AJP - Regu Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 277: R1112-R1119, 1999;
0363-6119/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bai, L.
Right arrow Articles by Ghishan, F. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bai, L.
Right arrow Articles by Ghishan, F. K.
Vol. 277, Issue 4, R1112-R1119, October 1999

Characterization of cis-elements required for osmotic response of rat Na+/H+ exchanger-2 (NHE-2) gene

Liqun Bai, James F. Collins, Yunhua L. Muller, Hua Xu, Pawel R. Kiela, and Fayez K. Ghishan

Departments of Pediatrics and Physiology, Steele Memorial Children's Research Center, University of Arizona Health Sciences Center, Tucson, Arizona 85724


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIAL AND METHODS
RESULTS
DISCUSSION
REFERENCES

The Na+/H+ exchanger (NHE-2) has been implicated in osmoregulation in the kidney, because it transports Na+ across the cell membrane and efficiently alters intracellular osmolarity. On hyperosmotic stress, NHE-2 mRNA increases in abundance in mouse inner medullary collecting duct (mIMCD-3) cells, suggesting possible transcriptional regulation. To investigate the molecular mechanism of potential transcriptional regulation of NHE-2 by hyperosmolarity, we have functionally characterized the 5'-flanking region of the gene in mIMCD-3 cells. Transient transfection of luciferase reporter gene constructs revealed a novel cis-acting element, which we call OsmoE (osmotic-responsive element, bp -808 to -791, GGGCCAGTTGGCGCTGGG), and a TonE-like element (tonicity-responsive element, bp -1201 to -1189, GCTGGAAAACCGA), which together are shown to be responsible for hyperosmotic induction of the NHE-2 gene. Electrophoretic mobility shift assays suggest that different DNA-protein interactions occur between these two osmotic response elements. However, both DNA sequences were shown to specifically bind nuclear proteins that dramatically increase in abundance under hyperosmotic conditions. Isolation of trans-acting factors and characterization of their specific interaction with these osmotic response elements will further elucidate the transcriptional mechanisms controlling NHE-2 gene expression under hyperosmolar conditions.

mouse inner medullary collecting duct cells; gel mobility shift; transcriptional regulation; kidney; OsmoE


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIAL AND METHODS
RESULTS
DISCUSSION
REFERENCES

HYPEROSMOLAR STRESS CAUSES initial cell shrinkage followed by gradual intracellular volume recovery. Activation of the Na+/H+ exchanger (NHE) and the Na+-K+-2Cl- cotransporter are two principal pathways that are activated when shrunken cells undergo recovery (11, 15), with the result being net uptake of NaCl and water, which restores original cell volume (4). Six NHE isoforms (NHE-1-NHE-6) have been identified (6, 23), and four of them (NHE-1-NHE-4) have been investigated under hyperosmolar conditions. NHE-1, when overexpressed in PS120 fibroblasts, was activated in response to short-term (13) or long-term hyperosmotic stress (28). NHE-4 overexpressed in PS120 fibroblasts was also increased by hyperosmolarity (2). In contrast, NHE-3 was found to be markedly inhibited by hyperosmolarity in several cell lines (16, 26, 33). Additionally, functional NHE-2 levels were shown to be increased by hyperosmolarity in mouse inner medullary collecting duct (mIMCD-3) cells (27) and AP-1 cells (16). Conversely, however, the inhibition of NHE-2 by hyperosmolarity in PS120 fibroblasts was also recently reported (21).

Although the hyperosmotic stress response of four NHE isoforms has been characterized, the precise molecular mechanism underlying osmotic regulation is largely unknown. A phosphorylation-dependent mechanism was previously shown to be involved in the activation of NHE-1 by hyperosmotic stress (12). However, a phosphorylation-independent mechanism was also suggested for NHE-1 (14). The mechanism of transcription or mRNA stability has been implicated in osmotic regulation of renal NHE-2. NHE-2 mRNA was shown to be expressed in mIMCD-3 cells, and the mRNA expression was increased by hyperosmotic shock (27). The inner medulla of the kidney is under an extremely high osmolar load during normal physiological conditions. Also, NHE-2 is known to be the only NHE isoform expressed in the apical membranes of epithelial cells of the renal collecting ducts. Therefore, it seems likely that NHE-2 plays an important physiological role in the cellular response to hyperosmolarity in the renal medulla.

Transcriptional regulation of renal genes by hyperosmolarity has been shown for two genes encoding organic molecule transporters and for aldose reductase (32). Tonicity-responsive element (TonE), the first identified hyperosmolality cis-acting element, was shown to mediate increased transcription of the Na+-Cl--betaine transporter gene in response to hypertonic stress (31). More recently, TonE-like osmotic response elements were identified in the Na+-myo-inositol cotransporter (24, 34) and the aldose reductase (10, 17) genes. The hyperosmolarity-induced increase in the transcription of the genes coding for these proteins was shown to be preceded by increases in intracellular Na+ and K+. Thus NHE-2 could be implicated as an early activation gene that functions to increase intracellular Na+ on osmotic stress and, thus, leads to a secondary increase in transcriptional expression of these other genes (and most likely additional unidentified genes).

We recently cloned the 5'-flanking region of the rat NHE-2 gene and showed that it functions as a promoter of gene transcription in mIMCD-3 cells (20). This work put us in a unique position to be able to decipher the transcriptional component of increased NHE-2 mRNA expression by hyperosmolarity. Here we describe the identification of a novel cis-acting element, osmotic-responsive element (OsmoE), and a TonE-like sequence, both of which are necessary for the osmotic response of the rat NHE-2 gene. The osmotic response is reduced when each of these sequences is mutated individually and completely abolished when they are both mutated, suggesting that these two sequences work in concert to provide maximal transcriptional induction.


    MATERIAL AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIAL AND METHODS
RESULTS
DISCUSSION
REFERENCES

Isolation of mRNA and semiquantitative RT-PCR analysis. Messenger RNA was purified from mIMCD-3 cells incubated with isosmotic medium (300 mosmol/kgH2O) or hyperosmotic medium (400 mosmol/kgH2O) for 36 h, as described previously (8, 9). RT-PCR was performed with NHE-2-specific primers (upstream: 5'-CAGCGCACATTGTCCTACAA-3', 2,041-2,061 bp; downstream: 5'-TGTCCGATCGCTGCTATTA-3', 2,273-2,293 bp) and beta -actin-specific primers (upstream: 5'-TGACGGGGTCACCCACACTGTGCCCATCTA-3', 1,038-1,068 bp; downstream: 5'-CTAGAAGCATTTGCGGTGGACGATGGAGGG-3', 1,846-1,876 bp) by use of standard methods (5, 7). Subsaturation levels of cDNA templates that were needed to produce a dose-dependent amount of PCR products were defined in initial experiments by testing a range of template concentrations. Subsequent PCR was carried out with subsaturation levels of RT reaction with NHE-2 and beta -actin primers in separate PCR reactions with identical parameters.

Assembly of reporter gene constructs. A series of progressively shorter NHE-2 promoter constructs in the pGL-3/basic luciferase reporter vector (Promega, Madison, MI) were made by restriction enzyme digestion by using restriction sites found in the NHE-2 gene or introduced by site-directed mutagenesis. Briefly, constructs -2630/+116 and -1271/+116 were made by subcloning a Hind III-Apa I fragment and an Sac I-Apa I fragment into the pGL-3/basic vector, respectively (20). Other reporter constructs, except -1271/-881 and -788/+116 (see Fig. 2), were made by introducing a Kpn I restriction site into different regions of the -271/+116 construct by PCR-based site-directed mutagenesis (1) and then removing the Kpn I fragment. The -1271/-808 and the -791/+116 constructs were made by introducing two EcoR I restriction sites at -808 and -791 bp, respectively, and removing 18 bp between these two EcoR I sites. The T mutant series (T, TL, and TR) and the O mutant series (OL, O1, O2, O3, O, and OR) were made by site-directed mutagenesis (Quantum). Mutant (T + O) contains the mutant T and mutant O sequence.

To confirm the location of the osmotic response region, eight double-stranded oligonucleotides containing the TonE-like sequence (construct TonE + SV40, bp -1201 to -1189, GCTGGAAAACCGG), reverse TonE-like sequence (construct Re-TonE + SV40, GGCCAAAAGGTCG), two tandem copies of TonE-like sequence (construct 2× TonE + SV40), OsmoE (construct OsmoE + SV40, bp -810 to -790, AAGGCCAGTTGGCGCTGGGA), reverse OsmoE (construct Re-OsmoE + SV40, AGGGTCGCGGTTGACCGGAA), two tandem copies of OsmoE (construct 2× OsmoE + SV40), and a tandem sequence of TonE and OsmoE with different order (constructs TonE/OsmoE and OsmoE/TonE) were synthesized and inserted into the Mlu I/Bgl II site immediately upstream of the SV40 promoter in the pGL-3/promoter vector. Constructs TonE-OsmoE and 2× TonE-OsmoE contain one and two copies of the DNA fragment between the identified TonE and OsmoE (-1203 to -789 bp), respectively. These fragments were amplified by PCR by use of overhanging primers carrying Mlu II/Bgl II and Bgl II/Nco I sequences, respectively, and then subcloned into Mlu I/Bgl II and Mlu I/Nco I site immediately upstream of the SV40 promoter in the pGL-3/promoter vector. All constructs were confirmed by DNA sequencing, and PCR-generated constructs were sequenced in their entirety to identify Taq polymerase-induced mutations.

Cell culture, transient transfection, osmotic shock, and luciferase assay. mIMCD-3 cells (passages 8-18) were seeded in six-well plates and maintained in a defined medium (20). The same batch of FCS was used in all experiments. When cells were 70% confluent, they were cotransfected with 1 µg of reporter vector DNA and 0.1 µg of pRL-cytomegalovirus (CMV) vector (as an internal standard to control for transfection efficiency) in serum-free medium. Twelve hours after transfection, one-half of the wells received fresh isosmotic medium and the other half received hypertonic medium (made by adding 100 mM mannitol to isosmotic growth medium; equals 400 mosmol/kgH2O). Osmolality of both media was confirmed by measuring on a wide-range osmometer. After 36 h the cells were harvested for dual luciferase assays (20). A minimum of three independent transfections were done for each construct with different populations of cells.

Preparation of nuclear extracts for electrophoretic mobility shift assay. Whole cell extracts were prepared by a standard method (29). Nuclear extracts were isolated from mIMCD-3 cells cultured in isosmotic medium (300 mosmol/kgH2O) or hyperosmotic medium (400 mosmol/kgH2O) for 36 h in 100-mm-diameter dishes. Two synthetic double-stranded oligonucleotides were designed that were identical to the NHE-2 TonE-like sequence and to the OsmoE sequence. The oligonucleotides used were -1203-bp AAGCTGGAAAACCGATAGATTCGACCTTTTGGCTATCT-1185 bp (probe T, TonE-like) and -810-bp AAGGGCCAGTTGGCGCTGGGATTCCCGGTCAACCGCGACCCT-789 bp (probe O, OsmoE). These DNA fragments were 3'-end labeled with digoxigenin-11-ddUTP (DIG). Nuclear extracts (4 µg of protein) were incubated with 0.1 pmol of DIG-labeled probe in electrophoretic mobility shift assay (EMSA) binding buffer containing 20 mM HEPES (pH 7.6), 1 mM EDTA, 10 mM (NH4)2SO4, 1 mM dithiothreitol, 0.2% (wt/vol) Tween 20, 30 mM KCl, 5 µg/ml poly-L-lysine, and 50 µg/ml poly[d(I-C)]. After incubation at room temperature for 15 min, the mixture was electrophoresed on a 6% polyacrylamide gel in 0.25× Tris-boric acid-EDTA buffer and electroblotted to a nylon membrane. Chemiluminescent detection was performed according to the standard protocol (electrophoretic mobility shift kit, Boehringer Mannheim, Indianapolis, IN). For the competition experiments, a 100-fold molar excess of unlabeled probe was added to the reaction mixture before the addition of DIG-labeled probe.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIAL AND METHODS
RESULTS
DISCUSSION
REFERENCES

Induction of NHE-2 mRNA by hyperosmolarity. The expression of NHE-2 mRNA in mIMCD-3 cells after exposure to control or hyperosmolar medium was assessed by semiquantitative RT-PCR by use of NHE-2- and beta -actin-specific primers (Fig. 1). The purpose of this experiment was to confirm previous observations that NHE-2 mRNA was increased in mIMCD-3 cells by hyperosmolar shock (27). The expression of NHE-2 mRNA was significantly increased by hyperosmolarity in accordance with the previous investigation (27).


View larger version (73K):
[in this window]
[in a new window]
 
Fig. 1.   Detection of Na+/H+ exchanger (NHE-2) mRNA levels by semiquantitative RT-PCR in isosmolality- or hyperosmolality-treated mouse inner medullary collecting duct (mIMCD-3) cells. mRNA prepared from mIMCD-3 cells grown in isosmotic (300 mosM) or hyperosmotic (400 mosM) medium for 36 h was used for 1st-strand cDNA synthesis. Subsequent PCR amplification was performed with NHE-2- or beta -actin-specific oligonucleotide primers in separate reactions. PCR products for NHE-2 and beta -actin for each sample were loaded on same gel lane and visualized with ethidium bromide.

Identification of regions controlling the osmotic response of the rat NHE-2 promoter. To test the induction of the NHE-2 promoter by hyperosmolarity, three luciferase reporter constructs, -2630/+116, -1271/+116, and -289/+116, were initially transfected into mIMCD-3 cells to measure reporter gene expression under normal and hyperosmotic conditions. As shown in Fig. 2, cells transfected with the -2630/+116 and -1271/+116 constructs showed 3.2- to 3.4-fold higher luciferase activity under hyperosmolar conditions than under isosmotic conditions, whereas cells transfected with the -289/+116 construct did not shown any induction of luciferase activity by hyperosmotic treatment. These results indicate that the NHE-2 promoter is upregulated by hyperosmolarity and that the putative osmotic response element(s) is located between -1271 and -289 bp upstream of the transcriptional initiation site.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2.   Hyperosmotic induction of rat NHE-2 promoter-luciferase reporter gene constructs in transiently transfected mIMCD-3 cells. Left: schematic representation of rat NHE-2 promoter-luciferase reporter constructs and deletion mutants. pGL-3/basic indicates promoterless luciferase reporter gene. Numbers above line indicate base pair relative to transcriptional start site. Right: relative luciferase activities of deletions of NHE-2 promoter. Fold induction is shown as ratio of luciferase activities of hyperosmotic- to isosmotic-treated cells. Values are means ± SD; n, number of replicates. lozenge  P < 0.001 vs. pGL-3/basic; * P < 0.005 vs. pGL-3/basic and -1271/+116 and -2630/+116 constructs.

To further define the osmotic response elements, a series of deletion constructs were transfected in mIMCD-3 cells and luciferase activity was measured under isosmotic and hyperosmotic conditions. Also shown in Fig. 2, cells transfected with the -1006/+116 and -817/+116 constructs showed a diminished response (~1.7-fold) to hyperosmolality (compared with the negative control). Further deletion to bp -784 completely abolished the induction of luciferase activity by hyperosmolarity. These data indicated that two regions are responsible for hyperosmotic induction, with one between bp -1271 and -817 and another between bp -817 and -784 of the promoter. Another construct, -1271/-808 + -791/+116, which contains all the sequences of construct -1271/+116, except 18 bp, significantly reduces the hyperosmotic induction to 1.7-fold. Overall, these data suggested that two regions are responsible for the hyperosmolarity regulation of the NHE-2 promoter, a 265-bp region from -1271 to -1006 bp and an 18-bp region from -808 to -791 bp.

Characterization of NHE-2 osmotic response elements. Analysis of the 265-bp region (-1271 to -1006) revealed a TonE-like sequence that has only 1-bp mismatch with the TonE consensus sequence (TGGAAAnnYnY; Y indicates pyrimidine) (25). Sited-directed mutagenesis was utilized to mutate this TonE-like sequence and an 18-bp region between -808 and -791. As shown in Table 1, when five of the key residues (19) of the TonE-like sequence (bp -1197 to -1193) were mutated, the hyperosmotic induction of luciferase activity was decreased from 3.3- to 2-fold (which was not different from the 1.7-fold induction with the -1006/+116 construct). However, mutations of both flanking regions of the TonE-like sequence, mutant TL and mutant TR, had no effect on luciferase expression. These results suggest that the TonE-like sequence between -1201 and -1189 bp is responsible for the hyperosmotic induction found in the 265-bp region (-1271 to -1006) and contributes at least partially to hyperosmotic induction of the NHE-2 promoter.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Luciferase activity of site-directed mutants of OsmoE and TonE-like sequence of NHE2 promoter

To map the osmotic response element within the region between bp -808 and -791 (a region we have named OsmoE for osmolality element), we made five mutants in this region and its flanking regions. As shown in Table 1, the hyperosmotic induction of luciferase activity was significantly reduced by three mutants, mutant O1, mutant O2, and mutant O3, which span the 18-bp sequence. These three mutants still maintained about 1.5-fold hyperosmotic induction. To eliminate the possibility that the remaining hyperosmotic induction of these three mutants was caused by incomplete mutation of the response element, mutant O, a 12-bp mutant of OsmoE, was tested and shown to maintain the same hyperosmotic induction as the other three mutants in this region (~1.5-fold). Two flanking region mutants, mutants OL and OR, had the same hyperosmotic induction as a wild-type mutant (~3-fold), indicating that only the 18-bp sequence between bp -808 and -791 is necessary for maximal induction by hyperosmolarity. On the basis of the above findings, a double mutant that contains mutant O (12 bp) and mutant T (5 bp) was tested. This mutant completely abolished the hyperosmotic induction of luciferase activity (Table 1), indicating that the osmotic response elements in the rat NHE-2 gene consists of two specific sequences, a TonE-like element and the novel OsmoE.

To evaluate the OsmoE and the TonE-like elements further, one or two tandem copies of OsmoE or the TonE-like element were inserted immediately upstream of an SV40 promoter in pGL-3/promoter plasmid and were tested for luciferase activity. Figure 3 shows that two copies of the OsmoE or the TonE-like elements, but not one copy of the forward or reverse sequence, induced 2.9- and 1.8-fold luciferase activity by hyperosmolarity, respectively. To further decipher hyperosmotic induction by these DNA sequences, constructs TonE-OsmoE + SV40 and 2× TonE-OsmoE + SV40, containing one or two tandem copies of the DNA fragment between the TonE-like sequence and OsmoE (bp -1203 to -789) were tested for luciferase induction. One copy of the TonE-OsmoE fragment induced 3.1-fold luciferase activity by hyperosmolarity, which is the same as construct -1271/+116. Interestingly, two tandem copies of the TonE-OsmoE fragment dramatically increased the hyperosmotic induction to 6.0-fold. However, tandem sequence of TonE and OsmoE with different order (constructs TonE/OsmoE and OsmoE/TonE) did not induce luciferase activity by hyperosmolarity. In addition, cotransfection of the separate OsmoE and TonE constructs did not show any additivity of luciferase induction by hyperosmolarity. These results confirm the observation that the fragment -1203/-789 that contains the OsmoE and TonE-like elements is responsible for the hyperosmotic induction of luciferase activity. It also suggests that the spatial orientation of OsmoE and the TonE-like element are likely necessary for maximal induction.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3.   Functional analysis of osmotic-responsive element (OsmoE) and tonicity-responsive element (TonE)-like element by hyperosmolarity-induced promoter activation. One or 2 copies of nucleotide sequence of OsmoE or TonE-like element or region between these elements was fused to pGL-3/SV40 promoter vector for reporter gene assays. TonE, OsmoE, and TonE-OsmoE represent 1 copy of TonE-like element (-1203/-1185), OsmoE (-810/-789), and fragment between TonE and OsmoE (-1203/-789), respectively. 2× TonE, 2× OsmoE, and 2× TonE-OsmoE represent 2 copies of above fragments, respectively. Re-TonE and Re-OsmoE represent reverse sequence of TonE and OsmoE, respectively. TonE/OsmoE and OsmoE/TonE indicate tandem sequence of TonE and OsmoE with different order. Cotransfection indicates cotransfection of 0.5 µg of each separate TonE and OsmoE construct. Luciferase assays were same as those in Fig. 1 legend. Fold induction is shown as ratio of luciferase activities of hyperosmotic- to isosmotic-treated cells. Values are means ± SD; n, number of replicates. * P < 0.005 vs. pGL-3/SV40 promoter.

Interaction of NHE-2 osmotic response elements with nuclear proteins. To test the interaction of the OsmoE and the TonE-like elements with osmotically induced nuclear proteins, we performed EMSA using double-stranded oligonucleotides corresponding to OsmoE and the TonE-like element and nuclear protein extracts prepared from cells maintained in isosmotic or hyperosmotic medium for 36 h. As shown in Fig. 4, probe O, corresponding to the OsmoE sequence, produced a shifted band of high molecular weight when the probe was incubated with nuclear extracts from mIMCD-3 cells exposed to hyperosmotic medium (Fig. 4, lane 3). The shifted band was barely detectable with nuclear extracts from cells maintained in isosmotic medium (lane 2). This binding could be abolished by competition with a 100-fold molar excess of unlabeled probe O (lanes 4 and 5), while the binding was unaffected by a 100-fold molar excess of unlabeled probe T, corresponding to the TonE-like sequence (lanes 6 and 7). These data indicated that protein binding was specific for the OsmoE sequence.


View larger version (59K):
[in this window]
[in a new window]
 
Fig. 4.   Electrophoretic mobility shift and competition assay of OsmoE. Probe O, a 21-bp DNA fragment corresponding to OsmoE, was labeled by digoxigenin-11-ddUTP (DIG). Labeled probe O was incubated with 4 µg of nuclear extracts from mIMCD-3 cells maintained in hyperosmotic (H; lanes 3, 5, and 7) or isosmotic (I; lanes 2, 4, and 6) medium in absence (-; lanes 2 and 3) or presence (100X) of a 100-fold molar excess of unlabeled probe O (lanes 4 and 5) or 100-fold molar excess of unlabeled probe T, corresponding to 19 bp of TonE-like sequence (lanes 6 and 7). Lane 1, DIG-labeled probe only.

Figure 5 shows the interaction between the TonE-like element and nuclear proteins. One predominant shifted band was observed when the probe was incubated with nuclear extracts from mIMCD-3 cells exposed to hyperosmotic (lane 3) or isosmotic medium (lane 2), but the band intensity was much weaker with isosmotic nuclear extract. This binding could be abolished by the addition of a 100-fold molar excess of unlabeled probe T (lanes 4 and 5) but was unaffected by unlabeled probe O. This data showed a specific interaction between an osmotically induced nuclear protein and the TonE-like sequence, and they further exemplified unique interactions from those shown with the OsmoE sequence.


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 5.   Electrophoretic mobility shift and competition assays of TonE-like element. Four micrograms of nuclear extracts, from mIMCD-3 cells maintained in hyperosmotic (H) or isomotic (I) medium, were incubated with DIG-labeled probe T, 19-bp fragment, which contained TonE-like element, in absence (-; lanes 2 and 3) or presence (100X) of a 100-fold molar excess of unlabeled probe T (lanes 4 and 5) or unlabeled probe O (lanes 6 and 7). Lane 1, DIG-labeled probe only.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIAL AND METHODS
RESULTS
DISCUSSION
REFERENCES

The transcriptional regulation of an Na+ transport gene by osmolarity in the mammalian kidney is of great interest, but the mechanism(s) of gene induction is not well understood. Our study presents the first evidence that transcriptional regulation of the NHE-2 gene by hyperosmolarity in mIMCD-3 cells is mediated by two osmotic response elements, the novel OsmoE (bp -808 to -791) and a TonE-like element (bp -1201 to -1189). Our data suggest that each of these elements is functional alone under hyperosmotic stress but that both elements work in concert to provide maximal transcriptional induction. Furthermore, EMSA revealed unique interactions with osmotically induced nuclear proteins between the OsmoE and the TonE-like element. Most importantly, the present investigation has identified a novel cis-acting element involved in regulation of gene transcription by hyperosmolarity in the renal medulla.

Increased osmolarity of the environment surrounding cells induces a rapid increase in expression of various genes. The increased expression of several ion transporters, including different NHE isoforms, the Na+-K+-2Cl- cotransporter, and K+ and Cl- channels, could modify the activity of key metabolic enzymes through alteration of the intracellular ion composition. These changes in ion concentration may then secondarily affect the transcription of other genes such as the Na+-Cl--betaine transporter, the Na+-myo-inositol cotransporter, and aldose reductase, which are involved in the cellular response to osmolar shock (3). TonE was the first identified cis-acting element responsible for hyperosmotic regulation in these genes (31). The consensus sequence of TonE, TGGAAAnnYnY, has been suggested on the basis of known TonE sequences in different genes at the time and analysis of TonE mutants, where each mutant has a single nucleotide mutated in a different position (19, 24). The identified TonE-like sequence of the NHE-2 gene (GCTGGAAAACCGA) has only 1-bp mismatch with the TonE consensus sequence in which the last Y (pyrimidine) is instead a purine (adenosine). Functional studies indicated that this TonE-like sequence is partially responsible for hyperosmotic induction of the NHE-2 gene. The specific DNA-protein interaction shown by EMSA further confirmed that the TonE-like sequence is a critical cis-acting element for hyperosmotic induction of the NHE-2 gene.

Although the deletion and mutation of the TonE-like element in NHE-2 reduced the induction of gene expression by hyperosmolarity, the remaining sequences, as shown by constructs -1006/+116 and -817/+116, still showed significant hyperosmotic induction. This suggested the presence of another osmotic response element downstream of the TonE-like element. Transfection of further deletion and mutant constructs revealed OsmoE, the second osmotic response element in the NHE-2 promoter. Further studies showed that although one copy of OsmoE or TonE-like element failed to produce significant osmotic induction in a heterologous promoter (i.e., SV40), tandem repeats of two OsmoE or TonE-like elements produced a significant osmotic induction of 2.9- and 1.8-fold, respectively. Furthermore, one or two copies of a DNA fragment containing both OsmoE and the TonE-like element and the sequence between them produced 3.1- and 6.0-fold osmotic induction, respectively. This suggests that either OsmoE or the TonE-like element alone is sufficient to generate an osmotic response. The observation of no additivity of luciferase induction by cotransfection of the TonE and OsmoE constructs suggested that the spatial relationship between these two cis-acting elements is important for maximal osmotic induction.

The OsmoE and the TonE-like element in the NHE-2 promoter produced less induction of gene expression (3.3-fold) than the betaine transporter (31) and aldose reductase (10) genes (10- to 20-fold). However, previous studies showed that 2,900 bp of immediate upstream sequence of the Na+-myo-inositol transporter gene containing TonE induce reporter gene expression of only twofold in response to hyperosmolarity (18, 25, 34). Later, five TonEs spread over 50,000 bp of the 5'-flanking region were located that increased gene expression by three- to fourfold with osmolar shock (24). Thus the TonE in the Na+-myo-inositol transporter gene and the osmotic response elements of the NHE-2 gene may represent a group that has a lower osmotic inducibility. Alternatively, a threefold induction of the NHE-2 gene may be sufficient to increase intracellular Na+ to produce the necessary physiological response, and this may explain why the osmotic stimulation of NHE-2 gene expression is lower than that reported for other genes.

Isolation of new cis-acting elements is an important step for identifying signal transduction pathways of gene transcription. OsmoE is thought to be a novel osmotic response element for the following reasons. 1) It is an 18-bp sequence with no nucleotide sequence homology to any known osmotic response element, although it has a 15-bp identical nucleotide with some regulator genes of bacteria (22, 30). It is unclear now whether OsmoE of the NHE-2 promoter has any relation to those bacterial genes, because such short regions of sequence identity may be found in many unrelated genes. 2) EMSA, using OsmoE sequence as a probe, showed a specific hyperosmolarity-induced nuclear binding complex. 3) The TonE-like probe is unable to inhibit OsmoE probe binding to nuclear proteins. All these facts suggest that the OsmoE of the NHE-2 gene and the putative OsmoE binding protein(s) are unique and have not been previously reported. At this time, however, we do not know precisely how the OsmoE and TonE-like elements work in concert to direct the induction of the NHE-2 gene by osmotic shock. Identification of trans-acting factors that bind OsmoE and TonE should allow elucidation of specific transcriptional mechanisms that regulate NHE-2 under the condition of osmotic stress.

In conclusion, we have identified a novel cis-acting element, OsmoE, and a TonE-like element, which together are responsible for the increased transcription of the NHE-2 gene induced by hyperosmolarity. Under hyperosmotic conditions, each of them can increase gene expression alone, and when working in concert, they provide maximal transcriptional induction. Our data on OsmoE and considering the fact that TonEs have been found in other osmotic-responsive genes suggest that multiple cis-acting elements are involved in control of the osmotic stress response in different genes. Identification of trans-acting factors that bind to these cis-acting elements in different genes should enable us to better understand the molecular mechanisms of gene regulation by hyperosmotic stress.

Perspectives

We have presented the identification and characterization of osmotic response elements of the rat NHE-2 gene promoter. The increased NHE-2 mRNA expression leads to an increase in renal medullary Na+ uptake necessary to meet the increasing cellular demands under hyperosmotic conditions. The data we present indicate that hyperosmotic stress induces the formation of nuclear protein complexes bound to the OsmoE and TonE-like sequences in mIMCD-3 cells. Future investigations should enable us to understand the interaction between these cis-acting elements and their trans-acting factor(s) during hyperosmotic stress. Furthermore, the identification of osmotic response elements provides fundamental information for isolation of these trans-acting factor(s). The investigation of signaling pathways that activate trans-acting factor(s) should elucidate more precisely the process of cellular osmoregulation.


    ACKNOWLEDGEMENTS

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant 2R01-DK-41274-10.


    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: F. K. Ghishan, Dept. of Pediatrics, Steele Memorial Children's Research Center, University of Arizona Health Sciences Center, 1501 N. Campbell Ave., Tucson, AZ 85724 (E-mail: fghishan{at}peds.arizona.edu).

Received 18 February 1999; accepted in final form 25 May 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIAL AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Bai, L., K. Fushimi, S. Sasaki, and F. Marumo. Structure of aquaporin2 vasopressin water channel. J. Biol. Chem. 271: 5171-5176, 1996[Abstract/Free Full Text].

2.   Bookstein, C., M. W. Musch, A. Depaoli, Y. Xie, M. Villereal, M. C. Rao, and E. B. Chang. A unique sodium/hydrogen exchange isoform (NHE-4) of the inner medulla of the rat kidney is induced by hyperosmolarity. J. Biol. Chem. 269: 29704-29709, 1994[Abstract/Free Full Text].

3.   Burg, M. B. Molecular basis of osmotic regulation. Am. J. Physiol. 268 (Renal Fluid Electrolyte Physiol. 37): F983-F996, 1995[Abstract/Free Full Text].

4.   Burg, M. B., E. D. Kwon, and D. Kultz. Regulation of gene expression by hypertonicity. Annu. Rev. Physiol. 59: 437-455, 1997[Medline].

5.   Collins, J. F., and F. K. Ghishan. Molecular cloning, functional expression, tissue distribution, and in situ hybridization of the renal sodium phosphate [Na+/P(i)] transporter in the control and hypophosphatemic mouse. FASEB J. 8: 862-868, 1994[Abstract].

6.   Collins, J. F., T. Honda, S. Knobel, N. M. Bulus, J. Conary, R. DuBois, and F. K. Ghishan. Molecular cloning, sequencing, tissue distribution, and functional expression of a Na+/H+ exchanger (NHE2). Proc. Natl. Acad. Sci. USA 90: 3938-3942, 1993[Abstract/Free Full Text].

7.   Collins, J. F., P. R. Kiela, H. Xu, J. Zeng, and F. K. Ghishan. Increased NHE2 expression in rat intestinal epithelium during ontogeny is transcriptionally mediated. Am. J. Physiol. 275 (Cell Physiol. 44): C1143-C1150, 1998[Abstract/Free Full Text].

8.   Collins, J. F., H. Xu, P. R. Kiela, J. Zeng, and F. K. Ghishan. Functional and molecular characterization of NHE3 expression during ontogeny in rat jejunal epithelium. Am. J. Physiol. 273 (Cell Physiol. 42): C1937-C1946, 1997[Abstract/Free Full Text].

9.   Collins, J. F., H. Xu, J. Zeng, and F. K. Ghishan. Ontogeny of basolateral membrane sodium/hydrogen exchange (NHE) activity and mRNA expression of NHE-1 and NHE-4 in rat kidney and jejunum. Biochim. Biophys. Acta 1369: 247-258, 1998[Medline].

10.   Ferraris, J. D., C. K. Williams, K. Jung, J. J. Bedford, M. B. Burg, and A. Garcia-Perez. ORE, a eukaryotic minimal essential osmotic response element. J. Biol. Chem. 271: 18318-18321, 1996[Abstract/Free Full Text].

11.   Grinstein, S., and J. K. Foskett. Ionic mechanisms of cell volume regulation in leukocytes. Annu. Rev. Physiol. 52: 399-414, 1990[Medline].

12.   Grinstein, S., J. D. Goetz-Smith, D. Stewart, B. J. Beresford, and A. Mellors. Protein phosphorylation during activation of Na+/H+ exchange by phorbol esters and by osmotic shrinking. Possible relation to cell pH and volume regulation. J. Biol. Chem. 261: 8009-8016, 1986[Abstract/Free Full Text].

13.   Grinstein, S., D. Rotin, and M. J. Mason. Na+/H+ exchange and growth factor-induced cytosolic pH changes. Role in cellular proliferation. Biochim. Biophys. Acta 988: 73-97, 1989[Medline].

14.   Grinstein, S., M. Woodside, C. Sardet, J. Pouyssegur, and D. Rotin. Activation of the Na+/H+ antiporter during cell volume regulation. Evidence for a phosphorylation-independent mechanism. J. Biol. Chem. 267: 23823-23828, 1992[Abstract/Free Full Text].

15.   Hoffmann, E. K., and L. O. Simonsen. Membrane mechanisms in volume and pH regulation in vertebrate cells. Physiol. Rev. 69: 315-382, 1989[Free Full Text].

16.   Kapus, A., S. Grinstein, S. Wasan, R. Kandasamy, and J. Orlowski. Functional characterization of three isoforms of the Na+/H+ exchanger stably expressed in Chinese hamster ovary cells. ATP dependence, osmotic sensitivity, and role in cell proliferation. J. Biol. Chem. 269: 23544-23552, 1994[Abstract/Free Full Text].

17.   Ko, B. C. B., B. Ruepp, K. M. Bohren, K. H. Gabbay, and S. S. M. Chung. Identification and characterization of multiple osmotic response sequences in the human aldose reductase gene. J. Biol. Chem. 272: 16431-16437, 1997[Abstract/Free Full Text].

18.   Mallee, J. J., M. G. Atta, V. L. Lorica, J. S. Rim, H. M. Kwon, A. D. Lucente, Y. Wang, and G. T. Berry. The structural organization of the human Na+/myoinositol cotransporter (SLC5A3) gene and characterization of the promoter. Genomics 46: 459-465, 1997[Medline].

19.   Miyakawa, H., S. K. Woo, C. Chen, S. C. Dahl, J. S. Handler, and H. M. Kwon. Cis- and trans-acting factors regulating transcription of the BGT1 gene in response to hypertonicity. Am. J. Physiol. 274 (Renal Physiol. 43): F753-F761, 1998[Abstract/Free Full Text].

20.   Muller, Y. L., J. F. Collins, L. Bai, H. Xu, and F. K. Ghishan. Molecular cloning and characterization of the rat NHE-2 gene promoter. Biochim. Biophys. Acta 1442: 314-319, 1998[Medline].

21.   Nath, S. K., C. Y. Hang, S. A. Levine, C. H. C. Yun, M. Montrose, M. Donowitz, and C. M. Tse. Hyperosmolarity inhibits the Na+/H+ exchanger isoforms NHE2 and NHE3: an effect opposite to that on NHE1. Am. J. Physiol. 270 (Gastrointest. Liver Physiol. 33): G431-G441, 1996[Abstract/Free Full Text].

22.   Ochsner, U. A., and M. L. Vasil. Gene repression by the ferric uptake regulator in Pseudomonas aeruginosa: cycle selection of iron-regulated genes. Proc. Natl. Acad. Sci. USA 93: 4409-4414, 1996[Abstract/Free Full Text].

23.   Orlowski, J., and S. Grinstein. Na+/H+ exchangers of mammalian cells. J. Biol. Chem. 272: 22373-22376, 1997[Free Full Text].

24.   Rim, J. S., M. G. Atta, S. C. Dahl, G. T. Berry, J. S. Handler, and H. M. Kwon. Transcription of the sodium/myoinositol cotransporter gene is regulated by multiple tonicity responsive enhancers spread over 50 kilobase pairs in the 5' flanking region. J. Biol. Chem. 273: 20615-20621, 1998[Abstract/Free Full Text].

25.   Rim, J. S., M. G. Atta, S. C. Dahl, G. T. Berry, J. S. Handler, and H. M. Kwon. The canine sodium/myoinositol cotransporter gene: structural organization and characterization of the promoter. Arch. Biochem. Biophys. 341: 193-199, 1997[Medline].

26.   Soleimani, M., C. Bookstein, J. A. McAteer, Y. J. Hattabaugh, G. L. Bizal, M. W. Musch, M. Villereal, M. C. Rao, R. L. Howard, and E. B. Chang. Effect of high osmolality on Na+/H+ exchange in renal proximal tubule cells. J. Biol. Chem. 269: 15613-15618, 1994[Abstract/Free Full Text].

27.   Soleimani, M., S. Gurinder, G. L. Bizal, S. R. Gullans, and J. A. McAteer. Na+/H+ exchanger isoforms NHE-2 and NHE-1 in inner medullary collecting duct cells. Expression, functional localization, and differential regulation. J. Biol. Chem. 269: 27973-27978, 1994[Abstract/Free Full Text].

28.   Soleimani, M., G. Singh, J. H. Dominguez, and R. L. Howard. Long-term high osmolality activates Na+/H+ exchange and protein kinase C in aortic smooth muscle cells. Circ. Res. 76: 530-535, 1995[Abstract/Free Full Text].

29.   Staal, F. J., M. Roederer, L. A. Herzenberg, and L. A. Herzenberg. Intracellular thiols regulate activation of nuclear factor-kappa B and transcription of human immunodeficiency virus. Proc. Natl. Acad. Sci. USA 87: 9943-9947, 1990[Abstract/Free Full Text].

30.   Stock, A., T. Chen, D. Welsh, and J. Stock. CheA protein, a central regulator of bacterial chemotaxis, belongs to a family of proteins that control gene expression in response to changing environmental conditions. Proc. Natl. Acad. Sci. USA 85: 1403-1407, 1988[Abstract/Free Full Text].

31.   Takenaka, M., A. S. Preston, H. M. Kwon, and J. S. Handler. The tonicity-sensitive element that mediates increased transcription of the betaine transporter gene in response to hypertonic stress. J. Biol. Chem. 269: 29379-29381, 1994[Abstract/Free Full Text].

32.   Waldegger, S., and F. Lang. Cell volume and gene expression. J. Membr. Biol. 162: 95-100, 1998[Medline].

33.   Watts, B. A., and D. W. Good. Apical membrane Na+/H+ exchange in rat medullary thick ascending limb. pH dependence and inhibition by hyperosmolality. J. Biol. Chem. 269: 20250-20255, 1994[Abstract/Free Full Text].

34.   Zhou, C., and P. R. Cammarata. Inducible expression of Na+/myoinositol cotransporter mRNA in anterior epithelium of bovine lens: affiliation with hypertonicity and cell proliferation. Exp. Eye Res. 35: 349-363, 1997.


Am J Physiol Regul Integr Compar Physiol 277(4):R1112-R1119
0002-9513/99 $5.00 Copyright © 1999 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
P. Hua, H. Xu, J. K. Uno, M. A. Lipko, J. Dong, P. R. Kiela, and F. K. Ghishan
Sp1 and Sp3 mediate NHE2 gene transcription in the intestinal epithelial cells
Am J Physiol Gastrointest Liver Physiol, July 1, 2007; 293(1): G146 - G153.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. Malakooti, R. Sandoval, V. C. Memark, P. K. Dudeja, and K. Ramaswamy
Zinc finger transcription factor Egr-1 is involved in stimulation of NHE2 gene expression by phorbol 12-myristate 13-acetate
Am J Physiol Gastrointest Liver Physiol, October 1, 2005; 289(4): G653 - G663.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
L. Bai, X. Zhang, and F. K. Ghishan
Characterization of vesicular glutamate transporter in pancreatic alpha - and beta -cells and its regulation by glucose
Am J Physiol Gastrointest Liver Physiol, May 1, 2003; 284(5): G808 - G814.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Xu, J. F. Collins, L. Bai, P. R. Kiela, R. M. Lynch, and F. K. Ghishan
Epidermal growth factor regulation of rat NHE2 gene expression
Am J Physiol Cell Physiol, August 1, 2001; 281(2): C504 - C513.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
L. Bai, J. F. Collins, H. Xu, and F. K. Ghishan
Transcriptional regulation of rat Na+/H+ exchanger isoform-2 (NHE-2) gene by Sp1 transcription factor
Am J Physiol Cell Physiol, May 1, 2001; 280(5): C1168 - C1175.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Xu, J. F. Collins, L. Bai, P. R. Kiela, and F. K. Ghishan
Regulation of the human sodium-phosphate cotransporter NaPi-IIb gene promoter by epidermal growth factor
Am J Physiol Cell Physiol, March 1, 2001; 280(3): C628 - C636.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Bai, H. Xu, J. F. Collins, and F. K. Ghishan
Molecular and Functional Analysis of a Novel Neuronal Vesicular Glutamate Transporter
J. Biol. Chem., September 21, 2001; 276(39): 36764 - 36769.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bai, L.
Right arrow Articles by Ghishan, F. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bai, L.
Right arrow Articles by Ghishan, F. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online