AJP - Regu Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 278: R140-R148, 2000;
0363-6119/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boudreau-Larivière, C.
Right arrow Articles by Jasmin, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boudreau-Larivière, C.
Right arrow Articles by Jasmin, B. J.
Vol. 278, Issue 1, R140-R148, January 2000

Myotubes originating from single fast and slow satellite cells display similar patterns of AChE expression

Céline Boudreau-Larivière, David J. Parry, and Bernard J. Jasmin

Department of Cellular and Molecular Medicine, Faculty of Medicine, University of Ottawa, Ottawa, Ontario, Canada K1H 8M5


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Slow- and fast-contracting skeletal muscles of both rats and mice display significant differences in their patterns of acetylcholinesterase (AChE) expression. Although neural influences are known to account for a large proportion of these differences, intrinsic variations between fast and slow myogenic precursor cells have been implicated. In the present study, we have capitalized on the use of Immorto transgenic mice to obtain single myogenic precursor cells isolated from either slow or fast muscle fibers and determined whether these cells generated myotubes that produced distinct patterns of AChE expression as observed in vivo between slow and fast muscles. These two myotube populations displayed similar cell-associated and secreted AChE enzyme activity as well as comparable levels of AChE transcripts. Both myotube populations also expressed nearly identical molecular form profiles. By contrast, AChE activity and transcript levels were approximately two- and fivefold greater in fast skeletal muscles compared with slow ones. Together, these findings indicate that differences in AChE expression between fast and slow muscles are not due to inherent differences in myogenic precursor cells, thereby suggesting that other factors, such as innervation, play a predominant role in establishing the distinct patterns of AChE expression in these muscle types.

acetylcholinesterase; neuromuscular junction; plasticity; activity; myoblasts


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

ACETYLCHOLINESTERASE (AChE) is a key constituent of central and peripheral cholinergic synapses, where it hydrolyzes acetylcholine released by nerve terminals, thereby ensuring efficient neurotransmission. The enzyme exists as a family of several molecular forms expressed in a variety of tissues at specific subcellular compartments (for example, see Ref. 30). Specifically, homomeric forms include globular monomers (G1), dimers (G2), and tetramers (G4). Heteromeric forms, on the other hand, encompass asymmetric forms composed of either one (A4), two (A8), or three (A12) tetramers associated with a collagenic structural subunit (26) as well as a membrane-linked G4 tetramer attached to a hydrophobic anchor (14). In skeletal muscle, the asymmetric forms accumulate within the synaptic basal lamina of the neuromuscular junction (31), whereas tetramers are concentrated within the perijunctional region of nerve-muscle contacts (18).

Several studies have shown that the pattern of AChE expression differs significantly between slow- and fast-contracting muscles. For instance, total AChE activity is greater in fast versus slow muscles of rat and mouse (17, 19). Analysis of the molecular form distributions in fast and slow muscles also revealed that the relative content of G4 is considerably higher in fast muscles, whereas the levels of asymmetric forms are proportionately greater in slow muscles (17, 19). Recent studies further demonstrated that the levels of transcripts encoding AChE are higher in fast- versus slow-contracting muscles (10, 32, 41).

Although neural activity is recognized as being responsible for a large proportion of these differences in AChE expression between mature fast and slow muscles (see, for instance, Ref. 23 and references therein), intrinsic properties of the two muscle types appear to also contribute to these variations. For example, soleus (Sol) and extensor digitorum longus (EDL) muscles from postnatal rats already display prominent differences in their molecular form profiles (40) despite receiving, at this developmental stage, similar impulse patterns delivered by their respective innervating motoneurons (34). Furthermore, when slow and fast rat hindlimb muscles are forced to undergo regeneration in situ in the presence or absence of innervation or at a different functional site by transplantation, regenerated muscles display AChE molecular form profiles resembling those observed in the original slow or fast muscle (11, 40). These latter data have been interpreted to suggest that myogenic precursors or satellite cells, which undergo proliferation and differentiation during the process of muscle regeneration (reviewed in Ref. 39), are intrinsically programmed to express either slow or fast AChE profiles independent of the presence of the motor nerve (11, 40).

In the present study, we further examined the contribution of intrinsic factors in determining the patterns of AChE expression in fast versus slow muscles of small rodents. Specifically, we assessed the profiles of AChE expression in myotubes derived from single myogenic satellite cell clones isolated from either slow or fast muscle fibers excised from H-2Kb-tsA58 (Immorto) transgenic mice. These transgenic mice harbor a temperature-sensitive SV40 large-T-antigen gene (tsA58) controlled by the activity of an interferon-gamma (IFN-gamma )-sensitive promoter (H-2Kb), which elicits indefinite growth of the cells under permissive conditions (25). Under nonpermissive conditions, these cells are capable of undergoing normal myogenic differentiation (33). Accordingly, we took advantage of these mice to obtain pure populations of myotubes derived from a single myogenic cell isolated from either a slow or fast fiber. The pattern of AChE expression from these two myotube populations was therefore determined and compared with the profiles displayed by slow and fast skeletal muscles.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Animal care and surgery. Female Sprague-Dawley rats weighing ~250 g were obtained from Charles River Laboratories (St. Constant, Québec). Rats were killed using CO2, and the EDL and Sol muscles were excised, frozen in liquid nitrogen, and stored at -80°C until further analysis. Immorto mice (H-2Kb-tsA58 transgenic mice; see Ref. 25) were originally obtained from Charles River Laboratories, and they were subsequently bred in the University of Ottawa Animal Care Facility. Transgenic mice were killed by barbiturate overdose, and the superficial portion of the tibialis anterior (TAS) muscle and the entire Sol muscle, which contain fast and slow muscle fibers, respectively (45), were carefully excised to minimize muscle fiber damage. Care and treatment of the animals were in accordance with the guidelines established by the Canadian Council on Animal Care.

Clonal myogenic cell cultures. TAS and Sol muscles from 6- to 8-wk-old Immorto mice were rinsed briefly in sterile PBS and digested at 35°C for 1.5-2 h in a plastic petri dish containing type I collagenase (Sigma, St. Louis, MO) in DMEM (GIBCO BRL, Burlington, ON). Single muscle fibers from TAS and Sol muscles were then isolated as previously described (36). Briefly, after muscle digestion, single muscle fibers were dissociated by repeated trituration in DMEM with fire-polished-tip Pasteur pipettes. Single intact muscle fibers were transferred to Matrigel (Collaborative Biomedical Products, Bedford, MA)-coated 24-well tissue culture plates (1 fiber/well) and given 3 min to attach before the addition of plating medium consisting of 10% horse serum (HS) and 0.5% chick embryo extract in DMEM. After ~3 days in culture, satellite cells displaying myogenic morphology detached from the single muscle fibers. Single myogenic cells were isolated in one of two ways. In the first procedure, the fiber was removed from the well as soon as a single satellite cell had detached, and, at this point, the plating medium was then replaced with growth medium containing 10% fetal bovine serum (FBS), 20% HS, 1% chick embryo extract, and 2% L-glutamine in DMEM. Myogenic cells were grown at 33°C in 5% CO2 in the presence of mouse recombinant IFN-gamma (20 U/ml; GIBCO). If several satellite cells detached, a second procedure was used. The fiber was removed, and the satellite cells were induced to proliferate in growth medium. The cells were then trypsinized and plated at low density in Matrigel-coated 35 mm tissue culture plates from which single myogenic cells were subsequently isolated with cloning cylinders. Regardless of the isolation procedure, when cells were near confluency, they were passaged and plated on a 6 × 35 mm well plate. Upon confluency, cells were incubated at 37°C in 5% CO2 in fusion medium 1 containing 5% HS for 24 h. Fusion medium 1 was then replaced with a second fusion medium (medium 2) containing 2% HS for a total of 4 days (see Ref. 36).

Extraction of AChE from cultured myotubes and mature muscles. Cultures of myotubes (4 × 35 mm wells) obtained from the fusion of myogenic cells from fast and slow muscles were washed with cold PBS, scraped, and homogenized in 1 ml of a high-salt detergent buffer containing anti-proteolytic agents: 10 mM Tris · HCl, pH 7.0; 10 mM EDTA; 1 M NaCl; 1% Triton X-100; 1 mg/ml bacitracin (Sigma); and 25 U/ml aprotinin (Sigma). Whole Sol and EDL muscles, conversely, were homogenized in 2 ml of extraction buffer. Homogenization was performed on ice for 30 s with a Polytron set at low speed. The homogenates were centrifuged (20,000 g) at 4°C for 15 min, and the supernatants were collected and frozen at -80°C. To assess AChE activity secreted from myotubes derived from fast and slow myogenic cells, diisopropyl fluorophosphate (DFP; Sigma)-treated HS was used to prepare fusion medium 2. Endogenous serum AChE was inactivated by incubating the HS with DFP for 48 h and then allowing the DFP to degrade for 10 days. Samples of fusion medium 2 that had been incubated with myotubes for 48 h before harvesting were collected and spun at 2,000 rpm to remove cell debris. Supernatants were kept at -80°C until further analysis.

AChE enzyme assay and velocity sedimentation analysis. AChE activity was measured using a modified version of the spectrophotometric method of Ellman et al. (13) as described previously (17, 23). Fifty-microliter aliquots were incubated in 1 ml of a phosphate buffer solution (pH 7.0) containing 7.5 × 10-4 M acetylthiocholine (Sigma) as the substrate and 5 × 10-4 M dithio-bis(nitrobenzoic acid) (Sigma). Nonspecific hydrolysis was determined by measuring substrate hydrolysis in the presence of both tetraisopropyl pyrophosphoramide (Sigma) and the AChE-specific inhibitor 1,5-bis(4-allydimethylammonium phenyl)pentan-3-one dibromide (Sigma).

Velocity sedimentation analysis of AChE molecular forms was performed as previously described (17, 23). For these experiments, 100-µl aliquots were layered onto 5-20% sucrose gradients. Samples were centrifuged in a Beckman SW41 rotor at 40,000 rpm for 16 h at 4°C. Approximately 45 fractions were collected from the bottom of the tubes and assayed for AChE activity. Analysis of AChE molecular forms and processing of the raw data were performed as described in detail elsewhere (17, 23).

RNA extraction and RT-PCR. Total RNA was isolated from cultured myotubes using 1 ml of Trizol (GIBCO) per 35 mm plate, whereas 1 ml of Trizol per 100 mg of rat muscle tissue was used to extract total RNA from muscle. Myotubes were scraped from the plates and disrupted by pipetting repeatedly up and down for 30 s. Muscles were homogenized with a Polytron set at maximum speed twice for 15 s. After addition of chloroform, the solution was mixed vigorously and spun at 12,000 g for 15 min at 4°C. The aqueous layer was then transferred to a fresh tube, and an appropriate amount of isopropanol was added. For RNA precipitation, the samples were spun and the resulting pellets were washed with 70% ethanol. Pellets were then briefly air-dried, and they were resuspended in RNase-free water. All samples were stored at -80°C until use.

For RT-PCR analysis, all RNA samples were adjusted to a final concentration of 80 ng/ml. Two microliters of each RNA sample were reverse transcribed at 42°C for 45 min followed by 5 min at 99°C, as previously described in detail elsewhere (3, 24, 32). Negative controls consisted of the same RT mixture in which sample RNA was replaced by 2 µl of RNase-free water.

cDNAs encoding AChE and S12 ribosomal RNA (rRNA) were amplified using PCR as described in detail elsewhere (3, 24, 32). Primers for AChE (5': CTGGGGTGCGGATCGGTGTACCCC; 3': TCACAGGTCTGAGCAGCGTTCCTG) and rRNA (5'-GGAAGGCATAGCTGCTGG, 3'CCTCGATGACATC- CTTGG; internal control for RT-PCR experiments) were synthesized on the basis of available sequences (15, 27). Cycle parameters for AChE included denaturation for 1 min at 94°C followed by primer annealing and extension at 70°C for 3 min. Primer annealing and extension for rRNA were 54°C for 1 min and 72°C for 2 min, respectively. In each experiment, the last cycle was followed by a 10-min elongation step at 72°C. The PCR products were visualized on 1% ethidium bromide-stained agarose gels. Quantitation of the PCR products was performed by separating PCR products in agarose gels containing the fluorescent dye VistraGreen (Amersham; Arlington Heights, IL), and the labeling intensity of the PCR product, which is linearly related to the amount of DNA, was quantitated using a Storm PhosphorImager and analyzed with the ImageQuant software program (Molecular Dynamics, Sunnyvale, CA). All values obtained for AChE were corrected according to their corresponding level of rRNA present in the sample.

All RT-PCR experiments aimed at determining the relative abundance of AChE mRNA in fast and slow muscles as well as in cultured myotubes derived from fast and slow myogenic cells were performed using cycle numbers that lay within the linear phase of amplification (8, 24, 32). The cycle numbers were 37 for AChE and 28 for rRNA. RT-PCR conditions (primer concentrations, input RNA, choice of RT primer, cycling conditions) were initially optimized, and they were identical for all samples. Appropriate precautions (use of sterile filtered tips and gloves) were taken to avoid contamination and RNA degradation. Samples, including the negative controls (RNase-free water), were always prepared using the same master mixes of RT and PCR reagents and they were run in parallel. In all experiments, PCR products were never detected in these negative controls.

Nuclear run-on assays. Nuclear run-on assays were performed as described elsewhere (2, 8). Nuclei were obtained by homogenizing ~1 g of frozen EDL or Sol muscle (8 or 9 muscles) in 10 vol of lysis buffer made of 0.3 M sucrose, 60 mM KCl, 15 mM NaCl, 15 mM HEPES, pH 7.5, 2 mM EDTA, 0.5 mM EGTA, 0.15 mM spermine, 0.5 mM spermidine, 10 mM dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride. Typically, we obtained approximately 4 × 106 nuclei per gram of muscle tissue. After centrifugation, pellets were resuspended in 1 ml of lysis buffer containing 0.05% Nonidet P-40 for further homogenization. Nuclei were then sedimented at 500 g and resuspended in transcription buffer containing 0.6 M (NH4)2SO4; 0.4 M Tris, pH 7.9; 0.2 M MgCl2; 0.2 M MnCl2; 1 M NaCl; 100 mM EDTA, pH 8; 0.02 M phenylmethylsulfonyl fluoride; 1 mM dithiothreitol; 10 mM creatine phosphate; 1 mM each of GTP, ATP, and CTP; 5% glycerol; 50 U of RNase inhibitor (Promega, Madison, WI); and 200 µCi of [alpha -32P]UTP to a final volume of 200 µl. RNA was transcribed at 28°C for 30 min. After RQ1 DNase (Promega) treatment, labeled RNA was isolated using Trizol and hybridized for 48 h with 10 µg of genomic DNA, linearized AChE (2 kb), and beta -actin (2 kb) cDNAs as well as the empty plasmids pEF-BOS (AChE) and Bluescript (SK) (actin) immobilized on Genescreen Plus nylon membrane (DuPont). After hybridization, membranes were washed thoroughly [1 × SSC (1× SSC is 0.15 M NaCl and 0.015 M sodium citrate, pH 7.0), 0.1% SDS] at 42°C and exposed for autoradiography at -80°C for 2-5 days with intensifying screens. The intensity of the signals was quantified using a Storm PhosphorImager (Molecular Dynamics). The signals corresponding to AChE were standardized relative to the beta -actin signal. Hybridization signals were below detectable levels for SK and pEF-BOS empty plasmids.

Statistical analysis. Student's t-tests were performed to determine whether the differences between group means were significant. The level of significance was set at P < 0.05. The data are expressed as means ± SE throughout.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

AChE expression in mature slow- and fast-contracting hindlimb muscles. Determination of AChE activity in mature slow Sol and fast EDL muscles, which are muscles of similar size, revealed that EDL muscles contained significantly higher enzyme activity than previously reported (Fig. 1; P < 0.05; see Refs. 1, 17, 19). In agreement with previous studies (see, for example, Ref. 23), significant differences between the proportions of the various AChE molecular forms were also observed in Sol and EDL muscles (Fig. 2). Notably, asymmetric forms accounted for a greater proportion of total AChE activity in Sol muscles (~50% compared with 20% in EDL), whereas globular forms, particularly G4, were relatively more abundant in EDL muscles (G4 content ~40% compared with 20% in Sol; see also Table 1).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 1.   Comparison of total acetylcholinesterase (AChE) activity in control soleus (Sol) and extensor digitorum longus (EDL) muscles from adult rats. * Significant difference at P < 0.05. n = 4 per group.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2.   Profiles of AChE molecular forms observed in adult Sol (A) and EDL (B) rat muscles. Shown are representative examples. Note different y-axis scales.

We next examined whether fast EDL and slow Sol muscles exhibited differences in the pattern of expression of the AChE gene. We initially determined the relative amount of AChE transcripts in Sol and EDL muscles by RT-PCR. As shown in Fig. 3, AChE mRNA levels, normalized to rRNA, were found to be approximately fivefold greater (P < 0.05) in EDL muscles compared with Sol muscles. Given these findings, we assessed whether these differences in AChE mRNA content between fast- and slow-contracting muscles could be attributed to enhanced transcriptional activity of the AChE gene in fast muscles. To address this issue, we performed nuclear run-on assays using nuclei isolated from Sol and EDL muscles. Representative hybridization signals of newly synthesized AChE mRNA, reflecting transcriptional activity of the AChE gene, are shown in Fig. 4A. Quantitative analysis revealed that nuclei isolated from both Sol and EDL muscles transcribed the AChE gene at approximately the same rate (Fig. 4B; P > 0.05).


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3.   Determination of AChE transcript levels in slow Sol and fast EDL muscles. A: representative example of an ethidium bromide-stained agarose gel displaying RT-PCR products for AChE and S12 rRNA obtained from amplification of reverse transcribed RNA extracted from Sol and EDL muscles. B: quantitative analysis of AChE mRNA levels in Sol and EDL muscles standardized using corresponding rRNA signals. * Significant difference at P < 0.05. n = 6 per group.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4.   Transcription of AChE gene in slow and fast hindlimb muscles. A: representative run-on assays performed with nuclei isolated from Sol and EDL muscles. B: quantitative analysis of AChE gene transcription in Sol and EDL muscles standardized using beta -actin. Data were obtained from 3 separate experiments using 8 or 9 Sol and EDL muscles per experiment.

AChE expression in myotubes obtained from clonal satellite cells isolated from slow and fast muscle fibers. Given that fast-contracting muscles display significantly higher levels of AChE activity and transcripts as well as distinct molecular form profiles compared with their slow-twitch counterparts, we determined whether myogenic precursor cells originating from fast and slow muscle fibers are intrinsically programmed to express distinct AChE profiles. To achieve this objective, Sol and TAS muscles were excised from adult Immorto transgenic mice (see MATERIALS AND METHODS) and single myogenic cells were isolated from slow Sol and fast TAS muscle fibers. We took advantage of the fact that single clonal myogenic cells can be isolated directly from slow and fast muscle fibers and subsequently grown to give rise to a pure population of myoblasts capable of undergoing normal myogenic differentiation in culture (33). This approach therefore enabled us to analyze the pattern of AChE expression in two separate populations of myotubes.

We first measured total AChE activity in myotube cultures obtained from single myogenic cell clones derived from slow Sol and fast TAS muscle fibers. Figure 5 shows that cell-associated (Fig. 5A) and secreted (Fig. 5B) AChE activity were nearly identical for both myotube populations (P > 0.05). AChE specific activity (per mg of protein) for both cell-associated and secreted enzyme was also found to be similar for both sets of cultures (data not shown). Analysis of AChE molecular form profiles using myotube extracts revealed that asymmetric forms, particularly A12, were readily detected in these myotubes along with G4, G2, and a high level of G1 (Fig. 6). Furthermore, the relative proportions of cell-associated molecular forms in myotubes derived from myogenic cells isolated from Sol (Fig. 6A) and TAS (Fig. 6B) muscle fibers showed the same distribution (Table 1). In the fusion media, G4 and G1 were the only detectable forms of the enzyme with comparable levels for both myotube populations (Fig. 6; Table 1). Consistent with these AChE activity data, we did not observe differences in the abundance of AChE transcripts between these two myotube populations (Fig. 7; P > 0.05).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 5.   Total AChE activity from cultured myotubes derived from fusion of myoblasts obtained from proliferation of single myogenic cell clones isolated from slow Sol and fast tibialis anterior (TAS) muscle fibers from Immorto mice. A and B: cell-associated and secreted AChE activity per culture, respectively. n = 6 per group.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6.   AChE molecular form profiles observed in cultured myotubes and media. Shown are representative examples of average content in AChE molecular forms for cell-associated and secreted enzyme obtained from myotubes derived from single myogenic cells isolated from slow Sol (A) and fast TAS (B) muscle fibers.


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Distribution of AChE molecular forms in adult Sol and EDL muscles as well as in myotubes derived from proliferation and fusion of single clonal Sol and TAS myogenic cells



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 7.   AChE mRNA levels determined from cultured myotubes obtained from single myogenic cells derived from slow Sol and fast TAS muscle fibers. A: ethidium bromide-stained agarose gel displaying RT-PCR products for AChE and S12 rRNA. B: quantitative analysis of AChE mRNA levels standardized using rRNA signals. n = 6 per group.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Several lines of evidence have clearly demonstrated that motoneuron-derived signals, such as electrical activity and trophic molecules, play pivotal roles in regulating AChE expression in skeletal muscle (reviewed in Ref. 30). In addition, mechanical loading has recently been shown to also influence AChE expression in skeletal muscle cells (21). However, the contribution of these extrinsic factors versus intrinsic factors in controlling AChE synthesis in skeletal muscle remains controversial and needs to be clearly established if the ultimate goal is to understand all of the events contributing to the regulation of AChE in slow and fast muscles. In the present study, we provide evidence that myotubes derived from a pure population of myogenic precursor cells isolated from slow and fast muscle fibers exhibit intrinsically similar patterns of AChE expression. These findings indicate that differences in AChE expression between fast and slow muscles are not due to inherent differences in myogenic precursor cells, thereby suggesting that other factors, such as innervation, play a predominant role in establishing the distinct patterns of AChE expression in these muscle types.

Mechanisms regulating AChE expression in slow- and fast-contracting muscles in vivo. Compared with slow skeletal muscles, fast muscles of rats display significantly greater AChE activity, which is paralleled by a higher level of AChE mRNA (10, 32, 41). In the present study, we show that AChE mRNAs are fivefold more abundant in fast versus slow muscles, thereby confirming recent findings (41). However, we demonstrate also that AChE activity in fast muscle is only twofold higher. The more modest differences in AChE activity between slow and fast muscles compared with the larger variations in their AChE mRNA content, suggest therefore that the production of AChE molecules in muscle may also be regulated at the translational or posttranslational level. Indeed, evidence for translational control of AChE biosynthesis was reported recently in rats treated with glucocorticoids (4). Whereas AChE mRNA levels assessed by Northern blot remained unchanged in fast muscles of glucocorticoid-treated versus nontreated animals, substantial reductions in the levels of G1 and G2 molecular forms were reported, indicating that AChE protein synthesis was specifically hindered under these experimental conditions (4). Similarly, we have also shown that posttranslational events and, in particular, the association of AChE catalytic subunits with the collagenic structural subunit, may in fact enhance AChE activity in cultured muscle cells through the stabilization of newly synthesized catalytic peptides (29). A similar stabilization mechanism may also account for the more modest differences seen in AChE activity between slow and fast muscles, because it was recently shown that the collagenic structural subunit is more abundant in slow muscles (26).

One issue that had yet to be resolved is whether greater levels of AChE expression in fast muscles are due to enhanced transcription of the AChE gene in this muscle type. In the present investigation, we measured by run-on assays the levels of newly synthesized AChE mRNAs in nuclei isolated from slow Sol and fast EDL muscles. Our analysis showed that the rate of AChE gene transcription in both muscle types was similar, thereby indicating that posttranscriptional mechanisms are important in controlling the levels of AChE transcripts in slow versus fast muscles.

Previous in vitro experiments using cultured neural (9), hematopoietic (8), and myogenic cells (16) have provided evidence that enhanced AChE mRNA stability accounts for the increase in AChE expression that occurs during differentiation of these cells. Our current data support and extend these findings by indicating that a similar regulatory mechanism is likely playing a role in vivo by controlling the levels of AChE mRNA in slow and fast muscles. Interestingly, posttranscriptional mechanisms have also been postulated to regulate the differential expression of the cytochrome c gene in slow and fast muscles (44). Although the mechanisms that dictate the half-life of AChE transcripts in muscle have yet to be elucidated, it is reasonable to envisage that interactions between trans-acting factors and regions along the mRNA and, in particular, in the 3'-untranslated region, are involved (for review, see Ref. 37). Therefore, the abundance of trans-acting factors involved in RNA-protein interactions may differ in slow and fast muscles, thereby controlling the longevity of AChE transcripts in these muscle types.

Myotubes derived from myogenic clonal cells isolated from slow or fast muscle fibers display similar patterns of AChE expression. Findings from previous studies suggest that slow and fast muscle fibers are intrinsically programmed to display distinct patterns of AChE expression. For example, Dolenc and colleagues (11) showed that slow and fast muscles of adult rats undergoing regeneration due to an ischemic-toxic injury, in the presence or absence of the nerve, display distinct molecular form profiles comparable to those seen in intact slow and fast muscles, respectively (11). These findings imply that myogenic precursor cells from slow and fast muscles, which are activated during the regeneration process, are therefore preprogrammed to express distinct AChE molecular form profiles. In our experiments, we were able to obtain clonal populations of myogenic precursor cells from single muscle fibers of the slow Sol and fast TAS muscles, which comprise 60% type I/40% type IIA fibers and 80% type IIB/20% type IIX fibers, respectively (45). This enabled, therefore, the analysis of myotubes generated from a single myogenic cell isolated from either slow or fast muscle fibers. With this approach, which has been used previously to obtain several conditionally immortal cell lines from a variety of tissues (7, 20, 25, 43), including skeletal muscle (33), we demonstrate that myotubes generated from clonal populations of myoblasts obtained from the proliferation of single myogenic cells isolated from slow or fast muscle fibers, display nearly identical patterns of AChE expression. Specifically, these two myotube populations displayed similar total AChE activity, molecular form profiles, and transcript levels.

The reasons for these divergent results may be explained if we consider that during regeneration, fusion of satellite cells with preexisting muscle fibers that survive ischemic-toxic injury may express AChE molecular form profiles of the host fiber under the influence of mechanisms that override the intrinsic program of these satellite cells (22). In addition, satellite cells associated with muscle fibers within the core of the muscle may be damaged during severe ischemic conditions, thereby affecting their normal program of AChE expression (35, 38). Because interaction with other cell types or molecules influences the phenotype of myogenic cells (6, 12), it is also possible that in situ regeneration of muscle fibers within a previously deposited basal lamina may induce these cells to express an AChE profile reminiscent of that expressed in previously existing fibers. In this context, basal lamina-associated molecules, such as agrin and ARIA, which are known to regulate the expression of genes encoding synaptic proteins in muscle (for review, see Ref. 5), may continue to exert their effects within regenerating muscles. Given the above caveats, similar intrinsic regulation of AChE expression in myogenic precursor cells from slow and fast muscle fibers, as observed in the present investigation, may have been masked in previous studies using the regeneration model (11, 40).

Contribution of extrinsic versus intrinsic factors in regulating AChE molecular form profiles in slow- and fast-contracting muscles. In a recent study, we showed that inactivated, although still innervated, slow and fast hindlimb muscles expressed a common molecular form profile resembling that expressed in slow muscles (1). Our present findings provide evidence that myogenic precursor cells from slow or fast muscle fibers give rise to myotubes that also express comparable AChE molecular form profiles. In addition, the molecular form distributions of these myotubes displayed characteristics intermediate to those seen in slow and fast muscles in vivo. Together, these findings indicate that extrinsic factors and, in particular, nerve-derived signals, play a predominant role in establishing distinct AChE molecular form profiles in slow versus fast muscles in vivo. In this context, it is noteworthy that in the study of Dolenc et al. (11), regenerating fast muscles eventually altered their AChE profiles to a slow type after prolonged reinnervation by the soleus nerve, further highlighting the important contribution of innervation (11).

Previous studies have shown that Sol and EDL muscles from postnatal rats already display prominent differences in their molecular form profiles (40), despite receiving at this developmental stage similar high-frequency impulse patterns delivered by their respective innervating motoneurons (34). On the basis of these findings, it has been suggested that early postnatal slow and fast muscles are preprogrammed to express distinct AChE molecular form profiles independently of neural activation. However, an alternative explanation for these observations relates to the findings that slow muscles are known to be largely insensitive to phasic, high-frequency activity, whereas fast muscles readily adapt to this activity pattern, as previously reported (1, 23). Thus the distinct AChE profiles seen in neonatal fast and slow muscles likely reflect 1) the adaptation of a basic AChE profile to high-frequency activity in fast muscle and 2) the refractiveness of slow muscles to this type of neuromuscular activation.

The availability of structural subunits such as the collagenic and hydrophobic tails, is believed to dictate the relative proportions of asymmetric forms and hydrophobic-tailed tetramers synthesized in cells (26, 27, 29). Because in the current study we found that fast and slow myotube populations expressed similar levels of AChE activity as well as comparable proportions of asymmetric and G4 forms, it is reasonable to postulate that AChE-associated structural subunits are also expressed at similar levels within these myotubes. Transformation of AChE molecular form profiles from those expressed in myotubes into those observed in adult slow or fast muscles may therefore also be dependent on parallel modifications in the synthesis of the structural subunits. Accordingly, levels of the collagenic as well as the hydrophobic structural subunits may be highly sensitive to innervation and specific patterns of electrical activity (i.e., tonic vs. phasic), which, in turn, could dictate the molecular form distributions observed in slow- and fast-contracting muscles (42). Future studies aimed at determining the impact of neural signals on the expression of these structural subunits should prove useful for our understanding of additional biosynthetic events underlying the plasticity of AChE expression in muscle.

Perspectives

The phenotype of skeletal muscles is strongly influenced by nerve-derived signals, although intrinsic properties of the muscles may also determine its characteristics. In the present investigation, we demonstrate that intrinsic factors do not account for the distinct patterns of AChE expression displayed by fast- and slow-contracting skeletal muscles. Rather, extrinsic factors such as motoneuron-derived signals, i.e., electrical activity and trophic factors, as well as mechanical loading appear as key determinants governing expression of this enzyme via posttranscriptional regulatory mechanisms. In this context, our findings indicate that these extrinsic factors likely initiate signaling cascades that culminate 1) in the modulation of AChE mRNA stability and 2) in the assembly of AChE catalytic subunits with available structural subunits.


    ACKNOWLEDGEMENTS

We thank Dr. Victor Gisiger for providing us with some reagents and for fruitful discussions.


    FOOTNOTES

This work was supported by an operating grant from the Medical Research Council of Canada (MRC) to B. J. Jasmin. B. J. Jasmin was a Scholar of the MRC during the course of this work and is now an MRC Scientist.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: B. J. Jasmin, Dept. of Cellular and Molecular Medicine, Faculty of Medicine, Univ. of Ottawa, 451 Smyth Rd., Ottawa, Ontario, Canada K1H 8M5 (E-mail: jasmin{at}uottawa.ca).

Received 11 March 1999; accepted in final form 1 July 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Boudreau-Larivière, C., V. Gisiger, R. N. Michel, D. A. Hubatsch, and B. J. Jasmin. Fast and slow skeletal muscles express a common basic profile of acetylcholinesterase molecular forms. Am. J. Physiol. 272 (Cell Physiol. 41): C68-C76, 1997[Abstract/Free Full Text].

2.   Boudreau-Larivière, C., and B. J. Jasmin. Calcitonin gene-related peptide decreases expression of acetylcholinesterase in mammalian myotubes. FEBS Lett. 444: 22-26, 1999[Web of Science][Medline].

3.   Boudreau-Larivière, C., H. Sveistrup, D. J. Parry, and B. J. Jasmin. Ciliary neurotrophic factor: regulation of acetylcholinesterase in skeletal muscle and distribution of messenger RNA encoding its receptor in synaptic versus extrasynaptic compartments. Neuroscience 73: 613-622, 1996[Web of Science][Medline].

4.   Brank, M., K. Zajc-Kreft, S. Kreft, R. Komel, and Z. Grubic. Biogenesis of acetylcholinesterase is impaired, although its mRNA level remains normal, in the glucocorticoid-treated rat skeletal muscle. Eur. J. Biochem. 251: 374-381, 1998[Web of Science][Medline].

5.   Burden, S. J. The formation of neuromuscular synapses. Genes Dev. 12: 133-148, 1998[Free Full Text].

6.   Butler, J., E. Cosmos, and P. Cauwenbergs. Positional signals: evidence for a possible role in muscle fibre-type patterning of the embryonic avian limb. Development 102: 763-772, 1988[Abstract/Free Full Text].

7.   Chambers, T. J., J. M. Owens, G. Hattersley, P. S. Jat, and M. D. Noble. Generation of osteoclast-inductive and osteoclastogenic cell lines from the H-2KbtsA58 transgenic mouse. Proc. Natl. Acad. Sci. USA 90: 5578-5582, 1993[Abstract/Free Full Text].

8.   Chan, R. Y. Y., F. Adatia, A. M. Krupa, and B. J. Jasmin. Increased expression of acetylcholinesterase T and R transcripts during hematopoietic differentiation is accompanied by parallel elevations in the levels of their respective molecular forms. J. Biol. Chem. 273: 9727-9733, 1998[Abstract/Free Full Text].

9.   Coleman, B. A., and P. Taylor. Regulation of acetylcholinesterase expression during neuronal differentiation. J. Biol. Chem. 271: 4410-4416, 1996[Abstract/Free Full Text].

10.   Cresnar, B., N. Crne-Finderle, K. Breskvar, and J. Sketelj. Neural regulation of muscle acetylcholinesterase is exerted on the level of its mRNA. J. Neurosci. Res. 38: 294-299, 1994[Web of Science][Medline].

11.   Dolenc, I., N. Crne-Finderle, I. Erzen, and J. Sketelj. Satellite cells in slow and fast rat muscles differ in respect to acetylcholinesterase regulation mechanisms they convey to their descendant myofibers during regeneration. J. Neurosci. Res. 37: 236-246, 1994[Web of Science][Medline].

12.   Donoghue, M. J., R. Morris-Valero, Y. R. Johnson, J. P. Merlie, and J. R. Sanes. Mammalian muscle cells bear a cell-autonomous, heritable memory of their rostrocaudal position. Cell 69: 67-77, 1992[Web of Science][Medline].

13.   Ellman, G. L., K. D. Courtney, V. Andres, and R. M. Featherstone. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7: 88-95, 1961[Web of Science][Medline].

14.   Fernandez, H. L., R. D. Moreno, and N. C. Inestrosa. Tetrameric (G4) acetylcholinesterase: structure, localization, and physiological regulation. J. Neurochem. 66: 1335-1346, 1996[Web of Science][Medline].

15.   Forster, E., U. Otten, and M. Frotscher. Developmental neurotrophin expression in slice cultures of rat hippocampus. Neurosci. Lett. 155: 216-219, 1993[Web of Science][Medline].

16.   Fuentes, M. E., and P. Taylor. Control of acetylcholinesterase gene expression during myogenesis. Neuron 10: 679-687, 1993[Web of Science][Medline].

17.   Gisiger, V., and H. R. Stephens. Asymmetric and globular forms of AChE in slow and fast muscles of 129/ReJ normal and dystrophic mice. J. Neurochem. 41: 919-929, 1983[Web of Science][Medline].

18.   Gisiger, V., and H. R. Stephens. Localization of the pool of G4 acetylcholinesterase characterizing fast muscles and its alteration in murine muscular dystrophy. J. Neurosci. Res. 19: 62-78, 1988[Web of Science][Medline].

19.   Groswald, D. E., and W.-D. Dettbarn. Characterization of acetylcholinesterase molecular forms in slow and fast muscle of rat. Neurochem. Res. 8: 983-995, 1983[Web of Science][Medline].

20.   Groves, A. K., S. C. Barnett, R. J. M. Franklin, A. J. Crang, M. Mayer, W. F. Blakemore, and M. D. Noble. Repair of demyelinated lesions by transplantation of purified 0-2A progenitor cells. Nature 362: 453-455, 1993[Medline].

21.   Hubatsch, D., and B. J. Jasmin. Mechanical stimulation increases expression of acetylcholinesterase in cultured myotubes. Am. J. Physiol. 273 (Cell Physiol. 42): C2002-C2009, 1997[Abstract/Free Full Text].

22.   Hughes, S. M., and H. M. Blau. Muscle fiber pattern is independent of cell lineage in postnatal rodent development. Cell 68: 659-671, 1992[Web of Science][Medline].

23.   Jasmin, B. J., and V. Gisiger. Regulation by exercise of the pool of G4 acetylcholinesterase characterizing fast muscles: opposite effect of running training in antagonist muscles. J. Neurosci. 10: 1444-1454, 1990[Abstract].

24.   Jasmin, B. J., R. K. Lee, and R. L. Rotundo. Compartmentalization of acetylcholinesterase mRNA and enzyme at the vertebrate neuromuscular junction. Neuron 11: 467-477, 1993[Web of Science][Medline].

25.   Jat, P. S., M. D. Noble, P. Ataliotis, Y. Tanaka, N. Yannoutsos, L. Larsen, and D. Kioussis. Direct derivation of conditionally immortal cell lines from an H-2Kb-tsA58 transgenic mouse. Proc. Natl. Acad. Sci. USA 88: 5096-5100, 1991[Abstract/Free Full Text].

26.   Krejci, E., S. Thomine, N. Boschetti, C. Legay, J. Sketelj, and J. Massoulié. The mammalian gene of acetylcholinesterase-associated collagen. J. Biol. Chem. 272: 22840-22847, 1997[Abstract/Free Full Text].

27.   Legay, C., S. Bon, P. Vernier, F. Coussen, and J. Massoulié. Cloning and expression of a rat acetylcholinesterase subunit: generation of multiple molecular forms and complementarity with a Torpedo collagenic subunit. J. Neurochem. 60: 337-346, 1993[Web of Science][Medline].

28.   Legay, C., E. Krejci, P. Ascher, and J. Massoulié. Acetylcholinesterase at the neuromuscular junction: mechanisms of accumulation. Soc. Neurosci. Abstr. 24: 790, 1998.

29.  Legay, C., F. A. Mankal, J. Massoulié, and B. J. Jasmin. Stability and secretion of acetylcholinesterase splice variants in skeletal muscle cells. J. Neurosci. In press.

30.   Massoulié, J., L. Pezzementi, S. Bon, E. Krejci, and F.-M. Vallette. Molecular and cellular biology of cholinesterases. Prog. Neurobiol. 41: 31-91, 1993[Web of Science][Medline].

31.   McMahan, U. J., J. R. Sanes, and L. M. Marshall. Cholinesterase is associated with the basal lamina at the neuromuscular junction. Nature 271: 72-74, 1978.

32.   Michel, R. N., C. Q. Vu, W. Tetzlaff, and B. J. Jasmin. Neural regulation of acetylcholinesterase mRNAs at mammalian neuromuscular synapses. J. Cell Biol. 127: 1061-1069, 1994[Abstract/Free Full Text].

33.   Morgan, J. E., J. R. Beauchamp, C. N. Pagel, M. Peckham, P. Ataliotis, P. S. Jat, M. D. Noble, K. Farmer, and T. A. Partridge. Myogenic cell lines derived from transgenic mice carrying a thermolabile T antigen: a model system for the derivation of tissue-specific and mutation-specific cell lines. Dev. Biol. 162: 486-498, 1994[Web of Science][Medline].

34.   Navarrete, R., and G. Vrbova. Changes of activity patterns in slow and fast muscles during postnatal development. Dev. Brain Res. 8: 11-19, 1983.

35.   Phillips, G. D., D. Lu, V. I. Mitashov, and B. M. Carlson. Survival of myogenic cells in freely grafted rat rectus femoris and extensor digitorum longus muscles. Am. J. Anat. 180: 365-372, 1987[Web of Science][Medline].

36.   Rosenblatt, J. D., A. I. Lunt, D. J. Parry, and T. A. Partridge. Culturing satellite cells from living single muscle fiber explants. In Vitro Cell. Dev. Biol. 31: 773-779, 1995.

37.   Ross, J. mRNA stability in mammalian cells. Microbiol. Rev. 59: 423-450, 1995[Abstract/Free Full Text].

38.   Schultz, E., D. J. Albright, D. L. Jaryszak, and T. L. David. Survival of satellite cells in whole muscle transplants. J. Anat. Rec. 222: 12-17, 1988.

39.   Schultz, E., and K. M. McCormick. Skeletal muscle satellite cells. Rev. Physiol. Biochem. Pharmacol. 123: 213-257, 1994[Web of Science][Medline].

40.   Sketelj, J., N. Crne-Finderle, S. Ribaric, and M. Brzin. Interactions between intrinsic regulation and neural modulation of acetylcholinesterase in fast and slow skeletal muscles. Cell. Mol. Neurobiol. 11: 35-54, 1991[Web of Science][Medline].

41.   Sketelj, J., N. Crne-Finderle, B. Strukelj, J. V. Trontelj, and D. Pette. Acetylcholinesterase mRNA level and synaptic activity in rat muscles depend on nerve-induced pattern of muscle activation. J. Neurosci. 18: 1944-1952, 1998[Abstract/Free Full Text].

42.   Sveistrup, H., R. Y. Y. Chan, and B. J. Jasmin. Chronic enhancement of neuromuscular activity increases acetylcholinesterase gene expression in skeletal muscle. Am. J. Physiol. 269 (Cell Physiol. 38): C856-C862, 1995[Abstract/Free Full Text].

43.   Whitehead, R. H., P. E. VanEeden, M. D. Noble, P. Ataliotis, and P. S. Jat. Establishment of conditionally immortalized epithelial cell lines from both colon and small intestine of adult H-2KbtsA58 transgenic mice. Proc. Natl. Acad. Sci. USA 90: 587-591, 1993[Abstract/Free Full Text].

44.   Yan, Z., and F. W. Booth. Cytochrome c promoter activity in soleus and white vastus lateralis muscles in rats. J. Appl. Physiol. 85: 973-978, 1998[Abstract/Free Full Text].

45.   Zardini, D. M., and D. J. Parry. Identification, distribution, and myosin subunit composition of type IIX fibers in mouse muscles. Muscle Nerve 17: 1308-1316, 1994[Web of Science][Medline].


Am J Physiol Regul Integr Compar Physiol 278(1):R140-R148
0363-6119/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
J. Neurosci.Home page
P. Pregelj, M. Trinkaus, D. Zupan, J. J. Trontelj, and J. Sketelj
The Role of Muscle Activation Pattern and Calcineurin in Acetylcholinesterase Regulation in Rat Skeletal Muscles
J. Neurosci., January 31, 2007; 27(5): 1106 - 1113.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Y.-C. Huang, R. G. Dennis, and K. Baar
Cultured slow vs. fast skeletal muscle cells differ in physiology and responsiveness to stimulation
Am J Physiol Cell Physiol, July 1, 2006; 291(1): C11 - C17.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A.-M. Joseph, A. A. Rungi, B. H. Robinson, and D. A. Hood
Compensatory responses of protein import and transcription factor expression in mitochondrial DNA defects
Am J Physiol Cell Physiol, April 1, 2004; 286(4): C867 - C875.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. O. Gramolini, G. Belanger, J. M. Thompson, J. V. Chakkalakal, and B. J. Jasmin
Increased expression of utrophin in a slow vs. a fast muscle involves posttranscriptional events
Am J Physiol Cell Physiol, October 1, 2001; 281(4): C1300 - C1309.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boudreau-Larivière, C.
Right arrow Articles by Jasmin, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boudreau-Larivière, C.
Right arrow Articles by Jasmin, B. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online