|
|
||||||||
Department of Cellular and Molecular Medicine, Faculty of Medicine, University of Ottawa, Ottawa, Ontario, Canada K1H 8M5
| |
ABSTRACT |
|---|
|
|
|---|
Slow- and fast-contracting skeletal muscles of both rats and mice display significant differences in their patterns of acetylcholinesterase (AChE) expression. Although neural influences are known to account for a large proportion of these differences, intrinsic variations between fast and slow myogenic precursor cells have been implicated. In the present study, we have capitalized on the use of Immorto transgenic mice to obtain single myogenic precursor cells isolated from either slow or fast muscle fibers and determined whether these cells generated myotubes that produced distinct patterns of AChE expression as observed in vivo between slow and fast muscles. These two myotube populations displayed similar cell-associated and secreted AChE enzyme activity as well as comparable levels of AChE transcripts. Both myotube populations also expressed nearly identical molecular form profiles. By contrast, AChE activity and transcript levels were approximately two- and fivefold greater in fast skeletal muscles compared with slow ones. Together, these findings indicate that differences in AChE expression between fast and slow muscles are not due to inherent differences in myogenic precursor cells, thereby suggesting that other factors, such as innervation, play a predominant role in establishing the distinct patterns of AChE expression in these muscle types.
acetylcholinesterase; neuromuscular junction; plasticity; activity; myoblasts
| |
INTRODUCTION |
|---|
|
|
|---|
ACETYLCHOLINESTERASE (AChE) is a key constituent of central and peripheral cholinergic synapses, where it hydrolyzes acetylcholine released by nerve terminals, thereby ensuring efficient neurotransmission. The enzyme exists as a family of several molecular forms expressed in a variety of tissues at specific subcellular compartments (for example, see Ref. 30). Specifically, homomeric forms include globular monomers (G1), dimers (G2), and tetramers (G4). Heteromeric forms, on the other hand, encompass asymmetric forms composed of either one (A4), two (A8), or three (A12) tetramers associated with a collagenic structural subunit (26) as well as a membrane-linked G4 tetramer attached to a hydrophobic anchor (14). In skeletal muscle, the asymmetric forms accumulate within the synaptic basal lamina of the neuromuscular junction (31), whereas tetramers are concentrated within the perijunctional region of nerve-muscle contacts (18).
Several studies have shown that the pattern of AChE expression differs significantly between slow- and fast-contracting muscles. For instance, total AChE activity is greater in fast versus slow muscles of rat and mouse (17, 19). Analysis of the molecular form distributions in fast and slow muscles also revealed that the relative content of G4 is considerably higher in fast muscles, whereas the levels of asymmetric forms are proportionately greater in slow muscles (17, 19). Recent studies further demonstrated that the levels of transcripts encoding AChE are higher in fast- versus slow-contracting muscles (10, 32, 41).
Although neural activity is recognized as being responsible for a large proportion of these differences in AChE expression between mature fast and slow muscles (see, for instance, Ref. 23 and references therein), intrinsic properties of the two muscle types appear to also contribute to these variations. For example, soleus (Sol) and extensor digitorum longus (EDL) muscles from postnatal rats already display prominent differences in their molecular form profiles (40) despite receiving, at this developmental stage, similar impulse patterns delivered by their respective innervating motoneurons (34). Furthermore, when slow and fast rat hindlimb muscles are forced to undergo regeneration in situ in the presence or absence of innervation or at a different functional site by transplantation, regenerated muscles display AChE molecular form profiles resembling those observed in the original slow or fast muscle (11, 40). These latter data have been interpreted to suggest that myogenic precursors or satellite cells, which undergo proliferation and differentiation during the process of muscle regeneration (reviewed in Ref. 39), are intrinsically programmed to express either slow or fast AChE profiles independent of the presence of the motor nerve (11, 40).
In the present study, we further examined the contribution of intrinsic
factors in determining the patterns of AChE expression in fast versus
slow muscles of small rodents. Specifically, we assessed the profiles
of AChE expression in myotubes derived from single myogenic satellite
cell clones isolated from either slow or fast muscle fibers excised
from H-2Kb-tsA58 (Immorto)
transgenic mice. These transgenic mice harbor a temperature-sensitive
SV40 large-T-antigen gene (tsA58) controlled by the activity of an
interferon-
(IFN-
)-sensitive promoter (H-2Kb), which elicits
indefinite growth of the cells under permissive conditions (25). Under
nonpermissive conditions, these cells are capable of undergoing normal
myogenic differentiation (33). Accordingly, we took advantage of these
mice to obtain pure populations of myotubes derived from a single
myogenic cell isolated from either a slow or fast fiber. The pattern of
AChE expression from these two myotube populations was therefore
determined and compared with the profiles displayed by slow and fast
skeletal muscles.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Animal care and surgery. Female
Sprague-Dawley rats weighing ~250 g were obtained from Charles River
Laboratories (St. Constant, Québec). Rats were killed using
CO2, and the EDL and Sol muscles were excised, frozen in liquid nitrogen, and stored at
80°C
until further analysis. Immorto mice
(H-2Kb-tsA58 transgenic mice; see
Ref. 25) were originally obtained from Charles River Laboratories, and
they were subsequently bred in the University of Ottawa Animal Care
Facility. Transgenic mice were killed by barbiturate overdose, and the
superficial portion of the tibialis anterior (TAS) muscle and the
entire Sol muscle, which contain fast and slow muscle fibers,
respectively (45), were carefully excised to minimize muscle fiber
damage. Care and treatment of the animals were in accordance with the
guidelines established by the Canadian Council on Animal Care.
Clonal myogenic cell cultures. TAS and
Sol muscles from 6- to 8-wk-old Immorto mice were rinsed briefly in
sterile PBS and digested at 35°C for 1.5-2 h in a
plastic petri dish containing type I collagenase (Sigma, St. Louis, MO)
in DMEM (GIBCO BRL, Burlington, ON). Single muscle fibers from TAS and
Sol muscles were then isolated as previously described (36). Briefly,
after muscle digestion, single muscle fibers were dissociated by
repeated trituration in DMEM with fire-polished-tip Pasteur pipettes.
Single intact muscle fibers were transferred to Matrigel (Collaborative Biomedical Products, Bedford, MA)-coated 24-well tissue culture plates
(1 fiber/well) and given 3 min to attach before the addition of plating
medium consisting of 10% horse serum (HS) and 0.5% chick embryo
extract in DMEM. After ~3 days in culture, satellite cells displaying
myogenic morphology detached from the single muscle fibers. Single
myogenic cells were isolated in one of two ways. In the first
procedure, the fiber was removed from the well as soon as a single
satellite cell had detached, and, at this point, the plating medium was
then replaced with growth medium containing 10% fetal bovine serum
(FBS), 20% HS, 1% chick embryo extract, and 2%
L-glutamine in DMEM. Myogenic
cells were grown at 33°C in 5%
CO2 in the presence of mouse
recombinant IFN-
(20 U/ml; GIBCO). If several satellite cells
detached, a second procedure was used. The fiber was removed, and the
satellite cells were induced to proliferate in growth medium. The cells
were then trypsinized and plated at low density in Matrigel-coated 35 mm tissue culture plates from which single myogenic cells were
subsequently isolated with cloning cylinders. Regardless of the
isolation procedure, when cells were near confluency, they were
passaged and plated on a 6 × 35 mm well plate. Upon confluency,
cells were incubated at 37°C in 5%
CO2 in fusion
medium
1 containing 5% HS for 24 h. Fusion
medium 1 was then replaced with a
second fusion medium (medium
2) containing 2% HS for a total of
4 days (see Ref. 36).
Extraction of AChE from cultured myotubes and mature
muscles. Cultures of myotubes (4 × 35 mm wells)
obtained from the fusion of myogenic cells from fast and slow muscles
were washed with cold PBS, scraped, and homogenized in 1 ml of a
high-salt detergent buffer containing anti-proteolytic agents: 10 mM
Tris · HCl, pH 7.0; 10 mM EDTA; 1 M NaCl; 1% Triton
X-100; 1 mg/ml bacitracin (Sigma); and 25 U/ml aprotinin (Sigma). Whole
Sol and EDL muscles, conversely, were homogenized in 2 ml of extraction
buffer. Homogenization was performed on ice for 30 s with a Polytron
set at low speed. The homogenates were centrifuged (20,000 g) at 4°C for 15 min, and the
supernatants were collected and frozen at
80°C. To assess AChE activity secreted from myotubes derived from fast and slow myogenic cells, diisopropyl fluorophosphate (DFP; Sigma)-treated HS was
used to prepare fusion medium 2.
Endogenous serum AChE was inactivated by incubating the HS with DFP for
48 h and then allowing the DFP to degrade for 10 days. Samples of
fusion medium 2 that had been
incubated with myotubes for 48 h before harvesting were collected and
spun at 2,000 rpm to remove cell debris. Supernatants were kept at
80°C until further analysis.
AChE enzyme assay and velocity sedimentation
analysis. AChE activity was measured using a modified
version of the spectrophotometric method of Ellman et al. (13) as
described previously (17, 23). Fifty-microliter aliquots were incubated
in 1 ml of a phosphate buffer solution (pH 7.0) containing 7.5 × 10
4 M acetylthiocholine
(Sigma) as the substrate and 5 × 10
4 M
dithio-bis(nitrobenzoic acid) (Sigma). Nonspecific hydrolysis was
determined by measuring substrate hydrolysis in the presence of both
tetraisopropyl pyrophosphoramide (Sigma) and the AChE-specific inhibitor 1,5-bis(4-allydimethylammonium phenyl)pentan-3-one dibromide (Sigma).
Velocity sedimentation analysis of AChE molecular forms was performed as previously described (17, 23). For these experiments, 100-µl aliquots were layered onto 5-20% sucrose gradients. Samples were centrifuged in a Beckman SW41 rotor at 40,000 rpm for 16 h at 4°C. Approximately 45 fractions were collected from the bottom of the tubes and assayed for AChE activity. Analysis of AChE molecular forms and processing of the raw data were performed as described in detail elsewhere (17, 23).
RNA extraction and RT-PCR. Total RNA
was isolated from cultured myotubes using 1 ml of Trizol (GIBCO) per 35 mm plate, whereas 1 ml of Trizol per 100 mg of rat muscle tissue was
used to extract total RNA from muscle. Myotubes were scraped from the
plates and disrupted by pipetting repeatedly up and down for 30 s.
Muscles were homogenized with a Polytron set at maximum speed twice for 15 s. After addition of chloroform, the solution was mixed vigorously and spun at 12,000 g for 15 min at
4°C. The aqueous layer was then transferred to a fresh tube, and an
appropriate amount of isopropanol was added. For RNA precipitation, the
samples were spun and the resulting pellets were washed with 70%
ethanol. Pellets were then briefly air-dried, and they were resuspended
in RNase-free water. All samples were stored at
80°C until use.
For RT-PCR analysis, all RNA samples were adjusted to a final concentration of 80 ng/ml. Two microliters of each RNA sample were reverse transcribed at 42°C for 45 min followed by 5 min at 99°C, as previously described in detail elsewhere (3, 24, 32). Negative controls consisted of the same RT mixture in which sample RNA was replaced by 2 µl of RNase-free water.
cDNAs encoding AChE and S12 ribosomal RNA (rRNA) were amplified using PCR as described in detail elsewhere (3, 24, 32). Primers for AChE (5': CTGGGGTGCGGATCGGTGTACCCC; 3': TCACAGGTCTGAGCAGCGTTCCTG) and rRNA (5'-GGAAGGCATAGCTGCTGG, 3'CCTCGATGACATC- CTTGG; internal control for RT-PCR experiments) were synthesized on the basis of available sequences (15, 27). Cycle parameters for AChE included denaturation for 1 min at 94°C followed by primer annealing and extension at 70°C for 3 min. Primer annealing and extension for rRNA were 54°C for 1 min and 72°C for 2 min, respectively. In each experiment, the last cycle was followed by a 10-min elongation step at 72°C. The PCR products were visualized on 1% ethidium bromide-stained agarose gels. Quantitation of the PCR products was performed by separating PCR products in agarose gels containing the fluorescent dye VistraGreen (Amersham; Arlington Heights, IL), and the labeling intensity of the PCR product, which is linearly related to the amount of DNA, was quantitated using a Storm PhosphorImager and analyzed with the ImageQuant software program (Molecular Dynamics, Sunnyvale, CA). All values obtained for AChE were corrected according to their corresponding level of rRNA present in the sample.
All RT-PCR experiments aimed at determining the relative abundance of AChE mRNA in fast and slow muscles as well as in cultured myotubes derived from fast and slow myogenic cells were performed using cycle numbers that lay within the linear phase of amplification (8, 24, 32). The cycle numbers were 37 for AChE and 28 for rRNA. RT-PCR conditions (primer concentrations, input RNA, choice of RT primer, cycling conditions) were initially optimized, and they were identical for all samples. Appropriate precautions (use of sterile filtered tips and gloves) were taken to avoid contamination and RNA degradation. Samples, including the negative controls (RNase-free water), were always prepared using the same master mixes of RT and PCR reagents and they were run in parallel. In all experiments, PCR products were never detected in these negative controls.
Nuclear run-on assays. Nuclear run-on
assays were performed as described elsewhere (2, 8). Nuclei were
obtained by homogenizing ~1 g of frozen EDL or Sol muscle (8 or 9 muscles) in 10 vol of lysis buffer made of 0.3 M sucrose, 60 mM KCl, 15 mM NaCl, 15 mM HEPES, pH 7.5, 2 mM EDTA, 0.5 mM EGTA, 0.15 mM spermine,
0.5 mM spermidine, 10 mM dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride. Typically, we obtained approximately 4 × 106 nuclei per gram of muscle
tissue. After centrifugation, pellets were resuspended in 1 ml of lysis
buffer containing 0.05% Nonidet P-40 for further homogenization.
Nuclei were then sedimented at 500 g and resuspended in transcription
buffer containing 0.6 M (NH4)2SO4;
0.4 M Tris, pH 7.9; 0.2 M MgCl2;
0.2 M MnCl2; 1 M NaCl; 100 mM
EDTA, pH 8; 0.02 M phenylmethylsulfonyl fluoride; 1 mM dithiothreitol;
10 mM creatine phosphate; 1 mM each of GTP, ATP, and CTP; 5% glycerol;
50 U of RNase inhibitor (Promega, Madison, WI); and 200 µCi of
[
-32P]UTP to a
final volume of 200 µl. RNA was transcribed at 28°C for 30 min.
After RQ1 DNase (Promega) treatment, labeled RNA was isolated using
Trizol and hybridized for 48 h with 10 µg of genomic DNA, linearized
AChE (2 kb), and
-actin (2 kb) cDNAs as well as the empty plasmids
pEF-BOS (AChE) and Bluescript (SK) (actin) immobilized on Genescreen
Plus nylon membrane (DuPont). After hybridization, membranes were
washed thoroughly [1 × SSC (1× SSC is 0.15 M NaCl and
0.015 M sodium citrate, pH 7.0), 0.1% SDS] at 42°C and
exposed for autoradiography at
80°C for 2-5 days with
intensifying screens. The intensity of the signals was quantified using
a Storm PhosphorImager (Molecular Dynamics). The signals corresponding
to AChE were standardized relative to the
-actin signal.
Hybridization signals were below detectable levels for SK and pEF-BOS
empty plasmids.
Statistical analysis. Student's t-tests were performed to determine whether the differences between group means were significant. The level of significance was set at P < 0.05. The data are expressed as means ± SE throughout.
| |
RESULTS |
|---|
|
|
|---|
AChE expression in mature slow- and fast-contracting
hindlimb muscles. Determination of AChE activity in
mature slow Sol and fast EDL muscles, which are muscles of similar
size, revealed that EDL muscles contained significantly higher enzyme
activity than previously reported (Fig. 1;
P < 0.05; see Refs. 1, 17, 19). In
agreement with previous studies (see, for example, Ref. 23),
significant differences between the proportions of the various AChE
molecular forms were also observed in Sol and EDL muscles (Fig.
2). Notably, asymmetric forms accounted for
a greater proportion of total AChE activity in Sol muscles (~50%
compared with 20% in EDL), whereas globular forms, particularly
G4, were relatively more abundant
in EDL muscles (G4 content ~40%
compared with 20% in Sol; see also Table 1).
|
|
We next examined whether fast EDL and slow Sol muscles exhibited
differences in the pattern of expression of the AChE gene. We initially
determined the relative amount of AChE transcripts in Sol and EDL
muscles by RT-PCR. As shown in Fig. 3, AChE
mRNA levels, normalized to rRNA, were found to be approximately
fivefold greater (P < 0.05) in EDL
muscles compared with Sol muscles. Given these findings, we assessed
whether these differences in AChE mRNA content between fast- and
slow-contracting muscles could be attributed to enhanced
transcriptional activity of the AChE gene in fast muscles. To address
this issue, we performed nuclear run-on assays using nuclei isolated
from Sol and EDL muscles. Representative hybridization signals of newly
synthesized AChE mRNA, reflecting transcriptional activity of the AChE
gene, are shown in Fig.
4A.
Quantitative analysis revealed that nuclei isolated from both Sol and
EDL muscles transcribed the AChE gene at approximately the same rate
(Fig. 4B;
P > 0.05).
|
|
AChE expression in myotubes obtained from clonal satellite cells isolated from slow and fast muscle fibers. Given that fast-contracting muscles display significantly higher levels of AChE activity and transcripts as well as distinct molecular form profiles compared with their slow-twitch counterparts, we determined whether myogenic precursor cells originating from fast and slow muscle fibers are intrinsically programmed to express distinct AChE profiles. To achieve this objective, Sol and TAS muscles were excised from adult Immorto transgenic mice (see MATERIALS AND METHODS) and single myogenic cells were isolated from slow Sol and fast TAS muscle fibers. We took advantage of the fact that single clonal myogenic cells can be isolated directly from slow and fast muscle fibers and subsequently grown to give rise to a pure population of myoblasts capable of undergoing normal myogenic differentiation in culture (33). This approach therefore enabled us to analyze the pattern of AChE expression in two separate populations of myotubes.
We first measured total AChE activity in myotube cultures obtained from
single myogenic cell clones derived from slow Sol and fast TAS muscle
fibers. Figure 5 shows that cell-associated (Fig. 5A) and secreted (Fig.
5B) AChE activity were nearly
identical for both myotube populations
(P > 0.05). AChE specific activity (per mg of protein) for both cell-associated and secreted enzyme was
also found to be similar for both sets of cultures (data not shown).
Analysis of AChE molecular form profiles using myotube extracts
revealed that asymmetric forms, particularly
A12, were readily detected in
these myotubes along with G4,
G2, and a high level of
G1 (Fig.
6). Furthermore, the relative proportions
of cell-associated molecular forms in myotubes derived from myogenic cells isolated from Sol (Fig. 6A)
and TAS (Fig. 6B) muscle fibers showed the same distribution (Table 1). In
the fusion media, G4 and
G1 were the only detectable forms
of the enzyme with comparable levels for both myotube populations (Fig.
6; Table 1). Consistent with these AChE activity data, we did not
observe differences in the abundance of AChE transcripts between these
two myotube populations (Fig. 7;
P > 0.05).
|
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Several lines of evidence have clearly demonstrated that motoneuron-derived signals, such as electrical activity and trophic molecules, play pivotal roles in regulating AChE expression in skeletal muscle (reviewed in Ref. 30). In addition, mechanical loading has recently been shown to also influence AChE expression in skeletal muscle cells (21). However, the contribution of these extrinsic factors versus intrinsic factors in controlling AChE synthesis in skeletal muscle remains controversial and needs to be clearly established if the ultimate goal is to understand all of the events contributing to the regulation of AChE in slow and fast muscles. In the present study, we provide evidence that myotubes derived from a pure population of myogenic precursor cells isolated from slow and fast muscle fibers exhibit intrinsically similar patterns of AChE expression. These findings indicate that differences in AChE expression between fast and slow muscles are not due to inherent differences in myogenic precursor cells, thereby suggesting that other factors, such as innervation, play a predominant role in establishing the distinct patterns of AChE expression in these muscle types.
Mechanisms regulating AChE expression in slow- and fast-contracting muscles in vivo. Compared with slow skeletal muscles, fast muscles of rats display significantly greater AChE activity, which is paralleled by a higher level of AChE mRNA (10, 32, 41). In the present study, we show that AChE mRNAs are fivefold more abundant in fast versus slow muscles, thereby confirming recent findings (41). However, we demonstrate also that AChE activity in fast muscle is only twofold higher. The more modest differences in AChE activity between slow and fast muscles compared with the larger variations in their AChE mRNA content, suggest therefore that the production of AChE molecules in muscle may also be regulated at the translational or posttranslational level. Indeed, evidence for translational control of AChE biosynthesis was reported recently in rats treated with glucocorticoids (4). Whereas AChE mRNA levels assessed by Northern blot remained unchanged in fast muscles of glucocorticoid-treated versus nontreated animals, substantial reductions in the levels of G1 and G2 molecular forms were reported, indicating that AChE protein synthesis was specifically hindered under these experimental conditions (4). Similarly, we have also shown that posttranslational events and, in particular, the association of AChE catalytic subunits with the collagenic structural subunit, may in fact enhance AChE activity in cultured muscle cells through the stabilization of newly synthesized catalytic peptides (29). A similar stabilization mechanism may also account for the more modest differences seen in AChE activity between slow and fast muscles, because it was recently shown that the collagenic structural subunit is more abundant in slow muscles (26).
One issue that had yet to be resolved is whether greater levels of AChE expression in fast muscles are due to enhanced transcription of the AChE gene in this muscle type. In the present investigation, we measured by run-on assays the levels of newly synthesized AChE mRNAs in nuclei isolated from slow Sol and fast EDL muscles. Our analysis showed that the rate of AChE gene transcription in both muscle types was similar, thereby indicating that posttranscriptional mechanisms are important in controlling the levels of AChE transcripts in slow versus fast muscles.
Previous in vitro experiments using cultured neural (9), hematopoietic (8), and myogenic cells (16) have provided evidence that enhanced AChE mRNA stability accounts for the increase in AChE expression that occurs during differentiation of these cells. Our current data support and extend these findings by indicating that a similar regulatory mechanism is likely playing a role in vivo by controlling the levels of AChE mRNA in slow and fast muscles. Interestingly, posttranscriptional mechanisms have also been postulated to regulate the differential expression of the cytochrome c gene in slow and fast muscles (44). Although the mechanisms that dictate the half-life of AChE transcripts in muscle have yet to be elucidated, it is reasonable to envisage that interactions between trans-acting factors and regions along the mRNA and, in particular, in the 3'-untranslated region, are involved (for review, see Ref. 37). Therefore, the abundance of trans-acting factors involved in RNA-protein interactions may differ in slow and fast muscles, thereby controlling the longevity of AChE transcripts in these muscle types.
Myotubes derived from myogenic clonal cells isolated from slow or fast muscle fibers display similar patterns of AChE expression. Findings from previous studies suggest that slow and fast muscle fibers are intrinsically programmed to display distinct patterns of AChE expression. For example, Dolenc and colleagues (11) showed that slow and fast muscles of adult rats undergoing regeneration due to an ischemic-toxic injury, in the presence or absence of the nerve, display distinct molecular form profiles comparable to those seen in intact slow and fast muscles, respectively (11). These findings imply that myogenic precursor cells from slow and fast muscles, which are activated during the regeneration process, are therefore preprogrammed to express distinct AChE molecular form profiles. In our experiments, we were able to obtain clonal populations of myogenic precursor cells from single muscle fibers of the slow Sol and fast TAS muscles, which comprise 60% type I/40% type IIA fibers and 80% type IIB/20% type IIX fibers, respectively (45). This enabled, therefore, the analysis of myotubes generated from a single myogenic cell isolated from either slow or fast muscle fibers. With this approach, which has been used previously to obtain several conditionally immortal cell lines from a variety of tissues (7, 20, 25, 43), including skeletal muscle (33), we demonstrate that myotubes generated from clonal populations of myoblasts obtained from the proliferation of single myogenic cells isolated from slow or fast muscle fibers, display nearly identical patterns of AChE expression. Specifically, these two myotube populations displayed similar total AChE activity, molecular form profiles, and transcript levels.
The reasons for these divergent results may be explained if we consider that during regeneration, fusion of satellite cells with preexisting muscle fibers that survive ischemic-toxic injury may express AChE molecular form profiles of the host fiber under the influence of mechanisms that override the intrinsic program of these satellite cells (22). In addition, satellite cells associated with muscle fibers within the core of the muscle may be damaged during severe ischemic conditions, thereby affecting their normal program of AChE expression (35, 38). Because interaction with other cell types or molecules influences the phenotype of myogenic cells (6, 12), it is also possible that in situ regeneration of muscle fibers within a previously deposited basal lamina may induce these cells to express an AChE profile reminiscent of that expressed in previously existing fibers. In this context, basal lamina-associated molecules, such as agrin and ARIA, which are known to regulate the expression of genes encoding synaptic proteins in muscle (for review, see Ref. 5), may continue to exert their effects within regenerating muscles. Given the above caveats, similar intrinsic regulation of AChE expression in myogenic precursor cells from slow and fast muscle fibers, as observed in the present investigation, may have been masked in previous studies using the regeneration model (11, 40).
Contribution of extrinsic versus intrinsic factors in regulating AChE molecular form profiles in slow- and fast-contracting muscles. In a recent study, we showed that inactivated, although still innervated, slow and fast hindlimb muscles expressed a common molecular form profile resembling that expressed in slow muscles (1). Our present findings provide evidence that myogenic precursor cells from slow or fast muscle fibers give rise to myotubes that also express comparable AChE molecular form profiles. In addition, the molecular form distributions of these myotubes displayed characteristics intermediate to those seen in slow and fast muscles in vivo. Together, these findings indicate that extrinsic factors and, in particular, nerve-derived signals, play a predominant role in establishing distinct AChE molecular form profiles in slow versus fast muscles in vivo. In this context, it is noteworthy that in the study of Dolenc et al. (11), regenerating fast muscles eventually altered their AChE profiles to a slow type after prolonged reinnervation by the soleus nerve, further highlighting the important contribution of innervation (11).
Previous studies have shown that Sol and EDL muscles from postnatal rats already display prominent differences in their molecular form profiles (40), despite receiving at this developmental stage similar high-frequency impulse patterns delivered by their respective innervating motoneurons (34). On the basis of these findings, it has been suggested that early postnatal slow and fast muscles are preprogrammed to express distinct AChE molecular form profiles independently of neural activation. However, an alternative explanation for these observations relates to the findings that slow muscles are known to be largely insensitive to phasic, high-frequency activity, whereas fast muscles readily adapt to this activity pattern, as previously reported (1, 23). Thus the distinct AChE profiles seen in neonatal fast and slow muscles likely reflect 1) the adaptation of a basic AChE profile to high-frequency activity in fast muscle and 2) the refractiveness of slow muscles to this type of neuromuscular activation.
The availability of structural subunits such as the collagenic and hydrophobic tails, is believed to dictate the relative proportions of asymmetric forms and hydrophobic-tailed tetramers synthesized in cells (26, 27, 29). Because in the current study we found that fast and slow myotube populations expressed similar levels of AChE activity as well as comparable proportions of asymmetric and G4 forms, it is reasonable to postulate that AChE-associated structural subunits are also expressed at similar levels within these myotubes. Transformation of AChE molecular form profiles from those expressed in myotubes into those observed in adult slow or fast muscles may therefore also be dependent on parallel modifications in the synthesis of the structural subunits. Accordingly, levels of the collagenic as well as the hydrophobic structural subunits may be highly sensitive to innervation and specific patterns of electrical activity (i.e., tonic vs. phasic), which, in turn, could dictate the molecular form distributions observed in slow- and fast-contracting muscles (42). Future studies aimed at determining the impact of neural signals on the expression of these structural subunits should prove useful for our understanding of additional biosynthetic events underlying the plasticity of AChE expression in muscle.
Perspectives
The phenotype of skeletal muscles is strongly influenced by nerve-derived signals, although intrinsic properties of the muscles may also determine its characteristics. In the present investigation, we demonstrate that intrinsic factors do not account for the distinct patterns of AChE expression displayed by fast- and slow-contracting skeletal muscles. Rather, extrinsic factors such as motoneuron-derived signals, i.e., electrical activity and trophic factors, as well as mechanical loading appear as key determinants governing expression of this enzyme via posttranscriptional regulatory mechanisms. In this context, our findings indicate that these extrinsic factors likely initiate signaling cascades that culminate 1) in the modulation of AChE mRNA stability and 2) in the assembly of AChE catalytic subunits with available structural subunits.| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Victor Gisiger for providing us with some reagents and for fruitful discussions.
| |
FOOTNOTES |
|---|
This work was supported by an operating grant from the Medical Research Council of Canada (MRC) to B. J. Jasmin. B. J. Jasmin was a Scholar of the MRC during the course of this work and is now an MRC Scientist.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: B. J. Jasmin, Dept. of Cellular and Molecular Medicine, Faculty of Medicine, Univ. of Ottawa, 451 Smyth Rd., Ottawa, Ontario, Canada K1H 8M5 (E-mail: jasmin{at}uottawa.ca).
Received 11 March 1999; accepted in final form 1 July 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Boudreau-Larivière, C.,
V. Gisiger,
R. N. Michel,
D. A. Hubatsch,
and
B. J. Jasmin.
Fast and slow skeletal muscles express a common basic profile of acetylcholinesterase molecular forms.
Am. J. Physiol.
272 (Cell Physiol. 41):
C68-C76,
1997
2.
Boudreau-Larivière, C.,
and
B. J. Jasmin.
Calcitonin gene-related peptide decreases expression of acetylcholinesterase in mammalian myotubes.
FEBS Lett.
444:
22-26,
1999[Web of Science][Medline].
3.
Boudreau-Larivière, C.,
H. Sveistrup,
D. J. Parry,
and
B. J. Jasmin.
Ciliary neurotrophic factor: regulation of acetylcholinesterase in skeletal muscle and distribution of messenger RNA encoding its receptor in synaptic versus extrasynaptic compartments.
Neuroscience
73:
613-622,
1996[Web of Science][Medline].
4.
Brank, M.,
K. Zajc-Kreft,
S. Kreft,
R. Komel,
and
Z. Grubic.
Biogenesis of acetylcholinesterase is impaired, although its mRNA level remains normal, in the glucocorticoid-treated rat skeletal muscle.
Eur. J. Biochem.
251:
374-381,
1998[Web of Science][Medline].
5.
Burden, S. J.
The formation of neuromuscular synapses.
Genes Dev.
12:
133-148,
1998
6.
Butler, J.,
E. Cosmos,
and
P. Cauwenbergs.
Positional signals: evidence for a possible role in muscle fibre-type patterning of the embryonic avian limb.
Development
102:
763-772,
1988
7.
Chambers, T. J.,
J. M. Owens,
G. Hattersley,
P. S. Jat,
and
M. D. Noble.
Generation of osteoclast-inductive and osteoclastogenic cell lines from the H-2KbtsA58 transgenic mouse.
Proc. Natl. Acad. Sci. USA
90:
5578-5582,
1993
8.
Chan, R. Y. Y.,
F. Adatia,
A. M. Krupa,
and
B. J. Jasmin.
Increased expression of acetylcholinesterase T and R transcripts during hematopoietic differentiation is accompanied by parallel elevations in the levels of their respective molecular forms.
J. Biol. Chem.
273:
9727-9733,
1998
9.
Coleman, B. A.,
and
P. Taylor.
Regulation of acetylcholinesterase expression during neuronal differentiation.
J. Biol. Chem.
271:
4410-4416,
1996
10.
Cresnar, B.,
N. Crne-Finderle,
K. Breskvar,
and
J. Sketelj.
Neural regulation of muscle acetylcholinesterase is exerted on the level of its mRNA.
J. Neurosci. Res.
38:
294-299,
1994[Web of Science][Medline].
11.
Dolenc, I.,
N. Crne-Finderle,
I. Erzen,
and
J. Sketelj.
Satellite cells in slow and fast rat muscles differ in respect to acetylcholinesterase regulation mechanisms they convey to their descendant myofibers during regeneration.
J. Neurosci. Res.
37:
236-246,
1994[Web of Science][Medline].
12.
Donoghue, M. J.,
R. Morris-Valero,
Y. R. Johnson,
J. P. Merlie,
and
J. R. Sanes.
Mammalian muscle cells bear a cell-autonomous, heritable memory of their rostrocaudal position.
Cell
69:
67-77,
1992[Web of Science][Medline].
13.
Ellman, G. L.,
K. D. Courtney,
V. Andres,
and
R. M. Featherstone.
A new and rapid colorimetric determination of acetylcholinesterase activity.
Biochem. Pharmacol.
7:
88-95,
1961[Web of Science][Medline].
14.
Fernandez, H. L.,
R. D. Moreno,
and
N. C. Inestrosa.
Tetrameric (G4) acetylcholinesterase: structure, localization, and physiological regulation.
J. Neurochem.
66:
1335-1346,
1996[Web of Science][Medline].
15.
Forster, E.,
U. Otten,
and
M. Frotscher.
Developmental neurotrophin expression in slice cultures of rat hippocampus.
Neurosci. Lett.
155:
216-219,
1993[Web of Science][Medline].
16.
Fuentes, M. E.,
and
P. Taylor.
Control of acetylcholinesterase gene expression during myogenesis.
Neuron
10:
679-687,
1993[Web of Science][Medline].
17.
Gisiger, V.,
and
H. R. Stephens.
Asymmetric and globular forms of AChE in slow and fast muscles of 129/ReJ normal and dystrophic mice.
J. Neurochem.
41:
919-929,
1983[Web of Science][Medline].
18.
Gisiger, V.,
and
H. R. Stephens.
Localization of the pool of G4 acetylcholinesterase characterizing fast muscles and its alteration in murine muscular dystrophy.
J. Neurosci. Res.
19:
62-78,
1988[Web of Science][Medline].
19.
Groswald, D. E.,
and
W.-D. Dettbarn.
Characterization of acetylcholinesterase molecular forms in slow and fast muscle of rat.
Neurochem. Res.
8:
983-995,
1983[Web of Science][Medline].
20.
Groves, A. K.,
S. C. Barnett,
R. J. M. Franklin,
A. J. Crang,
M. Mayer,
W. F. Blakemore,
and
M. D. Noble.
Repair of demyelinated lesions by transplantation of purified 0-2A progenitor cells.
Nature
362:
453-455,
1993[Medline].
21.
Hubatsch, D.,
and
B. J. Jasmin.
Mechanical stimulation increases expression of acetylcholinesterase in cultured myotubes.
Am. J. Physiol.
273 (Cell Physiol. 42):
C2002-C2009,
1997
22.
Hughes, S. M.,
and
H. M. Blau.
Muscle fiber pattern is independent of cell lineage in postnatal rodent development.
Cell
68:
659-671,
1992[Web of Science][Medline].
23.
Jasmin, B. J.,
and
V. Gisiger.
Regulation by exercise of the pool of G4 acetylcholinesterase characterizing fast muscles: opposite effect of running training in antagonist muscles.
J. Neurosci.
10:
1444-1454,
1990[Abstract].
24.
Jasmin, B. J.,
R. K. Lee,
and
R. L. Rotundo.
Compartmentalization of acetylcholinesterase mRNA and enzyme at the vertebrate neuromuscular junction.
Neuron
11:
467-477,
1993[Web of Science][Medline].
25.
Jat, P. S.,
M. D. Noble,
P. Ataliotis,
Y. Tanaka,
N. Yannoutsos,
L. Larsen,
and
D. Kioussis.
Direct derivation of conditionally immortal cell lines from an H-2Kb-tsA58 transgenic mouse.
Proc. Natl. Acad. Sci. USA
88:
5096-5100,
1991
26.
Krejci, E.,
S. Thomine,
N. Boschetti,
C. Legay,
J. Sketelj,
and
J. Massoulié.
The mammalian gene of acetylcholinesterase-associated collagen.
J. Biol. Chem.
272:
22840-22847,
1997
27.
Legay, C.,
S. Bon,
P. Vernier,
F. Coussen,
and
J. Massoulié.
Cloning and expression of a rat acetylcholinesterase subunit: generation of multiple molecular forms and complementarity with a Torpedo collagenic subunit.
J. Neurochem.
60:
337-346,
1993[Web of Science][Medline].
28.
Legay, C.,
E. Krejci,
P. Ascher,
and
J. Massoulié.
Acetylcholinesterase at the neuromuscular junction: mechanisms of accumulation.
Soc. Neurosci. Abstr.
24:
790,
1998.
29.
Legay, C., F. A. Mankal, J. Massoulié, and B. J. Jasmin.
Stability and secretion of acetylcholinesterase splice variants in
skeletal muscle cells. J. Neurosci. In press.
30.
Massoulié, J.,
L. Pezzementi,
S. Bon,
E. Krejci,
and
F.-M. Vallette.
Molecular and cellular biology of cholinesterases.
Prog. Neurobiol.
41:
31-91,
1993[Web of Science][Medline].
31.
McMahan, U. J.,
J. R. Sanes,
and
L. M. Marshall.
Cholinesterase is associated with the basal lamina at the neuromuscular junction.
Nature
271:
72-74,
1978.
32.
Michel, R. N.,
C. Q. Vu,
W. Tetzlaff,
and
B. J. Jasmin.
Neural regulation of acetylcholinesterase mRNAs at mammalian neuromuscular synapses.
J. Cell Biol.
127:
1061-1069,
1994
33.
Morgan, J. E.,
J. R. Beauchamp,
C. N. Pagel,
M. Peckham,
P. Ataliotis,
P. S. Jat,
M. D. Noble,
K. Farmer,
and
T. A. Partridge.
Myogenic cell lines derived from transgenic mice carrying a thermolabile T antigen: a model system for the derivation of tissue-specific and mutation-specific cell lines.
Dev. Biol.
162:
486-498,
1994[Web of Science][Medline].
34.
Navarrete, R.,
and
G. Vrbova.
Changes of activity patterns in slow and fast muscles during postnatal development.
Dev. Brain Res.
8:
11-19,
1983.
35.
Phillips, G. D.,
D. Lu,
V. I. Mitashov,
and
B. M. Carlson.
Survival of myogenic cells in freely grafted rat rectus femoris and extensor digitorum longus muscles.
Am. J. Anat.
180:
365-372,
1987[Web of Science][Medline].
36.
Rosenblatt, J. D.,
A. I. Lunt,
D. J. Parry,
and
T. A. Partridge.
Culturing satellite cells from living single muscle fiber explants.
In Vitro Cell. Dev. Biol.
31:
773-779,
1995.
37.
Ross, J.
mRNA stability in mammalian cells.
Microbiol. Rev.
59:
423-450,
1995
38.
Schultz, E.,
D. J. Albright,
D. L. Jaryszak,
and
T. L. David.
Survival of satellite cells in whole muscle transplants.
J. Anat. Rec.
222:
12-17,
1988.
39.
Schultz, E.,
and
K. M. McCormick.
Skeletal muscle satellite cells.
Rev. Physiol. Biochem. Pharmacol.
123:
213-257,
1994[Web of Science][Medline].
40.
Sketelj, J.,
N. Crne-Finderle,
S. Ribaric,
and
M. Brzin.
Interactions between intrinsic regulation and neural modulation of acetylcholinesterase in fast and slow skeletal muscles.
Cell. Mol. Neurobiol.
11:
35-54,
1991[Web of Science][Medline].
41.
Sketelj, J.,
N. Crne-Finderle,
B. Strukelj,
J. V. Trontelj,
and
D. Pette.
Acetylcholinesterase mRNA level and synaptic activity in rat muscles depend on nerve-induced pattern of muscle activation.
J. Neurosci.
18:
1944-1952,
1998
42.
Sveistrup, H.,
R. Y. Y. Chan,
and
B. J. Jasmin.
Chronic enhancement of neuromuscular activity increases acetylcholinesterase gene expression in skeletal muscle.
Am. J. Physiol.
269 (Cell Physiol. 38):
C856-C862,
1995
43.
Whitehead, R. H.,
P. E. VanEeden,
M. D. Noble,
P. Ataliotis,
and
P. S. Jat.
Establishment of conditionally immortalized epithelial cell lines from both colon and small intestine of adult H-2KbtsA58 transgenic mice.
Proc. Natl. Acad. Sci. USA
90:
587-591,
1993
44.
Yan, Z.,
and
F. W. Booth.
Cytochrome c promoter activity in soleus and white vastus lateralis muscles in rats.
J. Appl. Physiol.
85:
973-978,
1998
45.
Zardini, D. M.,
and
D. J. Parry.
Identification, distribution, and myosin subunit composition of type IIX fibers in mouse muscles.
Muscle Nerve
17:
1308-1316,
1994[Web of Science][Medline].
This article has been cited by other articles:
![]() |
P. Pregelj, M. Trinkaus, D. Zupan, J. J. Trontelj, and J. Sketelj The Role of Muscle Activation Pattern and Calcineurin in Acetylcholinesterase Regulation in Rat Skeletal Muscles J. Neurosci., January 31, 2007; 27(5): 1106 - 1113. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Huang, R. G. Dennis, and K. Baar Cultured slow vs. fast skeletal muscle cells differ in physiology and responsiveness to stimulation Am J Physiol Cell Physiol, July 1, 2006; 291(1): C11 - C17. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-M. Joseph, A. A. Rungi, B. H. Robinson, and D. A. Hood Compensatory responses of protein import and transcription factor expression in mitochondrial DNA defects Am J Physiol Cell Physiol, April 1, 2004; 286(4): C867 - C875. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. O. Gramolini, G. Belanger, J. M. Thompson, J. V. Chakkalakal, and B. J. Jasmin Increased expression of utrophin in a slow vs. a fast muscle involves posttranscriptional events Am J Physiol Cell Physiol, October 1, 2001; 281(4): C1300 - C1309. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |