is of great clinical significance and may be important for the development of future therapeutic modalities to inhibit the catabolic response in patients with sepsis.
Intracellular protein breakdown is regulated by different proteolytic
pathways, including lysosomal and nonlysosomal pathways (11). Recent
studies in both experimental animals and patients with sepsis provided
evidence that the sepsis-induced muscle catabolism is associated with
upregulated energy-ubiquitin-dependent protein breakdown (33, 34). In
this proteolytic pathway, proteins are conjugated to ubiquitin,
whereafter they are degraded by the 26S proteolytic complex (14, 17).
The catalytic core of the 26S proteasome is the 20S proteasome, which
is a barrel-shaped particle composed of four stacked rings with seven
subunits in each ring (2). The two outer rings are comprised of
-subunits and the two inner rings subunits. The functions of the
-subunits include interaction between the 20S proteasome and various
regulators, whereas the hydrolytic sites are located on the inner side
of some of the subunits. The 20S proteasome possesses at least five peptidase activities, i.e., the trypsin-like, chymotrypsin-like, peptidylglutamyl peptidase, branched-chain amino acid-preferring, and
small neutral amino acid-preferring activities (26). The influence of
sepsis on the expression and activity of the 20S proteasome in skeletal
muscle is not known.
The present study was designed to test the hypothesis that the activity of the 20S proteasome and the expression of various proteasome subunits are increased in skeletal muscle during sepsis. We found that 20S proteasomes isolated from muscles of septic rats displayed increased proteolytic activity and that the expression of several proteasome subunits was upregulated. The results support a role for proteasome-dependent muscle proteolysis during sepsis.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Sepsis was induced in male Sprague-Dawley rats (40-60 g body wt) by cecal ligation and puncture (CLP) as described previously (16, 33). Control rats were sham operated, i.e., they underwent laparotomy and manipulation, but no ligation or puncture, of the cecum. All animals were resuscitated with 10 ml/100 g body weight of normal saline administered subcutaneously on the back at the time of surgery. Metabolic studies were performed up to 16 h after CLP or shamoperation. Rats had free access to drinking water, but food was withheld after the surgical procedures to avoid the influence on metabolic changes of any difference in food intake between the experimental groups. This septic model was used in several previous reports from our laboratory and resulted in a reproducible and pronounced increase in total and myofibrillar protein breakdown rates and upregulated expression of ubiquitin mRNA in skeletal muscle (16, 33). The model is clinically relevant because it resembles the situation in patients with sepsis caused by fecal peritonitis and intra-abdominal devitalized tissue. In previous reports that used this model, rats weighing 40-60 g were used because their extremity muscles are thin enough to allow for measurement of protein breakdown rates during incubation in vitro (12, 15). Rats of the same size were used in the present experiments to make it possible to compare results with previous results of increased protein breakdown rates in incubated muscles 16 h after CLP (16, 33).
Isolation of 20S proteasomes and measurement of
proteolytic activity. At different time points up to 16 h after sham operation or CLP, rats were anesthetized with
pentobarbital sodium (35 mg/kg ip), and the extensor digitorum longus
(EDL) and soleus muscles were harvested, frozen in liquid nitrogen and
stored at
70°C until analysis. The EDL (a fast-twitch
muscle) and soleus (a slow-twitch muscle) muscles were studied here
because in previous reports total and myofibrillar energy-dependent
protein breakdown and expression of the ubiquitin-proteasome
proteolytic pathway were substantially increased in EDL muscle 16 h
after CLP, with only minor changes noticed in soleus (16, 33, 35). Thus
by including both EDL and soleus muscles it was possible to compare
changes in 20S proteasome activity and expression during sepsis in the two types of muscles with changes in protein breakdown rates and expression of ubiquitin reported previously. To isolate 20S
proteasomes, pooled muscles from five rats were homogenized in ice-cold
buffer (pH 7.5) containing (in mM) 50 Tris · HCl, 5 MgCl2, and 250 sucrose by means of
a Dounce homogenizer. The proteasomes were isolated by three sequential
centrifugations; the first centrifugation was at 10,000 g for 20 min. The supernatant was
centrifuged at 100,000 g for 1 h. The
supernatant from this centrifugation was centrifuged at 100,000 g for 5 h. The final pellet,
containing the 20S proteasomes, was resuspended in buffer (pH 7.5)
containing 50 mM Tris · HCl, 5 mM
MgCl2, and 20% glycerol. The
protein content of the proteasome preparation was determined in
accordance with Lowry et al. (20). The method used here to isolate 20S
proteasomes was based on previous reports (5, 31). Electron microscopy confirmed the presence of 20S proteasome particles in the proteasome preparation (data not shown), and inhibition of proteolytic activity by
specific proteasome blockers further validated the
procedure to isolate the 20S proteasomes.
The proteolytic activity of the 20S proteasomes was determined by measuring the activity against the fluorogenic substrates succinyl-leu-leu-val-tyr-7-amido-4-methylcoumarin (LLVY) and N-carbenzoxy-leu-leu-glu-7-amido-4-methylcoumarin (LLE) (Sigma, St. Louis, MO). These substrates are preferentially hydrolyzed by the chymotrypsin-like and peptidylglutamyl peptidase activities of the 20S proteasome, respectively (3). To measure proteolytic activity, 10 µl of the 20S proteasome extract was added to 50 µl of medium containing 50 mM Tris · HCl (pH 8.0), 10 mM MgCl2, 1 mM 1,4-dithiothreitol, 2 U Aypyrase, and 300 µM of LLVY or 800 µM of LLE. The reaction took place at 37°C for 45 min and was stopped by the addition of 150 µl 100% cold ethanol. The peptidase activity was determined by measuring the generation of the fluorogenic cleavage product (methylcoumarylamide) at 380 nm excitation wavelength and 440 nm emission wavelength with a CytoFluor 2350 fluorescence spectrophotometer (Millipore, Marlborough, MA). Standard curves were established for the fluorogenic product, and peptidase activity was expressed as picomoles per microgram protein per minute. In initial experiments, we established the relation between substrate and proteasome concentrations and proteasome activity. The substrate and proteasome concentrations used in the present experiments were on the linear parts of the curves describing these relationships.
Measurement of 20S proteasome subunit mRNA
levels. RC3, RC9, and RC7 mRNA levels were determined
by Northern blot analysis performed as described previously
(33-35). In short, total RNA was extracted by the guanidinium
thiocyanate-phenol-chloroform method using an RNA STAT-60 kit (Tel-Test
"B", Friendswood, TX). RNA was denatured and separated by
electrophoresis on 1% agarose gel containing formaldehyde. The RNA was
transferred from the gel to nylon membranes (Micron Separations,
Westboro, MA) by capillary action in 20 × SSC
(1× SSC = 0.15 M NaCl, 15 mM Na-citrate) overnight. RNA was
immobilized by UV crosslinking. The blots were hybridized at 42°C
for 4 h in 50% formaldehyde and 6× sodium chloride-sodium phosphate-EDTA (SSPE) (1× SSPE = 0.15 M NaCl, 10 mM
NaH2PO4,
1 M EDTA), 5× Denhardt's solution, 0.5% SDS, and 100 µg/ml
salmon sperm DNA. cDNA probes for the 20S proteasome subunits were
labeled by random priming with
[32P]dATP (Stratagene,
LaJolla, CA). The blots were hybridized at 60° overnight. The blots
were then washed twice in 1× SSC and 0.1% SDS and once in
0.1× SSC and 0.1% SDS, at room temperature and then
autoradiographed at
70°C. The blots were stripped and rehybridized with a rat 18S oligonucleotide probe
(GACAAGCATATGCTACTGGC) to control for equal loading of RNA. The blots
were quantitated on a Phosphoimager by means of the Image Quant Program
(Molecular Dynamics, Sunnyvale, CA), and the relative mRNA abundance
was expressed as the ratio between proteasome subunit mRNA and the 18S
band. The cDNA probes used here were kindly provided by Dr. K. Tanaka
(Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan).
Measurement of subunit RC9 protein levels. To estimate the influence of sepsis on the amount of 20S proteasome in muscle, subunit RC9 protein levels were determined by Western blot analysis. RC9 is a ubiquitous 20S proteasome subunit (2, 28) and changes in the amount of the 20S proteasome therefore should be reflected by changes in C9 levels. Muscles were sonicated for 5-10 s and were then homogenized with a Dounce homogenizer (Kontes Glass, Vineland, NJ). Homogenization was carried out in 1 ml of buffer containing 50 mM Tris · HCl, pH 7.4, 1% SDS, 5 mM EDTA, 0.25 mM sucrose, 2 µg/ml aprotinin, 1 mM phenylmethane sulphonyl fluoride, and 5 mM N-ethylmaleimide. After centrifugation at 12,000 g for 15 min, the supernatant was mixed with an equal volume of 2× Laemmli buffer (120 mM Tris · HCl, pH 6.8, 4% SDS, 20% glycerol, 0.01% bromphenol blue dye) and boiled for 10 min. Western blots were generated by means of aliquots containing 40 g total protein/lane on a 12% polyacrylamide gel in the presence of SDS. Samples were electrophoresed at 20 mA for 45 min. After SDS-polyacrylamide gel electrophoresis, proteins were transferred to a polyvinylidenedifluoride membrane (Bio-Rad, Hercules, CA) by semidry electroelution with a semidry trans cell (Bio-Rad) at 200 mA for 45 min. The membrane was washed three times with TBS (20 mM Tris base, 137 mM NaCl, pH 7.6) and 0.1% Tween and was then blocked for 1 h in Tris-buffered saline (TBS) containing 0.1% Tween and 5% fat-free dried milk. The membrane was again washed three times in TBS and 0.1% Tween, after which it was exposed to the primary antibody (purified rabbit polyclonal antibody to rat C9 produced in the laboratory of J. Monaco) at a dilution of 1:5,000 in TBS, 0.1% Tween, and 5% fat-free dried milk overnight at 4°C. The RC9 signal was visualized with horseradish peroxidase-conjugated secondary goat anti-rabbit IgG antibody (1:3,000) and epichemiluminescence substrate in accordance with the manufacturer's protocol (Amersham, Arlington Heights, IL). The membrane was exposed to Kodak X-OMAT AR film (Eastman Kodak, Rochester, NY). Bands were quantitated with the BioMAX ID 1.51 Kodak Scientific Imaging System (Eastman Kodak, Rochester, NY).
Statistics. Results are presented as means ± SE. Student's t-test or ANOVA followed by Tukey's test was used for statistical analysis.
| |
RESULTS |
|---|
|
|
|---|
In initial experiments, proteasomes were isolated from EDL muscles 16 h
after sham operation or CLP. The proteasome activity against LLVY was
increased by ~50% and that against LLE was doubled in muscles from
septic rats (Fig. 1), suggesting that the
chymotrypsin-like and peptidylglutamyl peptidase activities of the
proteasome were increased during sepsis.
|
To examine how soon after induction of sepsis proteasome activity
increased, chromotrypsin-like activity was measured in EDL muscles from
groups of rats 2, 4, 8, and 16 h after sham operation or CLP. Activity
against LLVY was significantly increased 4 h after induction of sepsis
and remained elevated throughout the rest of the experimental period
(Fig. 2).
|
To validate the methods used here to isolate 20S proteasomes and to
study their proteolytic activity, we next tested the effect of
different protease inhibitors. The lysosomal inhibitor leupeptin (100 µM) did not affect proteasome activity against LLVY or LLE in EDL
muscles from sham-operated or septic rats (Fig.
3). The proteasome blocker
N-acetyl-leu-leu-norleucinal
(LLnL; 100 µM) (29) inhibited the activity of proteasomes against
both substrates in muscles from sham-operated and septic rats.
Lactacystin (100 µM), which is a more specific proteasome blocker
than LLnL (10) and mainly blocks chymotrypsin-like proteasome activity
(3), inhibited the activity against LLVY of proteasomes from both
sham-operated and septic rats, but had no significant effect on the
activity against LLE (Fig. 3).
|
The involvement of the 20S proteasome in the catabolic response to
sepsis was further tested by examining the expression of mRNA for the
-subunits RC3 and RC9 and the
-subunit RC7 of the 20S proteasome.
These subunits were studied because their expression was increased in
muscle tissue in other catabolic conditions, including metabolic
acidosis (22), denervation (21), and fasting (37). Sepsis resulted in a
~70% increase in the concentrations of RC3, RC9, and RC7 in EDL
muscles (Fig. 4).
|
In additional experiments, we examined whether sepsis resulted in an
increased amount of the 20S proteasome in the EDL muscle. This was done
by determining the levels of RC9 protein in muscles from sham-operated
and septic rats by means of Western blot analysis. C9 is a ubiquitous
20S proteasome subunit (28), and changes in the amount of 20S
proteasome should therefore be reflected by changes in C9
protein. Western blot analysis showed that sepsis did not
result in changes in C9 protein levels in EDL muscles (Fig.
5).
|
In previous studies, evidence was found that the catabolic response to
sepsis is particularly pronounced in white, fast-twitch muscles (e.g.,
EDL muscles) with only minor changes in protein breakdown rates and
gene expression of different components of the ubiquitin-proteasome
pathway occurring in red, slow-twitch muscle (e.g., soleus muscles)
(16, 35). To test whether a similar differential response to sepsis
occurs with regard to 20S proteasome activity and expression, we next
isolated 20S proteasomes from soleus muscles of sham-operated and
septic rats. The proteasome activity against LLVY and LLE was not
affected by sepsis in soleus muscles (Fig.
6). Also, mRNA levels for RC3, RC7, and RC9
were unchanged in soleus muscles during sepsis (Fig.
7).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
In the present study, the activities against the peptide substrates LLVY and LLE were increased in 20S proteasomes isolated from EDL muscles of septic rats concomitant with increased expression of mRNA for several of the 20S proteasome subunits. Because the amount of RC9 protein was not increased in the same muscles, the increased proteasome activity most likely reflected increased specific activity, i.e., an increase in activity per 20S proteasome unit. The mechanism(s) of increased 20S proteasome activity in septic muscle is not known from the present experiments but may be related to increased activity of the regulating protein PA28 (11S) (6, 23) or an altered composition of the 20S proteasome (2). There is evidence that the proteasome fraction generated by the isolation method used in the present report contains PA28 (J. Monaco, unpublished observation). It is not likely that the proteasome activity was influenced by the PA700 (19S) regulatory protein because the assay was performed in the absence of ATP. Regardless of the mechanism of increased 20S proteasome activity, the present results support the concept that sepsis-induced muscle proteolysis is associated with upregulated expression and activity of the proteasome-dependent proteolytic pathway (33-35). This interpretation was further supported by the finding that 20S proteasome activity and expression were not influenced by sepsis in soleus muscles. Thus the changes in 20S proteasome activity and expression noted here in different types of skeletal muscle, paralleled changes in protein breakdown rates and expression of ubiquitin reported previously (16, 35). In addition, in recent studies from our (9, 18) and other laboratories (32), the catabolic response in skeletal muscle was blocked by specific proteasome inhibitors, lending further support to the role of the ubiquitin-proteasome pathway in sepsis-induced muscle catabolism.
The effects of the proteasome inhibitors LLnL and lactacystin on the
20S proteasome activity were tested here. Although the peptide aldehyde
LLnL has been widely used in previous studies as a proteasome blocker
(9, 18, 29, 32), this substance is not completely specific but inhibits
calpains and lysosomal cysteine protease activity as well (29). In
contrast, lactacystin is a specific proteasome blocker that
irreversibly inhibits the chymotrypsin-like peptidase activity of the
20S proteasome (10). In recent studies, evidence was found that
lactacystin spontaneously hydrolyzes into clastolactacystin
-lactone, which is the active proteasome inhibitor (7). Lactacystin
(
-lactone) exerts its 20S proteasome blocking effect by irreversibly
binding to
-subunits that have N-terminal threonines, i.e., LMP2,
LMP7, MECL-1, X, Y, and Z (10). The differential effects of leupeptin
(a predominantly lysosomal protease inhibitor) on one hand and LLnL and
lactacystin on the other hand noted here support the interpretation
that the activity against the peptide substrates used here reflected
proteasome activity.
The influence of sepsis on the activity of isolated 20S proteasomes from skeletal muscle has not been reported previously. However, muscle 20S proteasome activity has been examined in other catabolic conditions. The effect of starvation on muscle 20S proteasomes was reported by Dahlmann et al. (4). They found that neither the total amount of 20S proteasome nor its peptidase activity increased during starvation. Rather, the specific activity was decreased and the 20S proteasome content per muscle remained at the same level as in normal rats. In contrast, recent experiments in our laboratory (unpublished observation) provided evidence that muscle 20S proteasome activity was increased after burn injury, another condition characterized by muscle catabolism. Thus the 20S proteasome may respond differently to different catabolic conditions.
The regulation of the proteolytic activity of isolated 20S and 26S
proteasomes from normal rabbit skeletal muscle was examined in a recent
study by Craiu et al. (3). Similar to the present report, lactacystin
(and its active breakdown product
-lactone) effectively blocked the
hydrolysis of LLVY, consistent with inhibition of the chymotrypsin-like
proteasome activity. In contrast, the peptidylglutamyl-like peptidase
activity was relatively resistant to the effect of
-lactone (3),
which probably explains why lactacystin did not significantly block the
hydrolysis of LLE in the present study. In addition to examining the
hydrolysis of different peptide substrates by the proteasomes, Craiu et
al. (3) determined the breakdown of casein by purified muscle
proteasomes. Lactacystin and
-lactone inhibited casein breakdown by
the 20S and 26S proteasomes as well, although the concentrations
necessary to inhibit protein breakdown were higher than to reduce
peptide hydrolysis. Those results are important because they suggest
that changes in proteasome activity against peptide substrates reflect changes in proteasome proteolytic activity.
The structure of the 20S proteasome and the expression and function of
its different subunits were reviewed in several recent reports (1, 2,
28). The proteolytic activity is located on the inside of some, but not
all
-subunits. There is evidence that the interaction between active
and inactive
-subunits is required to generate peptidase activity.
The
-subunit studied here, RC7, is inactive (24). It is not known
from the present study whether the increased mRNA levels for RC7 were
related to the increased proteasome proteolytic activity, but it may be
speculated that the expression of both inactive and active
-subunits
is increased in catabolic conditions, thus allowing for increased interaction between different
-subunits and stimulated proteolytic activity. Because the mRNA levels for the two
-subunits examined here were increased as well, it is possible that the expression of all
or at least most proteasome subunits (
and
) is increased in
skeletal muscle during different catabolic conditions (21, 22, 34, 35,
37), suggesting that the expression of several of the proteasome
subunits is upregulated in parallel in catabolic muscle.
It is not known from the present experiments whether the increased mRNA levels for the proteasome subunits reflected increased gene transcription, increased mRNA stability, or a combination of these mechanisms. In a recent study, we found evidence that increased ubiquitin mRNA levels in septic muscle were not caused by increased mRNA stability, but most likely reflected increased transcription of the ubiquitin gene (35). In other studies, Price et al. (27) found that increased mRNA levels for ubiquitin and the proteasome subunits RC3, RC5, and RC9 in skeletal muscle of insulinopenic rats were caused by stimulated gene transcription. Thus it is likely that the increased mRNA levels for RC3, RC9, and RC7 noted here in muscles of septic rats were caused by increased transcription rates, although further experiments are needed to test that notion.
The unchanged RC9 protein levels in muscles from septic rats were surprising in light of the increased RC9 mRNA levels. The finding may have several explanations, including increased breakdown of RC9 protein in addition to increased RC9 synthesis. The results could also be consistent with reduced translational efficiency of the RC9 mRNA. In addition, the finding may reflect different time courses for RC9 mRNA and protein levels, and it is possible that protein levels were elevated at a later time point than studied here. More experiments are needed to determine the mechanism(s) behind the unchanged RC9 protein levels in light of the increased mRNA levels.
Although the present results suggest that sepsis stimulates proteasome-dependent protein breakdown in skeletal muscle, the data need to be interpreted with caution for several reasons. First, the proteolytic activity was measured in a cell-free system with the use of artificial substrates, and because no ATP was added to the system, activity of the 20S rather than the 26S proteasome accounted for the results. This differs from the situation in vivo, where ubiquitinated proteins are degraded by the 26S proteasome by an energy-dependent mechanism (14, 17). The activity of isolated 20S proteasomes was measured in the present study because the 20S proteasome is the catalytic core of the 26S proteasome (1, 2). The present experimental design, therefore, allowed for the individual assessment of one of the key components of the ubiquitin-proteasome pathway. In addition, there is evidence that the 20S proteasome, rather than the 26S proteasome, is responsible for the breakdown of oxidized proteins (13), which is of particular importance for the present study because sepsis results in increased levels of oxidatively damaged proteins in skeletal muscle (8).
Second, even if the 20S proteasome proteolytic activity is increased in skeletal muscle during sepsis, it is not known if this is a rate-limiting step of sepsis-induced muscle proteolysis. Indeed, although recent studies suggest that sepsis is associated with increased expression of ubiquitin, ubiquitin-conjugating enzymes, and several of the 20S proteasome subunits (19, 33-35), it is not known whether muscle proteolysis during sepsis is activated or regulated by the ubiquitin-proteasome pathway. It is possible, for example, that the proteolytic pathway is upregulated secondary to increased amounts of substrates made available to the system. Third, only two proteolytic activities were tested in the present study, and it remains to be determined if other 20S proteasome activities as well are stimulated by sepsis.
Finally, 20S proteasomes were isolated from muscles of small growing rats with septic peritonitis. Although this experimental model was associated with upregulated energy-dependent muscle protein breakdown and increased expression of various components of the ubiquitin-proteasome pathway (33, 35), further studies are needed to determine if the 20S proteasome activity is increased in muscle from adult animals and patients with sepsis. In light of a recent study from this laboratory in which the expression of ubiquitin and the proteasome subunit HC3 was increased in muscle from septic patients (34), it is possible that sepsis results in increased 20S proteasome activity in human muscle as well.
| |
ACKNOWLEDGEMENTS |
|---|
This study was supported in part by National Institute of Diabetes and Digestive and Kidney Diseases Grant 37908 and by a grant from the Shriners of North America. S. C. Hobler and A. Williams were supported by National Institute of General Medical Sciences training grant 1T32-08478. D. Fischer was supported by a Research Fellowship from the Shriners of North America.
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: P.-O. Hasselgren, Univ. of Cincinnati College of Medicine, Dept. of Surgery, 231 Bethesda Ave., Mail Location 558, Cincinnati, OH 45267-0558 (E-mail: hasselp{at}uc.edu).
Received 6 July 1998; accepted in final form 12 May 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Baumeister, W.,
Z. Cejha,
M. Kania,
and
E. Seemüller.
The proteasome: a macromolecular assembly designed to confine proteolysis to a nanocompartment.
Biol. Chem.
378:
121-130,
1997[Medline].
2.
Coux, O.,
K. Tanaka,
and
A. L. Goldberg.
Structure and functions of the 20S and 26S proteasomes.
Annu. Rev. Biochem.
65:
801-847,
1996[Medline].
3.
Craiu, A.,
M. Gaczynska,
T. Akopian,
C. F. Gramm,
G. Fenteany,
A. L. Goldberg,
and
K. L. Rock.
Lactacystin and clastolactacystin
-lactone modify multiple proteasome
-subunits and inhibit intracellular protein degradation and major histocompatibility complex class I antigen presentation.
J. Biol. Chem.
272:
13437-13445,
1997
4.
Dahlmann, B.,
L. Kuehn,
H. Reinauer,
and
J. Kay.
Multicatalytic proteinase activity in skeletal muscle from starving rat.
Biochem. Soc. Trans.
15:
963-964,
1987.
5.
Dahlmann, B.,
L. Kuehn,
M. Rutschmann,
and
H. Reinauer.
Purification and characterization of a multicatalytic high-molecular-mass proteinase from rat skeletal muscle.
Biochem. J.
228:
161-170,
1985[Medline].
6.
DeMartino, G. N.,
and
C. A. Slaughter.
Regulatory proteins of the proteasome.
Enzyme Protein
47:
314-324,
1993[Medline].
7.
Dick, L. R.,
A. A. Cruikshank,
L. Grenier,
F. D. Melandri,
S. L. Nunes,
and
R. L. Stein.
Mechanistic studies on the inactivation of the proteasome by lactacystin. A central role for clasto-lactacystin
-lactone.
J. Biol. Chem.
271:
7273-7276,
1996
8.
Fagan, J. M.,
M. Ganguly,
G. Tiao,
J. E. Fischer,
and
P.-O. Hasselgren.
Sepsis increases oxidatively damaged proteins in skeletal muscle.
Arch. Surg.
131:
1326-1332,
1996
9.
Fang, C. H.,
J. J. Wang,
S. Hobler,
B. G. Li,
J. E. Fischer,
and
P.-O. Hasselgren.
Proteasome blockers inhibit protein breakdown in skeletal muscle after burn injury in rats.
Clin. Sci. (Colch.)
95:
225-233,
1998[Medline].
10.
Fenteany, G.,
R. F. Standaert,
W. S. Lane,
S. Choi,
J. Corey,
and
S. L. Schreiber.
Inhibition of proteasome activities and subunit-specific amino-terminal threonine modification by lactacystin.
Science
268:
726-731,
1995
11.
Goldberg, A. L.
The mechanism and functions of ATP-dependent proteases in bacterial and animal cells.
Eur. J. Biochem.
203:
9-23,
1992[Medline].
12.
Goldberg, A. L.,
S. B. Martel,
and
M. J. Kushmerich.
In vitro preparations of the diaphragm and other skeletal muscles.
Methods Enzymol.
39:
82-94,
1975[Medline].
13.
Grune, T.,
T. Reinheckel,
and
K. J. A. Davis.
Degradation of oxidized proteins in mammalian cells.
FASEB J.
11:
526-534,
1997[Abstract].
14.
Hasselgren, P.-O.,
and
J. E. Fischer.
The ubiquitin-proteasome pathway. Review of a novel intracellular mechanism of muscle protein breakdown during sepsis and other catabolic conditions.
Ann. Surg.
225:
307-316,
1997[Medline].
15.
Hasselgren, P.-O.,
M. Hall-Angerås,
U. Angerås,
D. W. Benson,
J. H. James,
and
J. E. Fischer.
Regulation of total and myofibrillar protein breakdown in rat extensor digitorum longus and soleus muscle incubated flaccid or at resting length.
Biochem. J.
267:
37-44,
1990[Medline].
16.
Hasselgren, P.-O.,
J. H. James,
D. W. Benson,
M. Hall-Angerås,
U. Angerås,
D. T. Hiyama,
S. Li,
and
J. E. Fischer.
Total and myofibrillar protein breakdown in different types of rat skeletal muscle: effects of sepsis and regulation by insulin.
Metabolism
38:
634-640,
1989[Medline].
17.
Hershko, A.,
and
A. Ciechanover.
The ubiquitin system for protein degradation.
Annu. Rev. Biochem.
61:
761-807,
1992[Medline].
18.
Hobler, S. C.,
G. Tiao,
J. E. Fischer,
J. Monaco,
and
P.-O. Hasselgren.
Sepsis-induced increase in muscle proteolysis is blocked by specific proteasome inhibitors.
Am. J. Physiol.
274 (Regulatory Integrative Comp. Physiol. 43):
R30-R37,
1998
19.
Hobler, S. C.,
J. J. Wang,
A. B. Williams,
F. Melandri,
X. Sun,
J. E. Fischer,
and
P.-O. Hasselgren.
Sepsis is associated with increased ubiquitin-conjugating enzyme E214K mRNA in skeletal muscle.
Am. J. Physiol.
276 (Regulatory Integrative Comp. Physiol. 45):
R468-R473,
1999
20.
Lowry, O. H.,
N. J. Rosbrough,
A. L. Farr,
and
R. J. Randell.
Protein measurements with the folin phenol reagent.
J. Biol. Chem.
193:
265-275,
1951
21.
Medina, R.,
S. S. Wing,
A. Haas,
and
A. L. Goldberg.
Activation of the ubiquitin-ATP-dependent proteolytic system in skeletal muscle during fasting and denervation atrophy.
Biomed. Biochim. Acta
50:
347-356,
1991[Medline].
22.
Mitch, W. E.,
R. Medina,
S. Grieber,
R. C. May,
B. K. England,
S. R. Price,
J. L. Bailey,
and
A. L. Goldberg.
Metabolic acidosis stimulates muscle protein degradation by activating the adenosine triphosphate-dependent pathway involving ubiquitin and proteasomes.
J. Clin. Invest.
93:
2127-2133,
1994.
23.
Mott, J. D.,
B. C. Pramanik,
C. R. Moomaw,
S. J. Afendis,
G. N. DeMartino,
and
C. A. Slaughter.
PA28, an activator of the 20S proteasome, is composed of two nonidentical but homologous subunits.
J. Biol. Chem.
269:
31466-31471,
1994
24.
Mykles, D. L.,
G. N. DeMartino,
and
P. M. Kloetzel.
Proteasome workshop at Colorado State University.
Enzyme Protein
48:
298-310,
1996.
25.
Newsholme, E. A.,
and
M. Parry-Billings.
Properties of glutamine release from muscle and its importance for the immune system.
J. Parenter. Enteral Nutr.
14:
63S-67S,
1990.
26.
Orlowsi, M.,
C. Cardozo,
and
C. Michaud.
Evidence for the presence of five distinct proteolytic components in the pituitary multicatalytic proteinase complex. Properties of two components cleaving bonds on the carboxyl side of the branched chain and small neutral amino acids.
Biochemistry
32:
1563-1572,
1993[Medline].
27.
Price, S. R.,
J. L. Bailey,
X. Wang,
C. Jurkovitz,
B. K. England,
X. Ding,
L. S. Phillips,
and
W. E. Mitch.
Muscle wasting in insulinopenic rats results from activation of the ATP-dependent, ubiquitin-proteasome proteolytic pathway by a mechanism including gene transcription.
J. Clin. Invest.
98:
1703-1708,
1996[Medline].
28.
Rivett, A. J.
Proteasomes: multicatalytic proteinase complexes.
Biochem. J.
291:
1-10,
1993.
29.
Rock, K. L.,
C. Gramm,
L. Rothstein,
K. Clark,
R. Stein,
L. Dick,
D. Hwang,
and
A. L. Goldberg.
Inhibitors of the proteasome block the degradation of most cell proteins and the generation of peptides presented on MCH class I molecules.
Cell
78:
761-771,
1994[Medline].
30.
Rosenblatt, S.,
G. H. A. Clowes,
B. C. George,
E. Hirsch,
and
B. Lindberg.
Exchange of amino acids by muscle and liver in sepsis. Comparative studies in vivo and in vitro.
Arch. Surg.
118:
167-175,
1983
31.
Tanaka, K.,
K. Ii,
A. Ichihara,
L. Waxman,
and
A. L. Goldberg.
A high molecular weight protease in the cytosol of rat liver. I. Purification, enzymological properties, and tissue distribution.
J. Biol. Chem.
261:
15197-15203,
1986
32.
Tawa, N. E.,
R. Odessey,
and
A. L. Goldberg.
Inhibitors of the proteasome reduce the accelerated proteolysis in atrophying rat skeletal muscles.
J. Clin. Invest.
100:
197-203,
1997[Medline].
33.
Tiao, G.,
J. M. Fagan,
N. Samuels,
J. H. James,
K. Hudson,
M. Lieberman,
J. E. Fischer,
and
P.-O. Hasselgren.
Sepsis stimulates nonlysosomal, energy-dependent proteolysis and increases ubiquitin mRNA levels in rat skeletal muscle.
J. Clin. Invest.
94:
2255-2264,
1994.
34.
Tiao, G.,
S. Hobler,
J. J. Wang,
T. A. Meyer,
F. A. Luchette,
J. E. Fischer,
and
P.-O. Hasselgren.
Sepsis is associated with increased mRNAs of the ubiquitin-proteasome proteolytic pathway in human skeletal muscle.
J. Clin. Invest.
99:
163-168,
1997[Medline].
35.
Tiao, G.,
M. Lieberman,
J. E. Fischer,
and
P.-O. Hasselgren.
Intracellular regulation of protein degradation during sepsis is different in fast- and slow-twitch muscle.
Am. J. Physiol.
272 (Regulatory Integrative Comp. Physiol. 41):
R849-R856,
1997
36.
Windmueller, H. G.,
and
A. E. Spaeth.
Respiratory fuels and nitrogen metabolism in vivo in small intestine of fed rats.
J. Biol. Chem.
255:
107-112,
1980
37.
Wing, S. S.,
and
A. L. Goldberg.
Glucocorticoids activate the ATP-ubiquitin-dependent proteolytic system in skeletal muscle during fasting.
Am. J. Physiol.
264 (Endocrinol. Metab. 27):
E668-E676,
1993
This article has been cited by other articles:
![]() |
J. M. McClung, M. A. Whidden, A. N. Kavazis, D. J. Falk, K. C. DeRuisseau, and S. K. Powers Redox regulation of diaphragm proteolysis during mechanical ventilation Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2008; 294(5): R1608 - R1617. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Dupont-Versteegden, J. D. Fluckey, M. Knox, D. Gaddy, and C. A. Peterson Effect of flywheel-based resistance exercise on processes contributing to muscle atrophy during unloading in adult rats J Appl Physiol, July 1, 2006; 101(1): 202 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. U. Fareed, A. R. Evenson, W. Wei, M. Menconi, V. Poylin, V. Petkova, B. Pignol, and P.-O. Hasselgren Treatment of rats with calpain inhibitors prevents sepsis-induced muscle proteolysis independent of atrogin-1/MAFbx and MuRF1 expression Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2006; 290(6): R1589 - R1597. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Combaret, D. Dardevet, I. Rieu, M.-N. Pouch, D. Bechet, D. Taillandier, J. Grizard, and D. Attaix A leucine-supplemented diet restores the defective postprandial inhibition of proteasome-dependent proteolysis in aged rat skeletal muscle J. Physiol., December 1, 2005; 569(2): 489 - 499. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. DeRuisseau, A. N. Kavazis, M. A. Deering, D. J. Falk, D. Van Gammeren, T. Yimlamai, G. A. Ordway, and S. K. Powers Mechanical ventilation induces alterations of the ubiquitin-proteasome pathway in the diaphragm J Appl Physiol, April 1, 2005; 98(4): 1314 - 1321. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Ordway, P. D. Neufer, E. R. Chin, and G. N. DeMartino Chronic contractile activity upregulates the proteasome system in rabbit skeletal muscle J Appl Physiol, March 1, 2000; 88(3): 1134 - 1141. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |