|
|
||||||||
1-isoform
in the European eel (Anguilla anguilla)
1 School of Biology, Bute Medical Buildings, University of Saint Andrews, Saint Andrews, Fife, Scotland KY16 9TS; and 2 Gatty Marine Laboratory, University of Saint Andrews, Saint Andrews, Fife, Scotland KY16 8LB, United Kingdom
| |
ABSTRACT |
|---|
|
|
|---|
Recent studies on
teleost fish have suggested that their genomes have undergone ancient
polyploidization events resulting in the duplication of the genome. A
duplicate copy of the Na,K-ATPase
1-isoform (called
233) has been identified in the European eel (Anguilla anguilla). The
233-isoform shares
high levels of nucleotide (74.8%) and amino acid (69.9%) homology
with the eel
1-subunit as well as other vertebrate
1-sequences. Compared with the widely expressed
1-isoform, expression of
233-mRNA is
mainly restricted to epithelial tissues. Seawater acclimation induced
increases in
233-mRNA levels in kidney, gill, and
intestine of migratory "silver" but not the nonmigratory
"yellow" adult eels, suggesting that the factors responsible for
this upregulation are themselves developmentally regulated. Expression
of a variably glycosylated 40- to 52-kDa
233-protein in
both gill "chloride" and intestinal epithelial cells suggests that
the
233-isoform of Na,K-ATPase may play an important
functional role in the major osmoregulatory tissues of euryhaline fish
such as the eel.
teleost fish; mRNA expression; salinity acclimation; developmental maturation; immunolocalization.
| |
INTRODUCTION |
|---|
|
|
|---|
THE P
TYPE ATPase gene family comprises a number of related proteins
predominately involved in the active transport of cations across
biological membranes (25). Within this family, only two members require more than a single subunit for catalytic activity, namely the Na,K-ATPase and the closely related H,K-ATPase. These enzymes use the energy liberated from ATP hydrolysis to exchange extracellular K+ with either intracellular Na+
or H+, generating ion-selective concentration gradients.
Both enzymes have an
-subunit, which contains most of the functional
domains, and a
-subunit, which not only acts to correctly fold and
deliver the
-subunit to the plasma membrane, but may also be
involved in K+ occlusion and modulation of enzyme
affinities for ion substrates (3, 4). A
proteolipid
-subunit has also been found to copurify with the
Na,K-ATPase and, although not essential for enzyme activity, may modify
enzyme function (2, 3). In mammals, a number of
- and
-subunit isoforms exist. Four
-isoforms (called
1 to
4) and three
-isoforms (called
1 to
3) have been identified for
Na,K-ATPase and two
-isoforms (gastric and nongastric) and a single
-isoform (gastric) have been isolated for H,K-ATPase (3, 4). Experimental modulation of
Na/H,K-ATPase
- and
-isoform combinations have been shown to
produce active enzymes with the ion specificity determined entirely by
the
-subunit (3, 8, 17).
In teleost fish, homologs of mammalian
1- and
1- and
3-isoforms have been identified
(1, 9, 11, 12) and
although the presence of a number of other isoforms has been suggested (10, 13, 21, 28),
no further sequence information is available (for reviews of
Na,K-ATPase in teleosts, see Refs. 13 and 24)
Studies from various teleost fish species have recently suggested that
fish genomes have undergone ancient polyploidization events followed by
species-dependent loss of certain chromosomal segments, resulting in
the production of duplicate copies of some, but not all, genes
(27, 32). In this study, a duplicate copy of
the Na,K-ATPase
1-isoform (called
233)
has been identified by homology cloning in the European eel
(Anguilla anguilla) (13, 24).
Northern blot studies demonstrate that the mRNA expression of this
duplicate exhibits a more limited tissue distribution than that of the
1-isoform and also that, although
233-expression can be induced in osmoregulatory tissues
as a result of seawater (SW) acclimation, this response is dependent on
the developmental stage of the fish. A functional role for the
233 is further suggested by the localization of
233-protein expression in both branchial "chloride"
and intestinal epithelial cells.
| |
METHODS |
|---|
|
|
|---|
Fish. Adult freshwater (FW) sexually immature "yellow" and sexually maturing migratory "silver" eels (Anguilla anguilla; 125-1,250 g body wt) were obtained from local suppliers in Inverness, Blairgowrie and Kelso, and transferred to laboratory aquariums at the Gatty Marine Laboratory, where they were maintained on a 12:12-h light-dark cycle. For initial experiments, yellow eels (see Figs. 1-4) were maintained in either FW (0-10 mOsm/kg), 33% SW (330 mOsm/kg), SW (960-1,020 mOsm/kg), or 200% SW (2,000 mOsm/kg), as indicated for 23 days as described in Cutler et al. (12). Yellow and silver eels used in subsequent experiments (see Fig. 5) were transferred to tanks containing either FW or SW for a period of 21 days. Fish were decapitated and pithed before removal of tissues.
Total RNA extraction. Total RNA samples for experiments shown in Figs. 1-4 were extracted by a modified LiCl procedure as described in Cutler et al. (12). Total RNA isolated in the experiments indicated in Fig. 5 was extracted essentially as described in Chomczynski and Sacchi (6), except with the modification that the isopropanol precipitation was replaced by a high-salt precipitation step (5). The final total RNA pellets were dissolved in Milli-Q (Millipore, Watford, UK) water and supplemented with 1 µl of RNase inhibitor RNaseOut (GIBCO Life Technologies, Paisley, UK).
Cloning and sequencing.
The initial
233-bp fragment of the
233-cDNA was amplified by RT-PCR (10) using
degenerate primers designed to amplify fragments of any vertebrate P
type
-subunits (primer pair 2, see Ref. 9). Subsequent 5' and 3'
rapid amplification of cDNA ends (RACE) fragments were amplified using
Taq DNA polymerase (Amersham Pharmacia Biotech, Little
Chalfont, UK) from cDNA made with mRNA samples extracted from the gills
of 21-day SW-acclimated yellow eels using Clontech's (Basingstoke, UK)
Marathon cDNA Amplification kit. The 5' RACE fragment (790 bp) was
amplified by PCR using a specific antisense primer
(ACATTGGGCCGCACTTTGGCCTT) and the Marathon kit's AP1 primer. The 3'
RACE fragments (3 bands of 350-450 bp) were synthesized using
nested PCR reactions initially with the specific sense primer
(CCCAGAGGATGCCAAGG) and the Marathon kit's AP1 primer followed by
amplification with the nested specific sense primer
(GTTTGAAATACTTTGGCATTGGCGATGGT) and the Marathon cDNA synthesis primer.
A further faint band of a larger product (~1,500 bp) was present on
gels of 3' RACE amplification reaction. No positive colonies were
obtained in experiments attempting to clone this band.
Northern blotting and analysis.
Total RNA was Northern blotted and hybridized to
32P-labeled DNA probes as previously described
(12). For quantitative studies, the concentrations of
total RNA in each tissue extract were initially determined using the
spectrophotometric absorbance at 260 nm, and then the relative amounts
of total RNA loaded in each lane were finally assessed using the
intensity levels of ethidium bromide-stained 18S and 28S ribosomal RNA
present on electrophoresis gels, as determined using a gel
documentation and analysis system (Syngene, Cambridge, UK). Variations
in amounts of total RNA present on the gel used for the blot were noted
and used to adjust the final radioactive signals obtained per microgram
of total RNA from the hybridization. Quantitative analysis of
radiolabeled
233-DNA probes hybridizing to blots was
determined by electronic autoradiography using an Instant Imager
(Canberra Packard, Meriden, CT). Statistical analysis was performed
using StatView 4.01 software (Abacus Concepts, Berkeley, CA), using
ANOVA followed by Scheffé's F post analyses of significance.
Antibody production.
A region of the original
233-cDNA fragment's derived
amino acid sequence, which shared the lowest level of homology with the
1-isoform, was chosen for peptide manufacture (amino
acids 222-236; sequence DAGKLQEVKYFGIGD). The 15-mer was
manufactured as a multiple-antigen peptide (Severn Biotechnology,
Kidderminster, UK) and used to raise
233-specific
polyclonal antibodies in sheep by the Scottish Antibody Production Unit
(SAPU; Law Hospital, Carluke, UK).
Tissue sample preparation and Western blotting.
The epithelial layers were stripped from the intestines of three 3-wk
SW-acclimated yellow eels. The tissue was homogenized at 0-4°C
in 15 vol (vol/wt) of a homogenizing buffer comprising 25 mM HEPES,
0.25 M sucrose, 5 mM MgCl2, 1 mM CaCl2, 0.5 mM
dithiothreitol (DTT), and 0.18 mg/ml phenylmethyl sulphonyl fluoride,
pH 7.4. Membrane fractions were isolated by discontinuous sucrose
density gradient centrifugation essentially as described previously
(23). After centrifugation, membrane fractions banding at
8-35% and 35-43% (wt/vol) sucrose interfaces were
collected, washed, and finally resuspended in 25 mM HEPES, 0.25 M
sucrose, and 0.5 mM DTT, pH 7.4, before freezing in aliquots at
90oC. Samples of the isolated membrane fractions were
incubated at 10°C overnight in the presence of
N-glycosidase F (NGF; 50 enzyme units · mg membrane
protein
1 · ml
1; Boehringer Mannheim,
Lewes, UK). Western blotting was conducted using standard techniques
(16). In brief, NGF-treated and untreated membrane samples
(5 µg protein) were denatured by incubation at 80°C for 10 min in
62.5 mM Tris · HCl, 10% glycerol, 2% SDS, and 45 mM DTT, pH
6.8, and denatured proteins separated by SDS-PAGE using 8% gels
(19). Colored molecular mass standards (30-250 kDa;
Amersham Pharmacia Biotech) were run in parallel tracks to confirm full
transfer of proteins after blotting and to estimate the molecular
masses of immunoreactive bands. Proteins were electroblotted (at 35 V
for 16 h using a Trans-Blot Cell; BioRad, Hemel Hempstead, UK)
onto polyvinylidene difluoride membranes (BDH, Poole, UK), and the
membranes were immediately processed for immunodetection. With
all subsequent procedures conducted at room temperature, membranes were
blocked for 1 h with PBS containing 2.5% BSA and 0.2% Tween 20 and then incubated for 1 h with a 1/1,000 dilution of
233-antisera in PBS containing 1% BSA and 0.2% Tween
20 (PBT). Membranes were then washed three times for 15 min in PBT
before incubation for 1 h with alkaline phosphatase-conjugated
donkey anti-sheep/goat IgG (Sigma-Aldrich, Poole, UK; final dilution 1/10,000) in PBT. After washing three times for 15 min in PBT and twice
for 15 min in PBS, membranes were incubated in Western Blue alkaline
phosphate substrate solution (Promega) for 3-5 min until the
development of immunoreactive bands. The membranes were then washed in
distilled water for 5 min and then left to dry at room temperature.
Immunohistochemistry.
Gill and intestinal tissues from 3-wk SW-acclimated yellow eels were
removed, washed in ice-cold PBS, and fixed in 4% paraformaldehyde in
PBS for 24 h at 4°C. Dehydrated tissues were embedded in
paraffin, and 5-µm sections were mounted on
poly-L-lysine-coated slides before removal of paraffin by
four washes in xylene. With all subsequent procedures carried out at
room temperature, sections were rehydrated in a graded series of
alcohol solutions and finally transferred to a bath containing PBS.
Endogenous peroxidase activity was blocked by immersing the slides in a
3% H2O2 solution for 30 min followed by three
washes in PBS. After incubation in the presence of 10% normal donkey
serum (NDS; SAPU) in PBS for 60 min, the sections were incubated for
1 h in a 1/200 dilution of
233-antiserum in PBS
containing 1% NDS. Control sections were also processed when slides
were incubated with 1/200 dilution of preimmune serum or in the
presence of 1/200 dilution of
233-antiserum containing
40-50 µg/ml of the original peptide antigen. Slides were then
washed three times for 5 min with PBS and further incubated for 1 h with a 1/200 dilution of the secondary antibody, biotinylated donkey
anti-sheep/goat IgG (SAPU). After being washed with PBS three times,
the sections were incubated with 1/800 dilution of streptavidin-peroxidase conjugate (SAPU) for 40 min, washed a further
three times for 5 min in PBS, and finally developed for 10 min in
peroxidase substrate solution (Sigma-Aldrich) containing peroxidase and
3,3'-diaminobenzidine tetrahydrochloride. Slides were washed and
counterstained with Mayer's hematoxylin for 3 min before dehydration
in graded alcohols and xylene and mounting in DPX mountant (BDH) before
drying overnight at room temperature. Slides were viewed and
photographed using a Lietz Dialux 20 microscope and camera system.
| |
RESULTS |
|---|
|
|
|---|
Nucleotide and amino acid sequences of eel
233.
The eel
233-cDNA sequence contained an open reading
frame encoding 302 amino acids (Fig. 1).
The coding region showed high levels of both nucleotide (74.8%) and
amino acid (69.9%) homology to the eel
1-sequence
(12). In a similar fashion to the eel
1-sequence, the
233-cDNA shares highest
levels of amino acid homology with vertebrate
1-isoforms
(54.8-60%) rather than other known
-isoforms (30-35%).
The coding region showed highest levels of nucleotide or amino acid
homology (Fig. 2) to mammalian
1-sequences (62.7-64.3% and 58.0-60.0%,
respectively), with lower homologies to chicken
1 (64.3 and 57.4%, respectively)-, amphibian
1
(59.1-59.4% and 56.4-58.0%, respectively)-, and Torpedo
1-sequences (57.8% and 54.8%, respectively) and to the
human
1-pseudogene nucleotide sequence (58.8%).
The
233-nucleotide sequence also exhibited significant
homology to the eel
1 in the 5' (57.6%) and comparable 3' (68.4%) untranslated regions. The derived eel
233-amino acid sequence possesses three potential
N-linked glycosylation sites compared with the four present within the
eel
1-amino acid sequence (12).
|
|
1-gene (14). At position 10 of the
sequence, there is an antisense CCAAT box sequence similar to that
found in the rat
3-gene PRE1 element (26).
Overlapping with this at position 25, there is a sequence sharing 11 of
12 nucleotides with the region surrounding the adhesion molecule on
glia regulatory element (AMRE)/SP1 regulatory element found in the
promoter of the rat
2-gene (18).
Eel
233-mRNA expression.
Tissue Northern blot analysis of
233-mRNA expression
(Fig. 3) revealed two transcript sizes of
2.4 and 1.2 kb. High levels of expression of the 2.4-kb transcript were
found in the intestine with intermediate levels in kidney, brain, and
gill and low levels in eye, spleen, and esophagus. Expression of the
1.2-kb transcript was found predominately in the intestine, with low
levels also present in kidney and gill tissue samples. Results from the
cloning experiments suggest that the 3' RACE products that were cloned represent copies of the 1.2-kb transcript, whereas the longer 3' RACE
product obtained, which failed to clone, was likely to represent the
2.4-kb transcript.
|
233-mRNA expression was
effected by SW acclimation, yellow eels were acclimated to various
environmental salinities. Semiquantitative Northern blots of gill total
RNA samples indicated that the level of
233-mRNA
expression was not markedly different in FW, 33% SW, and SW-acclimated
eels, but considerably higher levels of expression were found in eels
acclimated to 200% SW (Fig. 4). The
levels of
233-mRNA expression were further investigated
in the gill, intestine, and kidney of both yellow and silver stages of
the adult eel's life cycle. This study (Fig. 5) demonstrated that the level of
233-mRNA expression in the kidney, gill, or intestine of
yellow eels was not significantly different following SW acclimation.
In contrast, in silver eels,
233-mRNA expression was
significantly increased in all three tissues (kidney, +93%; gill,
+208%; intestine, +79%) following SW acclimation. The increase in
gill
233-mRNA abundance was associated with significant
increases in both the 1.2 (+301%)- and 2.4-kb (+149%) transcript
sizes, whereas increases in the kidney and intestine
233-expression were associated only with significant increases in the larger 2.4-kb transcript (+93% and +82%,
respectively).
|
|
Eel
233-protein expression and localization.
The
233-specific antiserum was used for Western blotting
in tissue homogenates and purified membrane fractions from gill and
intestine. Western blots using the
233-antiserum and
membrane fractions from the intestine of either FW- or SW-acclimated
eels resulted in the appearance of a strongly staining but diffuse band
ranging between 40 and 52 kDa (Fig. 6). A
similar sized diffuse band was found with membrane fractions isolated
from the gill (results not shown). After overnight digestion of the
intestinal membrane fractions with NGF, there was a partial
rearrangement in the molecular size of the 40- to 52-kDa proteins into
three major components with mean molecular masses of 47, 39, and 33.5 kDa (Fig. 6), indicating that the immunoreactive proteins are indeed
glycosylated. Again, similar results were obtained with gill
membrane fractions after NGF treatment (results not shown). The
specific antiserum was also used for immunohistochemistry in both gill
and intestinal tissue sections. Antibody incubations with branchial
sections demonstrated labeling of large cells within the interlamellar
regions of the filamental epithelium (Fig.
7A), which correlate exactly
to the classically described location of the so-called
"mitochondrial-rich ionocytes" or "chloride cells" (34). Incubation of branchial sections with antibody
preblocked with peptide antigen (or preimmune serum; data not shown)
revealed no equivalent staining (Fig. 7C). Similar
experiments were also performed with sections from the intestine.
Immunostaining was observed across the basolateral surfaces of columnar
epithelial cells that cover most of the luminal surface of the
intestine (Fig. 7B). However, very little immunoreactivity
was observed in the underlying cell layers. Again, intestinal sections
were incubated with antibody preblocked with peptide antigen, and this produced a substantial reduction in peroxidase staining compared with
normal antibody incubations (Fig. 7D).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Unlike that found with the eel
1-isoform, the
233-isoform shares highest levels of nucleotide and
amino acid homology with mammalian (62.7-64.3% and
58.0-60.0%, respectively) rather than amphibian
1-isoforms (59.1-59.4% and 56.4-58.0%,
respectively), although the significance of this is unclear (see Fig.
2). The high level of nucleotide (74.8%) and amino acid (69.9%)
homology shared by the
233- and the eel
1-sequence suggests that these isoforms are gene duplicates.
The gene duplication of the
1-isoform in eels may
represent an isolated event. However, recent studies have suggested
that two polyploidization events occurred early in the evolution of ray-finned fishes either before or after the divergence of the fish and
mammalian lineages (27, 32). The
233-sequence may therefore have formed as a result of a
wider genomic duplication event. It is consequently also
possible that the
233-gene may be the homolog of a
mammalian protein, with which it would be expected to share high levels
of homology. A duplicate
1-gene is present within the
mammalian genome; however, this is thought to represent a nonfunctional
genomic pseudogene (20, 30). The lower level
of nucleotide homology that the
233-sequence shares with
the human
1-pseudogene (58.8%), compared with the same
region of the human
1-gene (63.5%), suggests that it
may not be a homolog of this gene (the eel
1-sequence
also shares lower levels of homology with the human
1-pseudogene), although the lower levels of homology may
also be explained by a faster rate of mutation in the pseudogene
because it became nonfunctional. As the
233-isoform is
expressed both at the mRNA and protein levels, this also argues against
the
233-being a direct counterpart of the pseudogene
found in humans.
Unlike other vertebrate
1-isoform sequences, the eel
1- and
233-isoforms share significant
amounts of homology in the 5' (57.6%) untranslated region. However,
the
233-isoform has several insertions relative to the
1-sequence. The 5' untranslated region of the
233-cDNA also has several sequences that are homologous to transcriptional promoter regulatory elements normally found upstream
of the transcription initiation sites of other Na,K-ATPase genes (see
Fig. 1). These sequences are not found in the comparable region of the
eel
1-cDNA (12). As these elements are
located in the 5' untranslated region, it is unclear whether these
promoter-like elements serve any purpose. The first putative element
shares high levels of homology (11 of 12 nucleotides) with the AMRE/SP1 regulatory element sequence found in the promoter of the rat
Na,K-ATPase
2-gene (AGGAGGCGGGGT; see Ref. 18). However,
the single nucleotide difference is located within the core region of
the SP1 binding site sequence (GCGG, whereas the
233-sequence has GGGG), and so it is unclear whether
this sequence could function as an SP1 binding site. Other putative
regulatory elements are an anti-sense CCAAT box sequence, similar to
that found in the rat
3-gene PRE1 element
(26), and a possible M/GRE region, which has an imperfect (nonexact inverted repeat) half site (TGTCCT) identical to the M/GRE of
the human
1-gene (14). The other potential
half site of the M/GRE (GGAGCA) is spaced 10 nucleotides away from the
first half site but shares only four of six common nucleotides with the
human
1-sequence. The teleost fish glucocorticoid
receptor (GR) has an extra nine amino acids inserted between the
DNA-binding zinc finger domains (15), suggesting that fish
GRs may bind half sites that are further apart than the consensus
spacing of three nucleotides apart in other vertebrate species
(31). If any of these putative regulatory elements in the
5' untranslated region of the eel
233-gene are
functional, as they are downstream of the transcription start site,
their most likely role would be to inhibit transcription. However, an
inhibitory M/GRE in this position could be difficult to reconcile
because in teleost fish, cortisol is known to stimulate Na,K-ATPase
activity (24). Another possible explanation for the
presence of putative regulatory element sequences in the 5'
untranslated region is that at one point earlier in the evolution of
the gene, the transcription start site was further downstream, and,
consequently, they were located within the promoter region at that time.
The tissue-specific distribution of
233-mRNA (Fig. 3)
shows a restricted pattern of expression compared with that of the eel
1-isoform (12). In particular, the levels
of
233-expression in eye, esophagus, pancreas, spleen,
and ovary are absent or very much reduced compared with the level of
1-expression in these tissues. The other notable point
is that there is no
233-expression in liver, heart, or
skeletal muscle tissues. Although there are very faint signals for
1-mRNA expression in eel skeletal muscle, no other
-subunits have so far been identified in these tissues (9, 10, 12).
The level of both eel gill
1- and
1-mRNA
abundance has been shown to be modulated by adaptation to differing
salinities, with increases in expression following acclimation of adult
FW eels to SW or 200% SW environments (11,
12, 22). In contrast to this, the levels of
branchial
233-mRNA expression (Fig. 4) show a different
pattern of expression. Visible increases in branchial
233-expression were only found after acclimation of FW
eels to the 200% SW environment, expression being essentially the same in FW, 33% SW, and SW environments.
Eels have two morphologically distinct developmental stages in the
adult phase of their life cycle. They begin adult life as sexually
immature yellow eels, which predominate in FW environments. After an
indeterminate period of time, yellow eels metamorphose into the
sexually maturer silver eels, which migrate back to the marine
environment where they may return to the Sargasso sea to breed.
Quantitative expression of
233-mRNAs was further
evaluated at these two developmental stages of the adult eel's life
cycle (Fig. 5). The levels of
233-mRNA expression in the
gill, intestine, and kidney of yellow eels were not significantly
elevated 3 wk after FW-to-SW transfer. However, in the developmentally
maturer silver eel, significant increases in expression were found in all three tissues following a similar period of SW acclimation. In
previous studies, the levels of
1- and
1-isoform mRNAs have been found to increase in both
yellow and silver eels following SW acclimation (data not shown). The
complexity of the situation is further increased by the existence of
two transcript sizes of 1.2 and 2.4 kb. The separate analysis of
changes in
233-expression for each transcript reveals
that significant increases in expression are found in all three tissues
for the larger transcript (2.4 kb), but a significant increase in
expression of the smaller transcript (1.2 kb) was only found in the
branchial tissue of silver eels. This differential tissue-specific
regulation of the expression of smaller
233-mRNA
transcripts suggests that the extra sequence information contained
within the 3' untranslated region of larger mRNA species may have some
functional significance.
The 3' untranslated region of the
233-sequence (1.2-kb
transcript) shares nucleotide homology with a comparable region of the
eel
1-isoform (68.4%), although no significant homology
to mammalian
1-sequences is evident. However, the
smaller
233-transcript does not possess the highly
homologous regions found further downstream within the 3' region of all
vertebrate
1 cDNAs (33). It has been
speculated that this region may be involved in modulating mRNA
stability (29), but no further evidence to support this is
available. Interestingly both mammalian
2- and
3-isoforms, but not the H,K-ATPase
-isoform, have
distinct highly conserved sequences within their 3' untranslated
regions (data not shown). It will be interesting to discover whether
the longer (2.4 kb)
233-transcript contains a comparable
homologous region.
Results from Western blotting experiments demonstrated that the
233-protein is functionally expressed in both gill and
intestine. The diffuse immunoreactive bands produced on these blots
(40-52 kDa), which were of somewhat larger size than that
predicted from the derived amino acid sequence (35 kDa), were sensitive
to the enzyme NGF, suggesting that the protein is likely to be variably glycosylated, as is normally the case for Na,K-ATPase
-subunits (7). It is possible that the range in the size of
immunoreactive bands following NGF treatment may reflect the incomplete
removal of all carbohydrate groups associated with the
233-protein. Localization studies, using the
233-specific antibody also demonstrated that this
duplicate of the
1-gene is also expressed at high levels within the large cells found in the interlamellar regions of the branchial epithelium, which are presumed to represent chloride cells.
In addition to this, the expression of the
233-isoform was also localized to the basolateral surfaces of columnar epithelial cells lining the lumen of the intestine. These observations suggest that the
233-isoform is an integral component of the
Na,K-ATPase enzyme that is expressed in the ionoregulatory cells of
both the branchial and intestinal epithelia. It is therefore possible
that this isoform of the
-subunit may have an important functional role in the major osmoregulatory tissues of the eel when fish are
acclimated to either the FW or SW environments.
In summary, a duplicate copy of the Na,K-ATPase
1-isoform (called
233) has been
identified by homology cloning in the European eel (Anguilla
anguilla). Expression of this isoform has been demonstrated in a
number of osmoregulatory tissues and has been localized to chloride and
columnar cells within the branchial and intestinal epithelia,
respectively. Northern blot studies of
233-mRNA
expression show that, although expression of this duplicate in the
osmoregulatory tissues of FW eels can be induced by SW acclimation,
this response is dependent on the developmental stage of the fish.
Perspectives
The hypothesis that fish genomes have undergone ancient polyploidization events resulting in the production of duplicate copies of some but not all genes has potentially large implications for fish physiology. This theory not only presents a plausible explanation as to why there was a considerable evolutionary diversification and expansion of the number of teleost fish species, but may also explain why teleosts have been able to exploit and adapt to differing environmental conditions so successfully. Of particular interest in this study is the underlying possibility that the retention or loss of certain gene duplicates within the genome may explain the ability of some teleost species to adapt to differing ionic environments. Is it possible that stenohaline marine or FW teleosts have lost key osmoregulatory genes that allow movement between these two environments? Likewise have euryhaline teleosts, like the eel, retained important gene duplicates that allow osmoregulatory plasticity?Another important aspect of genome duplication is whether
differences between gene duplicates are conserved between teleost fish
species. After duplication, teleost genomes presumably contained two
identical copies, which in the case of the eel
1- and
233-sequences, subsequently developed differences in
sequence and possibly function and regulation. However, although these
differences may have developed in a common ancestral teleost species,
suggesting that recognizable
1- and
233-counterparts may be present in other teleost
species, it is also possible that a different set of changes has
occurred in other species; in which case, each pair of
1-duplicates may have developed different functions and
patterns of regulation, with "
1-like" sequences
quite distinct from those of the eel
1- and
233-isoforms.
| |
ACKNOWLEDGEMENTS |
|---|
This study was supported by grants from the Wellcome Trust and the Natural Environment Research Council.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: C. Cutler, Bute Medical Bldg.s, School of Biology, Univ. of St Andrews, St Andrews, Fife, Scotland KY16 9TS, UK (E-mail:-cpc{at}st-and.ac.uk).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Received 12 May 1999; accepted in final form 9 February 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Appel, C,
Gloor S,
Schmalzing G,
Schachner M,
and
Bernhardt RR.
Expression of a Na,K-ATPase
3 subunit during development of the Zebrafish central nervous system.
J Neurosci Res
46:
551-564,
1996[Web of Science][Medline].
2.
Beguin, P,
Wang X,
Fursov D,
Puoti A,
Claeys D,
Horisberger J-D,
and
Geering K.
The
subunit is a specific component of the Na,K-ATPase and modulates its transport function.
EMBO J
16:
4250-4260,
1997[Web of Science][Medline].
3.
Blanco, G,
and
Mercer RW.
Isozymes of the Na-K-ATPase: heterogeneity in structure, diversity in function.
Am J Physiol Renal Physiol
275:
F633-F650,
1998
4.
Caplan, MJ.
Gastric H+/K+-ATPase: targeting signals in the regulation of physiologic function.
Curr Opin Cell Biol
10:
468-473,
1998[Web of Science][Medline].
5.
Chomczynski, P,
and
Mackey K.
Modification of the TRI Reagent procedure for the isolation of RNA from polysaccharide- and proteoglycan-rich sources.
Biotechniques
19:
942-945,
1995[Web of Science][Medline].
6.
Chomczynski, P,
and
Sacchi N.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[Web of Science][Medline].
7.
Chow, DC,
and
Forte JG.
Functional significance of the
-subunit for heterodimeric P-type ATPases.
J Exp Biol
198:
1-17,
1995[Abstract].
8.
Codina, J,
Delmas-Mata JT,
and
Dubose TD, Jr.
The
-subunit of the colonic H+,K+-ATPase assembles with
1-Na+,K+-ATPase in kidney and distal colon.
J Biol Chem
273:
7894-7899,
1998
9.
Cutler, CP,
Sanders IL,
and
Cramb G.
Expression of Na+,K+-ATPase
subunit isoforms in the European eel (Anguilla anguilla).
Fish Physiol Biochem
17:
371-376,
1997.
10.
Cutler, CP,
Sanders IL,
and
Cramb G.
Isolation of six putative P-type ATPase
subunit PCR fragments from the brain of the European eel (Anguilla anguilla).
Annals New York Acad Sci
834:
123-125,
1997[Web of Science][Medline].
11.
Cutler, CP,
Sanders IL,
Hazon N,
and
Cramb G.
Primary sequence, tissue specificity and expression of the Na+,K+- ATPase
1 subunit in the European eel (Anguilla anguilla).
Comp Biochem Physiol
111B:
567-573,
1995.
12.
Cutler, CP,
Sanders IL,
Hazon N,
and
Cramb G.
Primary sequence, tissue specificity and expression of the Na+,K+- ATPase
1 subunit in the European eel (Anguilla anguilla).
Fish Physiol Biochem
14:
423-429,
1995.
13.
Cutler, CP,
Sanders IL,
Luke G,
Hazon N,
and
Cramb G.
Ion transport in teleosts: identification and expression of ion transporting proteins in the branchial and intestinal epithelia of the European eel (Anguilla anguilla).
In: Gene Expression and Manipulation in Aquatic Organisms, Society of Experimental Biologists, Seminar Series 58, edited by Ennion SJ,
and Goldspink G.. Cambridge, UK: Cambridge University Press, 1996, p. 43-74.
14.
Derfoul, A,
Robertson NM,
Lingrel JB,
Hall DJ,
and
Litwack G.
Regulation of the human Na/K-ATPase
1 gene promoter by mineralocorticoid and glucocorticoid receptors.
J Biol Chem
273:
20702-20711,
1998
15.
Ducoret, B,
Tujague M,
Ashraf J,
Mouchel N,
Servel N,
Valotaire Y,
and
Thompson EB.
Cloning of a teleost fish glucocorticoid receptor shows that it contains a deoxyribonucleic acid-binding domain different from that of mammals.
Endocrinol
136:
3774-3783,
1995[Abstract].
16.
Hames, BD.
One dimensional polyacrylamide gel electrophoresis.
In: Gel Electrophoresis of Proteins: A Practical Approach (2nd ed.), edited by Hames BD,
and Rickwood D.. Oxford, UK: Oxford University Press, 1996, p. 1-147.
17.
Horisberger, JD,
Jaunin P,
Reuben MA,
Lasater LS,
Chow DC,
Forte JG,
Sachs G,
Rossier BC,
and
Geering K.
The H,K-ATPase
-subunit can act as a surrogate for the
-subunit of Na,K-pumps.
J Biol Chem
266:
19131-19134,
1991
18.
Kawakami, K,
Suzuki-Yagawa Y,
Watanabe Y,
and
Negano K.
Identification and characterisation of the cis-elements regulating the rat AMOG (Adhesion Molecule On Glia)/Na,K-ATPase
2 subunit gene.
J Biochem
111:
515-522,
1992
19.
Laemmli, UK.
Cleavage of structural proteins during the assembly of the head of the bacteriophage T4.
Nature
227:
680-685,
1970[Medline].
20.
Lane, LK,
Shull MM,
Whitmar KR,
and
Lingrel JB.
Characterisation of two genes for the human Na,K-ATPase
subunit.
Genomics
5:
445-453,
1989[Web of Science][Medline].
21.
Lee, T-H,
Tsai J-C,
Fang M-J,
Yu M-J,
and
Hwang P-P.
Isoform expression of Na+-K+-ATPase
-subunit in gills of the teleost Orechromis mossambicus.
Am J Physiol Regulatory Integrative Comp Physiol
275:
R926-R932,
1998
22.
Luke, GA,
Cutler CP,
Sanders IL,
Hazon N,
and
Cramb G.
Branchial Na+/K+-ATPase expression in the European eel (Anguilla anguilla) following saltwater acclimation.
In: The Sodium Pump: Structure, Mechanism, Hormonal Control and Its Role in Disease, edited by Bamberg E,
and Schoner W.. Darmstadt, Germany: Steinkopff, 1994, p. 246-249.
23.
McCartney, S,
and
Cramb G.
Effects of a high-salt diet on hepatic atrial natriuretic peptide receptor expression in Dahl salt-resistant and salt-sensitive rats.
J Hypertens
11:
253-262,
1993[Web of Science][Medline].
24.
McCormick, SD.
Hormonal control of gill Na+,K+-ATPase and chloride cell function.
In: Cellular and Molecular Approaches to Fish Ionic Regulation. Fish Physiology, edited by Woods CM,
and Shuttleworth TJ.. New York: Academic, 1995, vol. 14, p. 285-315.
25.
Møller, JV,
Juul B,
and
Le Maire M.
Structural organisation, ion transport, and energy transduction of P-type ATPases.
Biochim Biophys Acta
1286:
1-51,
1996[Medline].
26.
Murakami, Y,
Ikeda U,
Shimada K,
and
Kawakami K.
Promoter of the Na,K-ATPase
3 subunit gene is composed of cis elements to which NF-Y and SP1/SP3 bind in rat cardiocytes.
Biochim Biophys Acta
1352:
311-324,
1997[Medline].
27.
Postlethwait, JH,
Yan YL,
Gates MA,
Horne S,
Amores A,
Brownlie A,
Donovan A,
Egan ES,
Force A,
Gong ZY,
Goutel C,
Fritz A,
Kelsh R,
Knapik E,
Liao E,
Paw B,
Ransom D,
Singer A,
Thomson M,
Abduljabbar TS,
Yelick P,
Beier D,
Joly JS,
Larhammar D,
Rosa F,
Westerfield M,
Zon LI,
Johnson SL,
and
Talbot WS.
Vertebrate genome evolution and the zebrafish gene map.
Nature Genet
18:
345-349,
1998[Web of Science][Medline].
28.
Pressley, TA.
Phylogenetic conservation of isoform-specific regions within
-subunit of Na+-K+-ATPase.
Am J Physiol Cell Physiol
262:
C743-C751,
1992
29.
Taormino, JP,
and
Fambrough DM.
Effect of deletions in the 3' untranslated region of the
1-subunit mRNA on mRNA stability (Abstract).
J Gen Physiol
96:
24a,
1990.
30.
Ushkaryov Yu, A,
Monastyrskaya GS,
Broude NE,
Nikiforova NN,
Bessarab DA,
Yu M.,
Orlova Petrukhin KE,
Modyanov NN,
and
Sverdlov ED.
Human Na+,K+-ATPase genes.
-subunit gene family contains at least one gene and one pseudogene.
FEBS Lett
257:
439-442,
1989[Web of Science][Medline].
31.
Weigel, NL.
Steroid hormone receptors and their regulation by phosphorylation.
Biochem J
319:
657-667,
1996.
32.
Wittbrodt, J,
Meyer A,
and
Schartl M.
More genes in fish?
Bioessays
20:
511-515,
1998[Web of Science].
33.
Young, RM,
Shull GE,
and
Lingrel JB.
Multiple mRNAs from rat kidney and brain encode a single Na+,K+-ATPase
subunit protein.
J Biol Chem
262:
4905-4910,
1987
34.
Zadunaisky, JA.
The chloride cell: the active transport of chloride and the paracellular pathways.
In: Gills. Part B. Ion and water transfer. Fish Physiology, edited by Hoar WS,
and Randall DJ.. New York: Academic, 1984, vol. 10, p. 129-176.
This article has been cited by other articles:
![]() |
S. S. Madsen, P. Kiilerich, and C. K. Tipsmark Multiplicity of expression of Na+,K+-ATPase {alpha}-subunit isoforms in the gill of Atlantic salmon (Salmo salar): cellular localisation and absolute quantification in response to salinity change J. Exp. Biol., January 1, 2009; 212(1): 78 - 88. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kalujnaia, I. S. McWilliam, V. A. Zaguinaiko, A. L. Feilen, J. Nicholson, N. Hazon, C. P. Cutler, and G. Cramb Transcriptomic approach to the study of osmoregulation in the European eel Anguilla anguilla Physiol Genomics, November 14, 2007; 31(3): 385 - 401. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Grosell, K. M. Gilmour, and S. F. Perry Intestinal carbonic anhydrase, bicarbonate, and proton carriers play a role in the acclimation of rainbow trout to seawater Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R2099 - R2111. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-S. Martinez, C. P. Cutler, G. D. Wilson, C. Phillips, N. Hazon, and G. Cramb Regulation of expression of two aquaporin homologs in the intestine of the European eel: effects of seawater acclimation and cortisol treatment Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2005; 288(6): R1733 - R1743. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Evans, P. M. Piermarini, and K. P. Choe The Multifunctional Fish Gill: Dominant Site of Gas Exchange, Osmoregulation, Acid-Base Regulation, and Excretion of Nitrogenous Waste Physiol Rev, January 1, 2005; 85(1): 97 - 177. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Cutler and G. Cramb Branchial expression of an aquaporin 3 (AQP-3) homologue is downregulated in the European eel Anguilla anguilla following seawater acclimation J. Exp. Biol., September 1, 2002; 205(17): 2643 - 2651. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Lignot, C. P. Cutler, N. Hazon, and G. Cramb Immunolocalisation of aquaporin 3 in the gill and the gastrointestinal tract of the European eel Anguilla anguilla (L.) J. Exp. Biol., September 1, 2002; 205(17): 2653 - 2663. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Chen, C. Cutler, C. Jacques, E. Denamur, G. Lecointre, B. Mercier, G. Cramb, and C. Ferec A Combined Analysis of the Cystic Fibrosis Transmembrane Conductance Regulator: Implications for Structure and Disease Models Mol. Biol. Evol., September 1, 2001; 18(9): 1771 - 1788. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |