INTRODUCTION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

THE P TYPE ATPase gene family comprises a number of related proteins predominately involved in the active transport of cations across biological membranes (25). Within this family, only two members require more than a single subunit for catalytic activity, namely the Na,K-ATPase and the closely related H,K-ATPase. These enzymes use the energy liberated from ATP hydrolysis to exchange extracellular K⁺ with either intracellular Na⁺ or H⁺, generating ion-selective concentration gradients. Both enzymes have an -subunit, which contains most of the functional domains, and a -subunit, which not only acts to correctly fold and deliver the -subunit to the plasma membrane, but may also be involved in K⁺ occlusion and modulation of enzyme affinities for ion substrates (3, 4). A proteolipid -subunit has also been found to copurify with the Na,K-ATPase and, although not essential for enzyme activity, may modify enzyme function (2, 3). In mammals, a number of - and -subunit isoforms exist. Four -isoforms (called ₁ to ₄) and three -isoforms (called ₁ to ₃) have been identified for Na,K-ATPase and two -isoforms (gastric and nongastric) and a single -isoform (gastric) have been isolated for H,K-ATPase (3, 4). Experimental modulation of Na/H,K-ATPase - and -isoform combinations have been shown to produce active enzymes with the ion specificity determined entirely by the -subunit (3, 8, 17).

In teleost fish, homologs of mammalian ₁- and ₁- and ₃-isoforms have been identified (1, 9, 11, 12) and although the presence of a number of other isoforms has been suggested (10, 13, 21, 28), no further sequence information is available (for reviews of Na,K-ATPase in teleosts, see Refs. 13 and 24)

Studies from various teleost fish species have recently suggested that fish genomes have undergone ancient polyploidization events followed by species-dependent loss of certain chromosomal segments, resulting in the production of duplicate copies of some, but not all, genes (27, 32). In this study, a duplicate copy of the Na,K-ATPase ₁-isoform (called ₂₃₃) has been identified by homology cloning in the European eel (Anguilla anguilla) (13, 24). Northern blot studies demonstrate that the mRNA expression of this duplicate exhibits a more limited tissue distribution than that of the ₁-isoform and also that, although ₂₃₃-expression can be induced in osmoregulatory tissues as a result of seawater (SW) acclimation, this response is dependent on the developmental stage of the fish. A functional role for the ₂₃₃ is further suggested by the localization of ₂₃₃-protein expression in both branchial "chloride" and intestinal epithelial cells.

	METHODS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Fish. Adult freshwater (FW) sexually immature "yellow" and sexually maturing migratory "silver" eels (Anguilla anguilla; 125-1,250 g body wt) were obtained from local suppliers in Inverness, Blairgowrie and Kelso, and transferred to laboratory aquariums at the Gatty Marine Laboratory, where they were maintained on a 12:12-h light-dark cycle. For initial experiments, yellow eels (see Figs. 1-4) were maintained in either FW (0-10 mOsm/kg), 33% SW (330 mOsm/kg), SW (960-1,020 mOsm/kg), or 200% SW (2,000 mOsm/kg), as indicated for 23 days as described in Cutler et al. (12). Yellow and silver eels used in subsequent experiments (see Fig. 5) were transferred to tanks containing either FW or SW for a period of 21 days. Fish were decapitated and pithed before removal of tissues.

Total RNA extraction. Total RNA samples for experiments shown in Figs. 1-4 were extracted by a modified LiCl procedure as described in Cutler et al. (12). Total RNA isolated in the experiments indicated in Fig. 5 was extracted essentially as described in Chomczynski and Sacchi (6), except with the modification that the isopropanol precipitation was replaced by a high-salt precipitation step (5). The final total RNA pellets were dissolved in Milli-Q (Millipore, Watford, UK) water and supplemented with 1 µl of RNase inhibitor RNaseOut (GIBCO Life Technologies, Paisley, UK).

Cloning and sequencing. The initial ₂₃₃-bp fragment of the ₂₃₃-cDNA was amplified by RT-PCR (10) using degenerate primers designed to amplify fragments of any vertebrate P type -subunits (primer pair 2, see Ref. 9). Subsequent 5' and 3' rapid amplification of cDNA ends (RACE) fragments were amplified using Taq DNA polymerase (Amersham Pharmacia Biotech, Little Chalfont, UK) from cDNA made with mRNA samples extracted from the gills of 21-day SW-acclimated yellow eels using Clontech's (Basingstoke, UK) Marathon cDNA Amplification kit. The 5' RACE fragment (790 bp) was amplified by PCR using a specific antisense primer (ACATTGGGCCGCACTTTGGCCTT) and the Marathon kit's AP1 primer. The 3' RACE fragments (3 bands of 350-450 bp) were synthesized using nested PCR reactions initially with the specific sense primer (CCCAGAGGATGCCAAGG) and the Marathon kit's AP1 primer followed by amplification with the nested specific sense primer (GTTTGAAATACTTTGGCATTGGCGATGGT) and the Marathon cDNA synthesis primer. A further faint band of a larger product (~1,500 bp) was present on gels of 3' RACE amplification reaction. No positive colonies were obtained in experiments attempting to clone this band.

Northern blotting and analysis. Total RNA was Northern blotted and hybridized to ³²P-labeled DNA probes as previously described (12). For quantitative studies, the concentrations of total RNA in each tissue extract were initially determined using the spectrophotometric absorbance at 260 nm, and then the relative amounts of total RNA loaded in each lane were finally assessed using the intensity levels of ethidium bromide-stained 18S and 28S ribosomal RNA present on electrophoresis gels, as determined using a gel documentation and analysis system (Syngene, Cambridge, UK). Variations in amounts of total RNA present on the gel used for the blot were noted and used to adjust the final radioactive signals obtained per microgram of total RNA from the hybridization. Quantitative analysis of radiolabeled ₂₃₃-DNA probes hybridizing to blots was determined by electronic autoradiography using an Instant Imager (Canberra Packard, Meriden, CT). Statistical analysis was performed using StatView 4.01 software (Abacus Concepts, Berkeley, CA), using ANOVA followed by Scheffé's F post analyses of significance.

Antibody production. A region of the original ₂₃₃-cDNA fragment's derived amino acid sequence, which shared the lowest level of homology with the ₁-isoform, was chosen for peptide manufacture (amino acids 222-236; sequence DAGKLQEVKYFGIGD). The 15-mer was manufactured as a multiple-antigen peptide (Severn Biotechnology, Kidderminster, UK) and used to raise ₂₃₃-specific polyclonal antibodies in sheep by the Scottish Antibody Production Unit (SAPU; Law Hospital, Carluke, UK).

Tissue sample preparation and Western blotting. The epithelial layers were stripped from the intestines of three 3-wk SW-acclimated yellow eels. The tissue was homogenized at 0-4°C in 15 vol (vol/wt) of a homogenizing buffer comprising 25 mM HEPES, 0.25 M sucrose, 5 mM MgCl₂, 1 mM CaCl₂, 0.5 mM dithiothreitol (DTT), and 0.18 mg/ml phenylmethyl sulphonyl fluoride, pH 7.4. Membrane fractions were isolated by discontinuous sucrose density gradient centrifugation essentially as described previously (23). After centrifugation, membrane fractions banding at 8-35% and 35-43% (wt/vol) sucrose interfaces were collected, washed, and finally resuspended in 25 mM HEPES, 0.25 M sucrose, and 0.5 mM DTT, pH 7.4, before freezing in aliquots at 90^oC. Samples of the isolated membrane fractions were incubated at 10°C overnight in the presence of N-glycosidase F (NGF; 50 enzyme units · mg membrane protein¹ · ml¹; Boehringer Mannheim, Lewes, UK). Western blotting was conducted using standard techniques (16). In brief, NGF-treated and untreated membrane samples (5 µg protein) were denatured by incubation at 80°C for 10 min in 62.5 mM Tris · HCl, 10% glycerol, 2% SDS, and 45 mM DTT, pH 6.8, and denatured proteins separated by SDS-PAGE using 8% gels (19). Colored molecular mass standards (30-250 kDa; Amersham Pharmacia Biotech) were run in parallel tracks to confirm full transfer of proteins after blotting and to estimate the molecular masses of immunoreactive bands. Proteins were electroblotted (at 35 V for 16 h using a Trans-Blot Cell; BioRad, Hemel Hempstead, UK) onto polyvinylidene difluoride membranes (BDH, Poole, UK), and the membranes were immediately processed for immunodetection. With all subsequent procedures conducted at room temperature, membranes were blocked for 1 h with PBS containing 2.5% BSA and 0.2% Tween 20 and then incubated for 1 h with a 1/1,000 dilution of ₂₃₃-antisera in PBS containing 1% BSA and 0.2% Tween 20 (PBT). Membranes were then washed three times for 15 min in PBT before incubation for 1 h with alkaline phosphatase-conjugated donkey anti-sheep/goat IgG (Sigma-Aldrich, Poole, UK; final dilution 1/10,000) in PBT. After washing three times for 15 min in PBT and twice for 15 min in PBS, membranes were incubated in Western Blue alkaline phosphate substrate solution (Promega) for 3-5 min until the development of immunoreactive bands. The membranes were then washed in distilled water for 5 min and then left to dry at room temperature.

Immunohistochemistry. Gill and intestinal tissues from 3-wk SW-acclimated yellow eels were removed, washed in ice-cold PBS, and fixed in 4% paraformaldehyde in PBS for 24 h at 4°C. Dehydrated tissues were embedded in paraffin, and 5-µm sections were mounted on poly-L-lysine-coated slides before removal of paraffin by four washes in xylene. With all subsequent procedures carried out at room temperature, sections were rehydrated in a graded series of alcohol solutions and finally transferred to a bath containing PBS. Endogenous peroxidase activity was blocked by immersing the slides in a 3% H₂O₂ solution for 30 min followed by three washes in PBS. After incubation in the presence of 10% normal donkey serum (NDS; SAPU) in PBS for 60 min, the sections were incubated for 1 h in a 1/200 dilution of ₂₃₃-antiserum in PBS containing 1% NDS. Control sections were also processed when slides were incubated with 1/200 dilution of preimmune serum or in the presence of 1/200 dilution of ₂₃₃-antiserum containing 40-50 µg/ml of the original peptide antigen. Slides were then washed three times for 5 min with PBS and further incubated for 1 h with a 1/200 dilution of the secondary antibody, biotinylated donkey anti-sheep/goat IgG (SAPU). After being washed with PBS three times, the sections were incubated with 1/800 dilution of streptavidin-peroxidase conjugate (SAPU) for 40 min, washed a further three times for 5 min in PBS, and finally developed for 10 min in peroxidase substrate solution (Sigma-Aldrich) containing peroxidase and 3,3'-diaminobenzidine tetrahydrochloride. Slides were washed and counterstained with Mayer's hematoxylin for 3 min before dehydration in graded alcohols and xylene and mounting in DPX mountant (BDH) before drying overnight at room temperature. Slides were viewed and photographed using a Lietz Dialux 20 microscope and camera system.

	RESULTS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Nucleotide and amino acid sequences of eel ₂₃₃. The eel ₂₃₃-cDNA sequence contained an open reading frame encoding 302 amino acids (Fig. 1). The coding region showed high levels of both nucleotide (74.8%) and amino acid (69.9%) homology to the eel ₁-sequence (12). In a similar fashion to the eel ₁-sequence, the ₂₃₃-cDNA shares highest levels of amino acid homology with vertebrate ₁-isoforms (54.8-60%) rather than other known -isoforms (30-35%). The coding region showed highest levels of nucleotide or amino acid homology (Fig. 2) to mammalian ₁-sequences (62.7-64.3% and 58.0-60.0%, respectively), with lower homologies to chicken ₁ (64.3 and 57.4%, respectively)-, amphibian ₁ (59.1-59.4% and 56.4-58.0%, respectively)-, and Torpedo ₁-sequences (57.8% and 54.8%, respectively) and to the human ₁-pseudogene nucleotide sequence (58.8%). The ₂₃₃-nucleotide sequence also exhibited significant homology to the eel ₁ in the 5' (57.6%) and comparable 3' (68.4%) untranslated regions. The derived eel ₂₃₃-amino acid sequence possesses three potential N-linked glycosylation sites compared with the four present within the eel ₁-amino acid sequence (12).

View larger version (55K): [in this window] [in a new window]   Fig. 1.   Nucleotide and derived amino acid sequence of the eel Na,K-ATPase 233-subunit isoform. Potential regulatory elements in the 5' untranslated region are indicated as follows: mineralo-/glucocorticoid response element (M/GRE) half sites, solid lines; antisense CCAAT, double lines; adhesion molecule on glia regulatory element (AMRE)/SP1 site, shaded region. Sequences indicated within the coding region are potential N-linked glycosylation sites (solid lines) and the potential transmembrane domain (dashed lines). A putative polyadenylation site is indicated in the 3' untranslated region. The sequences have been submitted to the EMBL sequence database (European Bioinformatics Institute, Hinxton, UK) under the accession number AJ239317.

View larger version (73K): [in this window] [in a new window]   Fig. 2.   An alignment of derived amino acid sequences of the eel Na,K-ATPase 233-isoform compared with other 1-isoform sequences. Dashes indicate identical residues and periods indicate spaces introduced to an give optimal alignment. Sequences were aligned using GeneJockey II software (Biosoft). Dashes and periods were added after alignment. The EMBL/Swiss Prot accession numbers for amino acid sequences are as follows: eel 1 (P51165)-, human 1 (P05026), chicken 1 (P08251), Bufo marinus 1 (P30715), and Torpedo californica (P25029).

Eel ₂₃₃-mRNA expression. Tissue Northern blot analysis of ₂₃₃-mRNA expression (Fig. 3) revealed two transcript sizes of 2.4 and 1.2 kb. High levels of expression of the 2.4-kb transcript were found in the intestine with intermediate levels in kidney, brain, and gill and low levels in eye, spleen, and esophagus. Expression of the 1.2-kb transcript was found predominately in the intestine, with low levels also present in kidney and gill tissue samples. Results from the cloning experiments suggest that the 3' RACE products that were cloned represent copies of the 1.2-kb transcript, whereas the longer 3' RACE product obtained, which failed to clone, was likely to represent the 2.4-kb transcript.

View larger version (83K): [in this window] [in a new window]   Fig. 3.   Northern blot of 233-mRNA expression in 5 µg total RNA samples from tissues of yellow eels acclimated to SW for 3 wk. The sizes of mRNA transcripts are indicated in kb.

View larger version (58K): [in this window] [in a new window]   Fig. 4.   Northern blot of 233-mRNA expression in 5 µg total RNA samples from the gills of yellow eels adapted to freshwater (FW), 33% seawater (SW), SW, and 200% SW. Samples were extracted from 3 fish in each category. The sizes of mRNA transcripts are indicated in kb.

View larger version (17K): [in this window] [in a new window]   Fig. 5.   Quantification of Na,K-ATPase 233-isoform mRNA abundance in total RNA samples (10 µg) from the gills, intestines, and kidneys of yellow and silver adult eels adapted to FW or SW. The abundance of both the 2.4 (A)- and 1.2-kb (B) transcript sizes were measured in samples from 6 fish in each category. Statistical significance was determined using ANOVA and Scheffé's F post ad hoc testing with StatView 4.01 (ABACUS concepts) software. Significance of FW-to-SW comparisons are indicated; * significant at the 5% level (P < 0.05), ** significant at 1% level (P < 0.01), and *** significant at the 0.1% level (P < 0.001). Error bars, SE.

Eel ₂₃₃-protein expression and localization. The ₂₃₃-specific antiserum was used for Western blotting in tissue homogenates and purified membrane fractions from gill and intestine. Western blots using the ₂₃₃-antiserum and membrane fractions from the intestine of either FW- or SW-acclimated eels resulted in the appearance of a strongly staining but diffuse band ranging between 40 and 52 kDa (Fig. 6). A similar sized diffuse band was found with membrane fractions isolated from the gill (results not shown). After overnight digestion of the intestinal membrane fractions with NGF, there was a partial rearrangement in the molecular size of the 40- to 52-kDa proteins into three major components with mean molecular masses of 47, 39, and 33.5 kDa (Fig. 6), indicating that the immunoreactive proteins are indeed glycosylated. Again, similar results were obtained with gill membrane fractions after NGF treatment (results not shown). The specific antiserum was also used for immunohistochemistry in both gill and intestinal tissue sections. Antibody incubations with branchial sections demonstrated labeling of large cells within the interlamellar regions of the filamental epithelium (Fig. 7A), which correlate exactly to the classically described location of the so-called "mitochondrial-rich ionocytes" or "chloride cells" (34). Incubation of branchial sections with antibody preblocked with peptide antigen (or preimmune serum; data not shown) revealed no equivalent staining (Fig. 7C). Similar experiments were also performed with sections from the intestine. Immunostaining was observed across the basolateral surfaces of columnar epithelial cells that cover most of the luminal surface of the intestine (Fig. 7B). However, very little immunoreactivity was observed in the underlying cell layers. Again, intestinal sections were incubated with antibody preblocked with peptide antigen, and this produced a substantial reduction in peroxidase staining compared with normal antibody incubations (Fig. 7D).

View larger version (44K): [in this window] [in a new window]   Fig. 6.   Western blot using membrane fractions produced from eel intestinal eptithelial scrapes. Lane A: 5 µg of protein from the 35-43% sucrose fraction; lane B: 5 µg of the 35-43% sucrose fraction protein following NGF treatment. The blot was incubated with polyclonal antisera raised against a multiple antigen peptide (MAP) derived from the 233-amino acid sequence. Sizes are indicated in kDa.

View larger version (149K): [in this window] [in a new window]   Fig. 7.   Immunohistochemical staining of eel branchial and intestinal sections. A: a longitudinal section through a gill filament (×400) incubated with 233-polyclonal antisera, showing the primary epithelium (pe) and secondary lamellae (sl) with stained chloride cells (cc) and counterstained nuclei (n). B: transverse section across the midintestine (×250) showing a portion of a luminal epithelial fold incubated with 233-polyclonal antisera. Staining is apparent in columnar epithelial (ce) cells that line the intestinal lumen (il). C: longitudinal section through a gill filament (×250) incubated with 233-polyclonal antisera preblocked with 50 µg/ml 233-MAP peptide antigen. D: transverse section across the midintestine (×250) incubated with 233-polyclonal antisera preblocked with 40 µg/ml 233-MAP peptide antigen.

	DISCUSSION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Unlike that found with the eel ₁-isoform, the ₂₃₃-isoform shares highest levels of nucleotide and amino acid homology with mammalian (62.7-64.3% and 58.0-60.0%, respectively) rather than amphibian ₁-isoforms (59.1-59.4% and 56.4-58.0%, respectively), although the significance of this is unclear (see Fig. 2). The high level of nucleotide (74.8%) and amino acid (69.9%) homology shared by the ₂₃₃- and the eel ₁-sequence suggests that these isoforms are gene duplicates.

The gene duplication of the ₁-isoform in eels may represent an isolated event. However, recent studies have suggested that two polyploidization events occurred early in the evolution of ray-finned fishes either before or after the divergence of the fish and mammalian lineages (27, 32). The ₂₃₃-sequence may therefore have formed as a result of a wider genomic duplication event. It is consequently also possible that the ₂₃₃-gene may be the homolog of a mammalian protein, with which it would be expected to share high levels of homology. A duplicate ₁-gene is present within the mammalian genome; however, this is thought to represent a nonfunctional genomic pseudogene (20, 30). The lower level of nucleotide homology that the ₂₃₃-sequence shares with the human ₁-pseudogene (58.8%), compared with the same region of the human ₁-gene (63.5%), suggests that it may not be a homolog of this gene (the eel ₁-sequence also shares lower levels of homology with the human ₁-pseudogene), although the lower levels of homology may also be explained by a faster rate of mutation in the pseudogene because it became nonfunctional. As the ₂₃₃-isoform is expressed both at the mRNA and protein levels, this also argues against the ₂₃₃-being a direct counterpart of the pseudogene found in humans.

Unlike other vertebrate ₁-isoform sequences, the eel ₁- and ₂₃₃-isoforms share significant amounts of homology in the 5' (57.6%) untranslated region. However, the ₂₃₃-isoform has several insertions relative to the ₁-sequence. The 5' untranslated region of the ₂₃₃-cDNA also has several sequences that are homologous to transcriptional promoter regulatory elements normally found upstream of the transcription initiation sites of other Na,K-ATPase genes (see Fig. 1). These sequences are not found in the comparable region of the eel ₁-cDNA (12). As these elements are located in the 5' untranslated region, it is unclear whether these promoter-like elements serve any purpose. The first putative element shares high levels of homology (11 of 12 nucleotides) with the AMRE/SP1 regulatory element sequence found in the promoter of the rat Na,K-ATPase ₂-gene (AGGAGGCGGGGT; see Ref. 18). However, the single nucleotide difference is located within the core region of the SP1 binding site sequence (GCGG, whereas the ₂₃₃-sequence has GGGG), and so it is unclear whether this sequence could function as an SP1 binding site. Other putative regulatory elements are an anti-sense CCAAT box sequence, similar to that found in the rat ₃-gene PRE1 element (26), and a possible M/GRE region, which has an imperfect (nonexact inverted repeat) half site (TGTCCT) identical to the M/GRE of the human ₁-gene (14). The other potential half site of the M/GRE (GGAGCA) is spaced 10 nucleotides away from the first half site but shares only four of six common nucleotides with the human ₁-sequence. The teleost fish glucocorticoid receptor (GR) has an extra nine amino acids inserted between the DNA-binding zinc finger domains (15), suggesting that fish GRs may bind half sites that are further apart than the consensus spacing of three nucleotides apart in other vertebrate species (31). If any of these putative regulatory elements in the 5' untranslated region of the eel ₂₃₃-gene are functional, as they are downstream of the transcription start site, their most likely role would be to inhibit transcription. However, an inhibitory M/GRE in this position could be difficult to reconcile because in teleost fish, cortisol is known to stimulate Na,K-ATPase activity (24). Another possible explanation for the presence of putative regulatory element sequences in the 5' untranslated region is that at one point earlier in the evolution of the gene, the transcription start site was further downstream, and, consequently, they were located within the promoter region at that time.

The tissue-specific distribution of ₂₃₃-mRNA (Fig. 3) shows a restricted pattern of expression compared with that of the eel ₁-isoform (12). In particular, the levels of ₂₃₃-expression in eye, esophagus, pancreas, spleen, and ovary are absent or very much reduced compared with the level of ₁-expression in these tissues. The other notable point is that there is no ₂₃₃-expression in liver, heart, or skeletal muscle tissues. Although there are very faint signals for ₁-mRNA expression in eel skeletal muscle, no other -subunits have so far been identified in these tissues (9, 10, 12).

The level of both eel gill ₁- and ₁-mRNA abundance has been shown to be modulated by adaptation to differing salinities, with increases in expression following acclimation of adult FW eels to SW or 200% SW environments (11, 12, 22). In contrast to this, the levels of branchial ₂₃₃-mRNA expression (Fig. 4) show a different pattern of expression. Visible increases in branchial ₂₃₃-expression were only found after acclimation of FW eels to the 200% SW environment, expression being essentially the same in FW, 33% SW, and SW environments.

Eels have two morphologically distinct developmental stages in the adult phase of their life cycle. They begin adult life as sexually immature yellow eels, which predominate in FW environments. After an indeterminate period of time, yellow eels metamorphose into the sexually maturer silver eels, which migrate back to the marine environment where they may return to the Sargasso sea to breed. Quantitative expression of ₂₃₃-mRNAs was further evaluated at these two developmental stages of the adult eel's life cycle (Fig. 5). The levels of ₂₃₃-mRNA expression in the gill, intestine, and kidney of yellow eels were not significantly elevated 3 wk after FW-to-SW transfer. However, in the developmentally maturer silver eel, significant increases in expression were found in all three tissues following a similar period of SW acclimation. In previous studies, the levels of ₁- and ₁-isoform mRNAs have been found to increase in both yellow and silver eels following SW acclimation (data not shown). The complexity of the situation is further increased by the existence of two transcript sizes of 1.2 and 2.4 kb. The separate analysis of changes in ₂₃₃-expression for each transcript reveals that significant increases in expression are found in all three tissues for the larger transcript (2.4 kb), but a significant increase in expression of the smaller transcript (1.2 kb) was only found in the branchial tissue of silver eels. This differential tissue-specific regulation of the expression of smaller ₂₃₃-mRNA transcripts suggests that the extra sequence information contained within the 3' untranslated region of larger mRNA species may have some functional significance.

The 3' untranslated region of the ₂₃₃-sequence (1.2-kb transcript) shares nucleotide homology with a comparable region of the eel ₁-isoform (68.4%), although no significant homology to mammalian ₁-sequences is evident. However, the smaller ₂₃₃-transcript does not possess the highly homologous regions found further downstream within the 3' region of all vertebrate ₁ cDNAs (33). It has been speculated that this region may be involved in modulating mRNA stability (29), but no further evidence to support this is available. Interestingly both mammalian ₂- and ₃-isoforms, but not the H,K-ATPase -isoform, have distinct highly conserved sequences within their 3' untranslated regions (data not shown). It will be interesting to discover whether the longer (2.4 kb) ₂₃₃-transcript contains a comparable homologous region.

Results from Western blotting experiments demonstrated that the ₂₃₃-protein is functionally expressed in both gill and intestine. The diffuse immunoreactive bands produced on these blots (40-52 kDa), which were of somewhat larger size than that predicted from the derived amino acid sequence (35 kDa), were sensitive to the enzyme NGF, suggesting that the protein is likely to be variably glycosylated, as is normally the case for Na,K-ATPase -subunits (7). It is possible that the range in the size of immunoreactive bands following NGF treatment may reflect the incomplete removal of all carbohydrate groups associated with the ₂₃₃-protein. Localization studies, using the ₂₃₃-specific antibody also demonstrated that this duplicate of the ₁-gene is also expressed at high levels within the large cells found in the interlamellar regions of the branchial epithelium, which are presumed to represent chloride cells. In addition to this, the expression of the ₂₃₃-isoform was also localized to the basolateral surfaces of columnar epithelial cells lining the lumen of the intestine. These observations suggest that the ₂₃₃-isoform is an integral component of the Na,K-ATPase enzyme that is expressed in the ionoregulatory cells of both the branchial and intestinal epithelia. It is therefore possible that this isoform of the -subunit may have an important functional role in the major osmoregulatory tissues of the eel when fish are acclimated to either the FW or SW environments.

In summary, a duplicate copy of the Na,K-ATPase ₁-isoform (called ₂₃₃) has been identified by homology cloning in the European eel (Anguilla anguilla). Expression of this isoform has been demonstrated in a number of osmoregulatory tissues and has been localized to chloride and columnar cells within the branchial and intestinal epithelia, respectively. Northern blot studies of ₂₃₃-mRNA expression show that, although expression of this duplicate in the osmoregulatory tissues of FW eels can be induced by SW acclimation, this response is dependent on the developmental stage of the fish.

Perspectives

Another important aspect of genome duplication is whether differences between gene duplicates are conserved between teleost fish species. After duplication, teleost genomes presumably contained two identical copies, which in the case of the eel ₁- and ₂₃₃-sequences, subsequently developed differences in sequence and possibly function and regulation. However, although these differences may have developed in a common ancestral teleost species, suggesting that recognizable ₁- and ₂₃₃-counterparts may be present in other teleost species, it is also possible that a different set of changes has occurred in other species; in which case, each pair of ₁-duplicates may have developed different functions and patterns of regulation, with "₁-like" sequences quite distinct from those of the eel ₁- and ₂₃₃-isoforms.