AJP - Regu Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 279: R222-R229, 2000;
0363-6119/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (30)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cutler, C. P.
Right arrow Articles by Cramb, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cutler, C. P.
Right arrow Articles by Cramb, G.
Vol. 279, Issue 1, R222-R229, July 2000

Expression of a duplicate Na,K-ATPase beta 1-isoform in the European eel (Anguilla anguilla)

Christopher P. Cutler1, Stephane Brezillon1, Songul Bekir1, Ian L. Sanders1, Neil Hazon2, and Gordon Cramb1

1 School of Biology, Bute Medical Buildings, University of Saint Andrews, Saint Andrews, Fife, Scotland KY16 9TS; and 2 Gatty Marine Laboratory, University of Saint Andrews, Saint Andrews, Fife, Scotland KY16 8LB, United Kingdom


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Recent studies on teleost fish have suggested that their genomes have undergone ancient polyploidization events resulting in the duplication of the genome. A duplicate copy of the Na,K-ATPase beta 1-isoform (called beta 233) has been identified in the European eel (Anguilla anguilla). The beta 233-isoform shares high levels of nucleotide (74.8%) and amino acid (69.9%) homology with the eel beta 1-subunit as well as other vertebrate beta 1-sequences. Compared with the widely expressed beta 1-isoform, expression of beta 233-mRNA is mainly restricted to epithelial tissues. Seawater acclimation induced increases in beta 233-mRNA levels in kidney, gill, and intestine of migratory "silver" but not the nonmigratory "yellow" adult eels, suggesting that the factors responsible for this upregulation are themselves developmentally regulated. Expression of a variably glycosylated 40- to 52-kDa beta 233-protein in both gill "chloride" and intestinal epithelial cells suggests that the beta 233-isoform of Na,K-ATPase may play an important functional role in the major osmoregulatory tissues of euryhaline fish such as the eel.

teleost fish; mRNA expression; salinity acclimation; developmental maturation; immunolocalization.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

THE P TYPE ATPase gene family comprises a number of related proteins predominately involved in the active transport of cations across biological membranes (25). Within this family, only two members require more than a single subunit for catalytic activity, namely the Na,K-ATPase and the closely related H,K-ATPase. These enzymes use the energy liberated from ATP hydrolysis to exchange extracellular K+ with either intracellular Na+ or H+, generating ion-selective concentration gradients. Both enzymes have an alpha -subunit, which contains most of the functional domains, and a beta -subunit, which not only acts to correctly fold and deliver the alpha -subunit to the plasma membrane, but may also be involved in K+ occlusion and modulation of enzyme affinities for ion substrates (3, 4). A proteolipid gamma -subunit has also been found to copurify with the Na,K-ATPase and, although not essential for enzyme activity, may modify enzyme function (2, 3). In mammals, a number of alpha - and beta -subunit isoforms exist. Four alpha -isoforms (called alpha 1 to alpha 4) and three beta -isoforms (called beta 1 to beta 3) have been identified for Na,K-ATPase and two alpha -isoforms (gastric and nongastric) and a single beta -isoform (gastric) have been isolated for H,K-ATPase (3, 4). Experimental modulation of Na/H,K-ATPase alpha - and beta -isoform combinations have been shown to produce active enzymes with the ion specificity determined entirely by the alpha -subunit (3, 8, 17).

In teleost fish, homologs of mammalian alpha 1- and beta 1- and beta 3-isoforms have been identified (1, 9, 11, 12) and although the presence of a number of other isoforms has been suggested (10, 13, 21, 28), no further sequence information is available (for reviews of Na,K-ATPase in teleosts, see Refs. 13 and 24)

Studies from various teleost fish species have recently suggested that fish genomes have undergone ancient polyploidization events followed by species-dependent loss of certain chromosomal segments, resulting in the production of duplicate copies of some, but not all, genes (27, 32). In this study, a duplicate copy of the Na,K-ATPase beta 1-isoform (called beta 233) has been identified by homology cloning in the European eel (Anguilla anguilla) (13, 24). Northern blot studies demonstrate that the mRNA expression of this duplicate exhibits a more limited tissue distribution than that of the beta 1-isoform and also that, although beta 233-expression can be induced in osmoregulatory tissues as a result of seawater (SW) acclimation, this response is dependent on the developmental stage of the fish. A functional role for the beta 233 is further suggested by the localization of beta 233-protein expression in both branchial "chloride" and intestinal epithelial cells.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Fish. Adult freshwater (FW) sexually immature "yellow" and sexually maturing migratory "silver" eels (Anguilla anguilla; 125-1,250 g body wt) were obtained from local suppliers in Inverness, Blairgowrie and Kelso, and transferred to laboratory aquariums at the Gatty Marine Laboratory, where they were maintained on a 12:12-h light-dark cycle. For initial experiments, yellow eels (see Figs. 1-4) were maintained in either FW (0-10 mOsm/kg), 33% SW (330 mOsm/kg), SW (960-1,020 mOsm/kg), or 200% SW (2,000 mOsm/kg), as indicated for 23 days as described in Cutler et al. (12). Yellow and silver eels used in subsequent experiments (see Fig. 5) were transferred to tanks containing either FW or SW for a period of 21 days. Fish were decapitated and pithed before removal of tissues.

Total RNA extraction. Total RNA samples for experiments shown in Figs. 1-4 were extracted by a modified LiCl procedure as described in Cutler et al. (12). Total RNA isolated in the experiments indicated in Fig. 5 was extracted essentially as described in Chomczynski and Sacchi (6), except with the modification that the isopropanol precipitation was replaced by a high-salt precipitation step (5). The final total RNA pellets were dissolved in Milli-Q (Millipore, Watford, UK) water and supplemented with 1 µl of RNase inhibitor RNaseOut (GIBCO Life Technologies, Paisley, UK).

Cloning and sequencing. The initial beta 233-bp fragment of the beta 233-cDNA was amplified by RT-PCR (10) using degenerate primers designed to amplify fragments of any vertebrate P type beta -subunits (primer pair 2, see Ref. 9). Subsequent 5' and 3' rapid amplification of cDNA ends (RACE) fragments were amplified using Taq DNA polymerase (Amersham Pharmacia Biotech, Little Chalfont, UK) from cDNA made with mRNA samples extracted from the gills of 21-day SW-acclimated yellow eels using Clontech's (Basingstoke, UK) Marathon cDNA Amplification kit. The 5' RACE fragment (790 bp) was amplified by PCR using a specific antisense primer (ACATTGGGCCGCACTTTGGCCTT) and the Marathon kit's AP1 primer. The 3' RACE fragments (3 bands of 350-450 bp) were synthesized using nested PCR reactions initially with the specific sense primer (CCCAGAGGATGCCAAGG) and the Marathon kit's AP1 primer followed by amplification with the nested specific sense primer (GTTTGAAATACTTTGGCATTGGCGATGGT) and the Marathon cDNA synthesis primer. A further faint band of a larger product (~1,500 bp) was present on gels of 3' RACE amplification reaction. No positive colonies were obtained in experiments attempting to clone this band.

The original RT-PCR cDNA fragment was cloned into the plasmid vector pCR II using Invitrogen's TA Cloning kit. The 5' RACE product was cloned into the plasmid vector pGEM-T using Promega's (Southampton, UK) pGEM-T vector systems kit. The 3' RACE product was cloned into the plasmid vector pCR-Blunt II-TOPO using Invitrogen's (Leek, The Netherlands) Zero Blunt TOPO PCR Cloning kit.

The original RT-PCR cDNA fragment plasmids were sequenced as previously described (9). Both the 5' and 3' RACE products were reamplified from bacterial colonies. A sample of bacterial culture (50 µl) was centrifuged for 30 s at ~15,000 g in a microfuge, the supernatant was aspirated, and the bacterial pellet was resuspended in 200 µl of Milli-Q water. A sample of this suspension (0.5 µl) was used as a PCR template. Amplified PCR fragments (using vector T7 and SP6 or M13 reverse primers) were purified using Geneclean II DNA purification kit (Anachem, Luton, UK). Vector inserts were sequenced using an Applied Biosystems Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit (PE Applied Biosystems, Warrington, UK). At least three clones of each cDNA fragment were sequenced in both directions. The overlapping sequences obtained were then combined using the GeneJockey II software package (Biosoft, Cambridge, UK).

Northern blotting and analysis. Total RNA was Northern blotted and hybridized to 32P-labeled DNA probes as previously described (12). For quantitative studies, the concentrations of total RNA in each tissue extract were initially determined using the spectrophotometric absorbance at 260 nm, and then the relative amounts of total RNA loaded in each lane were finally assessed using the intensity levels of ethidium bromide-stained 18S and 28S ribosomal RNA present on electrophoresis gels, as determined using a gel documentation and analysis system (Syngene, Cambridge, UK). Variations in amounts of total RNA present on the gel used for the blot were noted and used to adjust the final radioactive signals obtained per microgram of total RNA from the hybridization. Quantitative analysis of radiolabeled beta 233-DNA probes hybridizing to blots was determined by electronic autoradiography using an Instant Imager (Canberra Packard, Meriden, CT). Statistical analysis was performed using StatView 4.01 software (Abacus Concepts, Berkeley, CA), using ANOVA followed by Scheffé's F post analyses of significance.

Antibody production. A region of the original beta 233-cDNA fragment's derived amino acid sequence, which shared the lowest level of homology with the beta 1-isoform, was chosen for peptide manufacture (amino acids 222-236; sequence DAGKLQEVKYFGIGD). The 15-mer was manufactured as a multiple-antigen peptide (Severn Biotechnology, Kidderminster, UK) and used to raise beta 233-specific polyclonal antibodies in sheep by the Scottish Antibody Production Unit (SAPU; Law Hospital, Carluke, UK).

Tissue sample preparation and Western blotting. The epithelial layers were stripped from the intestines of three 3-wk SW-acclimated yellow eels. The tissue was homogenized at 0-4°C in 15 vol (vol/wt) of a homogenizing buffer comprising 25 mM HEPES, 0.25 M sucrose, 5 mM MgCl2, 1 mM CaCl2, 0.5 mM dithiothreitol (DTT), and 0.18 mg/ml phenylmethyl sulphonyl fluoride, pH 7.4. Membrane fractions were isolated by discontinuous sucrose density gradient centrifugation essentially as described previously (23). After centrifugation, membrane fractions banding at 8-35% and 35-43% (wt/vol) sucrose interfaces were collected, washed, and finally resuspended in 25 mM HEPES, 0.25 M sucrose, and 0.5 mM DTT, pH 7.4, before freezing in aliquots at -90oC. Samples of the isolated membrane fractions were incubated at 10°C overnight in the presence of N-glycosidase F (NGF; 50 enzyme units · mg membrane protein-1 · ml-1; Boehringer Mannheim, Lewes, UK). Western blotting was conducted using standard techniques (16). In brief, NGF-treated and untreated membrane samples (5 µg protein) were denatured by incubation at 80°C for 10 min in 62.5 mM Tris · HCl, 10% glycerol, 2% SDS, and 45 mM DTT, pH 6.8, and denatured proteins separated by SDS-PAGE using 8% gels (19). Colored molecular mass standards (30-250 kDa; Amersham Pharmacia Biotech) were run in parallel tracks to confirm full transfer of proteins after blotting and to estimate the molecular masses of immunoreactive bands. Proteins were electroblotted (at 35 V for 16 h using a Trans-Blot Cell; BioRad, Hemel Hempstead, UK) onto polyvinylidene difluoride membranes (BDH, Poole, UK), and the membranes were immediately processed for immunodetection. With all subsequent procedures conducted at room temperature, membranes were blocked for 1 h with PBS containing 2.5% BSA and 0.2% Tween 20 and then incubated for 1 h with a 1/1,000 dilution of beta 233-antisera in PBS containing 1% BSA and 0.2% Tween 20 (PBT). Membranes were then washed three times for 15 min in PBT before incubation for 1 h with alkaline phosphatase-conjugated donkey anti-sheep/goat IgG (Sigma-Aldrich, Poole, UK; final dilution 1/10,000) in PBT. After washing three times for 15 min in PBT and twice for 15 min in PBS, membranes were incubated in Western Blue alkaline phosphate substrate solution (Promega) for 3-5 min until the development of immunoreactive bands. The membranes were then washed in distilled water for 5 min and then left to dry at room temperature.

Immunohistochemistry. Gill and intestinal tissues from 3-wk SW-acclimated yellow eels were removed, washed in ice-cold PBS, and fixed in 4% paraformaldehyde in PBS for 24 h at 4°C. Dehydrated tissues were embedded in paraffin, and 5-µm sections were mounted on poly-L-lysine-coated slides before removal of paraffin by four washes in xylene. With all subsequent procedures carried out at room temperature, sections were rehydrated in a graded series of alcohol solutions and finally transferred to a bath containing PBS. Endogenous peroxidase activity was blocked by immersing the slides in a 3% H2O2 solution for 30 min followed by three washes in PBS. After incubation in the presence of 10% normal donkey serum (NDS; SAPU) in PBS for 60 min, the sections were incubated for 1 h in a 1/200 dilution of beta 233-antiserum in PBS containing 1% NDS. Control sections were also processed when slides were incubated with 1/200 dilution of preimmune serum or in the presence of 1/200 dilution of beta 233-antiserum containing 40-50 µg/ml of the original peptide antigen. Slides were then washed three times for 5 min with PBS and further incubated for 1 h with a 1/200 dilution of the secondary antibody, biotinylated donkey anti-sheep/goat IgG (SAPU). After being washed with PBS three times, the sections were incubated with 1/800 dilution of streptavidin-peroxidase conjugate (SAPU) for 40 min, washed a further three times for 5 min in PBS, and finally developed for 10 min in peroxidase substrate solution (Sigma-Aldrich) containing peroxidase and 3,3'-diaminobenzidine tetrahydrochloride. Slides were washed and counterstained with Mayer's hematoxylin for 3 min before dehydration in graded alcohols and xylene and mounting in DPX mountant (BDH) before drying overnight at room temperature. Slides were viewed and photographed using a Lietz Dialux 20 microscope and camera system.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Nucleotide and amino acid sequences of eel beta 233. The eel beta 233-cDNA sequence contained an open reading frame encoding 302 amino acids (Fig. 1). The coding region showed high levels of both nucleotide (74.8%) and amino acid (69.9%) homology to the eel beta 1-sequence (12). In a similar fashion to the eel beta 1-sequence, the beta 233-cDNA shares highest levels of amino acid homology with vertebrate beta 1-isoforms (54.8-60%) rather than other known beta -isoforms (30-35%). The coding region showed highest levels of nucleotide or amino acid homology (Fig. 2) to mammalian beta 1-sequences (62.7-64.3% and 58.0-60.0%, respectively), with lower homologies to chicken beta 1 (64.3 and 57.4%, respectively)-, amphibian beta 1 (59.1-59.4% and 56.4-58.0%, respectively)-, and Torpedo beta 1-sequences (57.8% and 54.8%, respectively) and to the human beta 1-pseudogene nucleotide sequence (58.8%). The beta 233-nucleotide sequence also exhibited significant homology to the eel beta 1 in the 5' (57.6%) and comparable 3' (68.4%) untranslated regions. The derived eel beta 233-amino acid sequence possesses three potential N-linked glycosylation sites compared with the four present within the eel beta 1-amino acid sequence (12).


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 1.   Nucleotide and derived amino acid sequence of the eel Na,K-ATPase beta 233-subunit isoform. Potential regulatory elements in the 5' untranslated region are indicated as follows: mineralo-/glucocorticoid response element (M/GRE) half sites, solid lines; antisense CCAAT, double lines; adhesion molecule on glia regulatory element (AMRE)/SP1 site, shaded region. Sequences indicated within the coding region are potential N-linked glycosylation sites (solid lines) and the potential transmembrane domain (dashed lines). A putative polyadenylation site is indicated in the 3' untranslated region. The sequences have been submitted to the EMBL sequence database (European Bioinformatics Institute, Hinxton, UK) under the accession number AJ239317.



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 2.   An alignment of derived amino acid sequences of the eel Na,K-ATPase beta 233-isoform compared with other beta 1-isoform sequences. Dashes indicate identical residues and periods indicate spaces introduced to an give optimal alignment. Sequences were aligned using GeneJockey II software (Biosoft). Dashes and periods were added after alignment. The EMBL/Swiss Prot accession numbers for amino acid sequences are as follows: eel beta 1 (P51165)-, human beta 1 (P05026), chicken beta 1 (P08251), Bufo marinus beta 1 (P30715), and Torpedo californica beta (P25029).

The 5' untranslated region also has regions of sequence related to identified Na,K-ATPase promoter elements (Fig. 1). At positions 4 and 20 of the nucleotide sequence there are half sites that are identical to, and share four of six common nucleotides with, the mineralo-/glucocorticoid response element (M/GRE) half sites of the human beta 1-gene (14). At position 10 of the sequence, there is an antisense CCAAT box sequence similar to that found in the rat alpha 3-gene PRE1 element (26). Overlapping with this at position 25, there is a sequence sharing 11 of 12 nucleotides with the region surrounding the adhesion molecule on glia regulatory element (AMRE)/SP1 regulatory element found in the promoter of the rat beta 2-gene (18).

Eel beta 233-mRNA expression. Tissue Northern blot analysis of beta 233-mRNA expression (Fig. 3) revealed two transcript sizes of 2.4 and 1.2 kb. High levels of expression of the 2.4-kb transcript were found in the intestine with intermediate levels in kidney, brain, and gill and low levels in eye, spleen, and esophagus. Expression of the 1.2-kb transcript was found predominately in the intestine, with low levels also present in kidney and gill tissue samples. Results from the cloning experiments suggest that the 3' RACE products that were cloned represent copies of the 1.2-kb transcript, whereas the longer 3' RACE product obtained, which failed to clone, was likely to represent the 2.4-kb transcript.


View larger version (83K):
[in this window]
[in a new window]
 
Fig. 3.   Northern blot of beta 233-mRNA expression in 5 µg total RNA samples from tissues of yellow eels acclimated to SW for 3 wk. The sizes of mRNA transcripts are indicated in kb.

To determine whether the beta 233-mRNA expression was effected by SW acclimation, yellow eels were acclimated to various environmental salinities. Semiquantitative Northern blots of gill total RNA samples indicated that the level of beta 233-mRNA expression was not markedly different in FW, 33% SW, and SW-acclimated eels, but considerably higher levels of expression were found in eels acclimated to 200% SW (Fig. 4). The levels of beta 233-mRNA expression were further investigated in the gill, intestine, and kidney of both yellow and silver stages of the adult eel's life cycle. This study (Fig. 5) demonstrated that the level of beta 233-mRNA expression in the kidney, gill, or intestine of yellow eels was not significantly different following SW acclimation. In contrast, in silver eels, beta 233-mRNA expression was significantly increased in all three tissues (kidney, +93%; gill, +208%; intestine, +79%) following SW acclimation. The increase in gill beta 233-mRNA abundance was associated with significant increases in both the 1.2 (+301%)- and 2.4-kb (+149%) transcript sizes, whereas increases in the kidney and intestine beta 233-expression were associated only with significant increases in the larger 2.4-kb transcript (+93% and +82%, respectively).


View larger version (58K):
[in this window]
[in a new window]
 
Fig. 4.   Northern blot of beta 233-mRNA expression in 5 µg total RNA samples from the gills of yellow eels adapted to freshwater (FW), 33% seawater (SW), SW, and 200% SW. Samples were extracted from 3 fish in each category. The sizes of mRNA transcripts are indicated in kb.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   Quantification of Na,K-ATPase beta 233-isoform mRNA abundance in total RNA samples (10 µg) from the gills, intestines, and kidneys of yellow and silver adult eels adapted to FW or SW. The abundance of both the 2.4 (A)- and 1.2-kb (B) transcript sizes were measured in samples from 6 fish in each category. Statistical significance was determined using ANOVA and Scheffé's F post ad hoc testing with StatView 4.01 (ABACUS concepts) software. Significance of FW-to-SW comparisons are indicated; * significant at the 5% level (P < 0.05), ** significant at 1% level (P < 0.01), and *** significant at the 0.1% level (P < 0.001). Error bars, SE.

Eel beta 233-protein expression and localization. The beta 233-specific antiserum was used for Western blotting in tissue homogenates and purified membrane fractions from gill and intestine. Western blots using the beta 233-antiserum and membrane fractions from the intestine of either FW- or SW-acclimated eels resulted in the appearance of a strongly staining but diffuse band ranging between 40 and 52 kDa (Fig. 6). A similar sized diffuse band was found with membrane fractions isolated from the gill (results not shown). After overnight digestion of the intestinal membrane fractions with NGF, there was a partial rearrangement in the molecular size of the 40- to 52-kDa proteins into three major components with mean molecular masses of 47, 39, and 33.5 kDa (Fig. 6), indicating that the immunoreactive proteins are indeed glycosylated. Again, similar results were obtained with gill membrane fractions after NGF treatment (results not shown). The specific antiserum was also used for immunohistochemistry in both gill and intestinal tissue sections. Antibody incubations with branchial sections demonstrated labeling of large cells within the interlamellar regions of the filamental epithelium (Fig. 7A), which correlate exactly to the classically described location of the so-called "mitochondrial-rich ionocytes" or "chloride cells" (34). Incubation of branchial sections with antibody preblocked with peptide antigen (or preimmune serum; data not shown) revealed no equivalent staining (Fig. 7C). Similar experiments were also performed with sections from the intestine. Immunostaining was observed across the basolateral surfaces of columnar epithelial cells that cover most of the luminal surface of the intestine (Fig. 7B). However, very little immunoreactivity was observed in the underlying cell layers. Again, intestinal sections were incubated with antibody preblocked with peptide antigen, and this produced a substantial reduction in peroxidase staining compared with normal antibody incubations (Fig. 7D).


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 6.   Western blot using membrane fractions produced from eel intestinal eptithelial scrapes. Lane A: 5 µg of protein from the 35-43% sucrose fraction; lane B: 5 µg of the 35-43% sucrose fraction protein following NGF treatment. The blot was incubated with polyclonal antisera raised against a multiple antigen peptide (MAP) derived from the beta 233-amino acid sequence. Sizes are indicated in kDa.



View larger version (149K):
[in this window]
[in a new window]
 
Fig. 7.   Immunohistochemical staining of eel branchial and intestinal sections. A: a longitudinal section through a gill filament (×400) incubated with beta 233-polyclonal antisera, showing the primary epithelium (pe) and secondary lamellae (sl) with stained chloride cells (cc) and counterstained nuclei (n). B: transverse section across the midintestine (×250) showing a portion of a luminal epithelial fold incubated with beta 233-polyclonal antisera. Staining is apparent in columnar epithelial (ce) cells that line the intestinal lumen (il). C: longitudinal section through a gill filament (×250) incubated with beta 233-polyclonal antisera preblocked with 50 µg/ml beta 233-MAP peptide antigen. D: transverse section across the midintestine (×250) incubated with beta 233-polyclonal antisera preblocked with 40 µg/ml beta 233-MAP peptide antigen.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Unlike that found with the eel beta 1-isoform, the beta 233-isoform shares highest levels of nucleotide and amino acid homology with mammalian (62.7-64.3% and 58.0-60.0%, respectively) rather than amphibian beta 1-isoforms (59.1-59.4% and 56.4-58.0%, respectively), although the significance of this is unclear (see Fig. 2). The high level of nucleotide (74.8%) and amino acid (69.9%) homology shared by the beta 233- and the eel beta 1-sequence suggests that these isoforms are gene duplicates.

The gene duplication of the beta 1-isoform in eels may represent an isolated event. However, recent studies have suggested that two polyploidization events occurred early in the evolution of ray-finned fishes either before or after the divergence of the fish and mammalian lineages (27, 32). The beta 233-sequence may therefore have formed as a result of a wider genomic duplication event. It is consequently also possible that the beta 233-gene may be the homolog of a mammalian protein, with which it would be expected to share high levels of homology. A duplicate beta 1-gene is present within the mammalian genome; however, this is thought to represent a nonfunctional genomic pseudogene (20, 30). The lower level of nucleotide homology that the beta 233-sequence shares with the human beta 1-pseudogene (58.8%), compared with the same region of the human beta 1-gene (63.5%), suggests that it may not be a homolog of this gene (the eel beta 1-sequence also shares lower levels of homology with the human beta 1-pseudogene), although the lower levels of homology may also be explained by a faster rate of mutation in the pseudogene because it became nonfunctional. As the beta 233-isoform is expressed both at the mRNA and protein levels, this also argues against the beta 233-being a direct counterpart of the pseudogene found in humans.

Unlike other vertebrate beta 1-isoform sequences, the eel beta 1- and beta 233-isoforms share significant amounts of homology in the 5' (57.6%) untranslated region. However, the beta 233-isoform has several insertions relative to the beta 1-sequence. The 5' untranslated region of the beta 233-cDNA also has several sequences that are homologous to transcriptional promoter regulatory elements normally found upstream of the transcription initiation sites of other Na,K-ATPase genes (see Fig. 1). These sequences are not found in the comparable region of the eel beta 1-cDNA (12). As these elements are located in the 5' untranslated region, it is unclear whether these promoter-like elements serve any purpose. The first putative element shares high levels of homology (11 of 12 nucleotides) with the AMRE/SP1 regulatory element sequence found in the promoter of the rat Na,K-ATPase beta 2-gene (AGGAGGCGGGGT; see Ref. 18). However, the single nucleotide difference is located within the core region of the SP1 binding site sequence (GCGG, whereas the beta 233-sequence has GGGG), and so it is unclear whether this sequence could function as an SP1 binding site. Other putative regulatory elements are an anti-sense CCAAT box sequence, similar to that found in the rat alpha 3-gene PRE1 element (26), and a possible M/GRE region, which has an imperfect (nonexact inverted repeat) half site (TGTCCT) identical to the M/GRE of the human beta 1-gene (14). The other potential half site of the M/GRE (GGAGCA) is spaced 10 nucleotides away from the first half site but shares only four of six common nucleotides with the human beta 1-sequence. The teleost fish glucocorticoid receptor (GR) has an extra nine amino acids inserted between the DNA-binding zinc finger domains (15), suggesting that fish GRs may bind half sites that are further apart than the consensus spacing of three nucleotides apart in other vertebrate species (31). If any of these putative regulatory elements in the 5' untranslated region of the eel beta 233-gene are functional, as they are downstream of the transcription start site, their most likely role would be to inhibit transcription. However, an inhibitory M/GRE in this position could be difficult to reconcile because in teleost fish, cortisol is known to stimulate Na,K-ATPase activity (24). Another possible explanation for the presence of putative regulatory element sequences in the 5' untranslated region is that at one point earlier in the evolution of the gene, the transcription start site was further downstream, and, consequently, they were located within the promoter region at that time.

The tissue-specific distribution of beta 233-mRNA (Fig. 3) shows a restricted pattern of expression compared with that of the eel beta 1-isoform (12). In particular, the levels of beta 233-expression in eye, esophagus, pancreas, spleen, and ovary are absent or very much reduced compared with the level of beta 1-expression in these tissues. The other notable point is that there is no beta 233-expression in liver, heart, or skeletal muscle tissues. Although there are very faint signals for beta 1-mRNA expression in eel skeletal muscle, no other beta -subunits have so far been identified in these tissues (9, 10, 12).

The level of both eel gill alpha 1- and beta 1-mRNA abundance has been shown to be modulated by adaptation to differing salinities, with increases in expression following acclimation of adult FW eels to SW or 200% SW environments (11, 12, 22). In contrast to this, the levels of branchial beta 233-mRNA expression (Fig. 4) show a different pattern of expression. Visible increases in branchial beta 233-expression were only found after acclimation of FW eels to the 200% SW environment, expression being essentially the same in FW, 33% SW, and SW environments.

Eels have two morphologically distinct developmental stages in the adult phase of their life cycle. They begin adult life as sexually immature yellow eels, which predominate in FW environments. After an indeterminate period of time, yellow eels metamorphose into the sexually maturer silver eels, which migrate back to the marine environment where they may return to the Sargasso sea to breed. Quantitative expression of beta 233-mRNAs was further evaluated at these two developmental stages of the adult eel's life cycle (Fig. 5). The levels of beta 233-mRNA expression in the gill, intestine, and kidney of yellow eels were not significantly elevated 3 wk after FW-to-SW transfer. However, in the developmentally maturer silver eel, significant increases in expression were found in all three tissues following a similar period of SW acclimation. In previous studies, the levels of alpha 1- and beta 1-isoform mRNAs have been found to increase in both yellow and silver eels following SW acclimation (data not shown). The complexity of the situation is further increased by the existence of two transcript sizes of 1.2 and 2.4 kb. The separate analysis of changes in beta 233-expression for each transcript reveals that significant increases in expression are found in all three tissues for the larger transcript (2.4 kb), but a significant increase in expression of the smaller transcript (1.2 kb) was only found in the branchial tissue of silver eels. This differential tissue-specific regulation of the expression of smaller beta 233-mRNA transcripts suggests that the extra sequence information contained within the 3' untranslated region of larger mRNA species may have some functional significance.

The 3' untranslated region of the beta 233-sequence (1.2-kb transcript) shares nucleotide homology with a comparable region of the eel beta 1-isoform (68.4%), although no significant homology to mammalian beta 1-sequences is evident. However, the smaller beta 233-transcript does not possess the highly homologous regions found further downstream within the 3' region of all vertebrate beta 1 cDNAs (33). It has been speculated that this region may be involved in modulating mRNA stability (29), but no further evidence to support this is available. Interestingly both mammalian beta 2- and beta 3-isoforms, but not the H,K-ATPase beta -isoform, have distinct highly conserved sequences within their 3' untranslated regions (data not shown). It will be interesting to discover whether the longer (2.4 kb) beta 233-transcript contains a comparable homologous region.

Results from Western blotting experiments demonstrated that the beta 233-protein is functionally expressed in both gill and intestine. The diffuse immunoreactive bands produced on these blots (40-52 kDa), which were of somewhat larger size than that predicted from the derived amino acid sequence (35 kDa), were sensitive to the enzyme NGF, suggesting that the protein is likely to be variably glycosylated, as is normally the case for Na,K-ATPase beta -subunits (7). It is possible that the range in the size of immunoreactive bands following NGF treatment may reflect the incomplete removal of all carbohydrate groups associated with the beta 233-protein. Localization studies, using the beta 233-specific antibody also demonstrated that this duplicate of the beta 1-gene is also expressed at high levels within the large cells found in the interlamellar regions of the branchial epithelium, which are presumed to represent chloride cells. In addition to this, the expression of the beta 233-isoform was also localized to the basolateral surfaces of columnar epithelial cells lining the lumen of the intestine. These observations suggest that the beta 233-isoform is an integral component of the Na,K-ATPase enzyme that is expressed in the ionoregulatory cells of both the branchial and intestinal epithelia. It is therefore possible that this isoform of the beta -subunit may have an important functional role in the major osmoregulatory tissues of the eel when fish are acclimated to either the FW or SW environments.

In summary, a duplicate copy of the Na,K-ATPase beta 1-isoform (called beta 233) has been identified by homology cloning in the European eel (Anguilla anguilla). Expression of this isoform has been demonstrated in a number of osmoregulatory tissues and has been localized to chloride and columnar cells within the branchial and intestinal epithelia, respectively. Northern blot studies of beta 233-mRNA expression show that, although expression of this duplicate in the osmoregulatory tissues of FW eels can be induced by SW acclimation, this response is dependent on the developmental stage of the fish.

Perspectives

The hypothesis that fish genomes have undergone ancient polyploidization events resulting in the production of duplicate copies of some but not all genes has potentially large implications for fish physiology. This theory not only presents a plausible explanation as to why there was a considerable evolutionary diversification and expansion of the number of teleost fish species, but may also explain why teleosts have been able to exploit and adapt to differing environmental conditions so successfully. Of particular interest in this study is the underlying possibility that the retention or loss of certain gene duplicates within the genome may explain the ability of some teleost species to adapt to differing ionic environments. Is it possible that stenohaline marine or FW teleosts have lost key osmoregulatory genes that allow movement between these two environments? Likewise have euryhaline teleosts, like the eel, retained important gene duplicates that allow osmoregulatory plasticity?

Another important aspect of genome duplication is whether differences between gene duplicates are conserved between teleost fish species. After duplication, teleost genomes presumably contained two identical copies, which in the case of the eel beta 1- and beta 233-sequences, subsequently developed differences in sequence and possibly function and regulation. However, although these differences may have developed in a common ancestral teleost species, suggesting that recognizable beta 1- and beta 233-counterparts may be present in other teleost species, it is also possible that a different set of changes has occurred in other species; in which case, each pair of beta 1-duplicates may have developed different functions and patterns of regulation, with "beta 1-like" sequences quite distinct from those of the eel beta 1- and beta 233-isoforms.


    ACKNOWLEDGEMENTS

This study was supported by grants from the Wellcome Trust and the Natural Environment Research Council.


    FOOTNOTES

Address for reprint requests and other correspondence: C. Cutler, Bute Medical Bldg.s, School of Biology, Univ. of St Andrews, St Andrews, Fife, Scotland KY16 9TS, UK (E-mail:-cpc{at}st-and.ac.uk).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Received 12 May 1999; accepted in final form 9 February 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Appel, C, Gloor S, Schmalzing G, Schachner M, and Bernhardt RR. Expression of a Na,K-ATPase beta 3 subunit during development of the Zebrafish central nervous system. J Neurosci Res 46: 551-564, 1996[Web of Science][Medline].

2.   Beguin, P, Wang X, Fursov D, Puoti A, Claeys D, Horisberger J-D, and Geering K. The gamma  subunit is a specific component of the Na,K-ATPase and modulates its transport function. EMBO J 16: 4250-4260, 1997[Web of Science][Medline].

3.   Blanco, G, and Mercer RW. Isozymes of the Na-K-ATPase: heterogeneity in structure, diversity in function. Am J Physiol Renal Physiol 275: F633-F650, 1998[Abstract/Free Full Text].

4.   Caplan, MJ. Gastric H+/K+-ATPase: targeting signals in the regulation of physiologic function. Curr Opin Cell Biol 10: 468-473, 1998[Web of Science][Medline].

5.   Chomczynski, P, and Mackey K. Modification of the TRI Reagent procedure for the isolation of RNA from polysaccharide- and proteoglycan-rich sources. Biotechniques 19: 942-945, 1995[Web of Science][Medline].

6.   Chomczynski, P, and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987[Web of Science][Medline].

7.   Chow, DC, and Forte JG. Functional significance of the beta -subunit for heterodimeric P-type ATPases. J Exp Biol 198: 1-17, 1995[Abstract].

8.   Codina, J, Delmas-Mata JT, and Dubose TD, Jr. The alpha -subunit of the colonic H+,K+-ATPase assembles with beta 1-Na+,K+-ATPase in kidney and distal colon. J Biol Chem 273: 7894-7899, 1998[Abstract/Free Full Text].

9.   Cutler, CP, Sanders IL, and Cramb G. Expression of Na+,K+-ATPase beta  subunit isoforms in the European eel (Anguilla anguilla). Fish Physiol Biochem 17: 371-376, 1997.

10.   Cutler, CP, Sanders IL, and Cramb G. Isolation of six putative P-type ATPase beta  subunit PCR fragments from the brain of the European eel (Anguilla anguilla). Annals New York Acad Sci 834: 123-125, 1997[Web of Science][Medline].

11.   Cutler, CP, Sanders IL, Hazon N, and Cramb G. Primary sequence, tissue specificity and expression of the Na+,K+- ATPase alpha 1 subunit in the European eel (Anguilla anguilla). Comp Biochem Physiol 111B: 567-573, 1995.

12.   Cutler, CP, Sanders IL, Hazon N, and Cramb G. Primary sequence, tissue specificity and expression of the Na+,K+- ATPase beta 1 subunit in the European eel (Anguilla anguilla). Fish Physiol Biochem 14: 423-429, 1995.

13.   Cutler, CP, Sanders IL, Luke G, Hazon N, and Cramb G. Ion transport in teleosts: identification and expression of ion transporting proteins in the branchial and intestinal epithelia of the European eel (Anguilla anguilla). In: Gene Expression and Manipulation in Aquatic Organisms, Society of Experimental Biologists, Seminar Series 58, edited by Ennion SJ, and Goldspink G.. Cambridge, UK: Cambridge University Press, 1996, p. 43-74.

14.   Derfoul, A, Robertson NM, Lingrel JB, Hall DJ, and Litwack G. Regulation of the human Na/K-ATPase beta 1 gene promoter by mineralocorticoid and glucocorticoid receptors. J Biol Chem 273: 20702-20711, 1998[Abstract/Free Full Text].

15.   Ducoret, B, Tujague M, Ashraf J, Mouchel N, Servel N, Valotaire Y, and Thompson EB. Cloning of a teleost fish glucocorticoid receptor shows that it contains a deoxyribonucleic acid-binding domain different from that of mammals. Endocrinol 136: 3774-3783, 1995[Abstract].

16.   Hames, BD. One dimensional polyacrylamide gel electrophoresis. In: Gel Electrophoresis of Proteins: A Practical Approach (2nd ed.), edited by Hames BD, and Rickwood D.. Oxford, UK: Oxford University Press, 1996, p. 1-147.

17.   Horisberger, JD, Jaunin P, Reuben MA, Lasater LS, Chow DC, Forte JG, Sachs G, Rossier BC, and Geering K. The H,K-ATPase beta -subunit can act as a surrogate for the beta -subunit of Na,K-pumps. J Biol Chem 266: 19131-19134, 1991[Abstract/Free Full Text].

18.   Kawakami, K, Suzuki-Yagawa Y, Watanabe Y, and Negano K. Identification and characterisation of the cis-elements regulating the rat AMOG (Adhesion Molecule On Glia)/Na,K-ATPase beta 2 subunit gene. J Biochem 111: 515-522, 1992[Abstract/Free Full Text].

19.   Laemmli, UK. Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature 227: 680-685, 1970[Medline].

20.   Lane, LK, Shull MM, Whitmar KR, and Lingrel JB. Characterisation of two genes for the human Na,K-ATPase beta  subunit. Genomics 5: 445-453, 1989[Web of Science][Medline].

21.   Lee, T-H, Tsai J-C, Fang M-J, Yu M-J, and Hwang P-P. Isoform expression of Na+-K+-ATPase alpha -subunit in gills of the teleost Orechromis mossambicus. Am J Physiol Regulatory Integrative Comp Physiol 275: R926-R932, 1998[Abstract/Free Full Text].

22.   Luke, GA, Cutler CP, Sanders IL, Hazon N, and Cramb G. Branchial Na+/K+-ATPase expression in the European eel (Anguilla anguilla) following saltwater acclimation. In: The Sodium Pump: Structure, Mechanism, Hormonal Control and Its Role in Disease, edited by Bamberg E, and Schoner W.. Darmstadt, Germany: Steinkopff, 1994, p. 246-249.

23.   McCartney, S, and Cramb G. Effects of a high-salt diet on hepatic atrial natriuretic peptide receptor expression in Dahl salt-resistant and salt-sensitive rats. J Hypertens 11: 253-262, 1993[Web of Science][Medline].

24.   McCormick, SD. Hormonal control of gill Na+,K+-ATPase and chloride cell function. In: Cellular and Molecular Approaches to Fish Ionic Regulation. Fish Physiology, edited by Woods CM, and Shuttleworth TJ.. New York: Academic, 1995, vol. 14, p. 285-315.

25.   Møller, JV, Juul B, and Le Maire M. Structural organisation, ion transport, and energy transduction of P-type ATPases. Biochim Biophys Acta 1286: 1-51, 1996[Medline].

26.   Murakami, Y, Ikeda U, Shimada K, and Kawakami K. Promoter of the Na,K-ATPase alpha 3 subunit gene is composed of cis elements to which NF-Y and SP1/SP3 bind in rat cardiocytes. Biochim Biophys Acta 1352: 311-324, 1997[Medline].

27.   Postlethwait, JH, Yan YL, Gates MA, Horne S, Amores A, Brownlie A, Donovan A, Egan ES, Force A, Gong ZY, Goutel C, Fritz A, Kelsh R, Knapik E, Liao E, Paw B, Ransom D, Singer A, Thomson M, Abduljabbar TS, Yelick P, Beier D, Joly JS, Larhammar D, Rosa F, Westerfield M, Zon LI, Johnson SL, and Talbot WS. Vertebrate genome evolution and the zebrafish gene map. Nature Genet 18: 345-349, 1998[Web of Science][Medline].

28.   Pressley, TA. Phylogenetic conservation of isoform-specific regions within alpha -subunit of Na+-K+-ATPase. Am J Physiol Cell Physiol 262: C743-C751, 1992[Abstract/Free Full Text].

29.   Taormino, JP, and Fambrough DM. Effect of deletions in the 3' untranslated region of the beta 1-subunit mRNA on mRNA stability (Abstract). J Gen Physiol 96: 24a, 1990.

30.   Ushkaryov Yu, A, Monastyrskaya GS, Broude NE, Nikiforova NN, Bessarab DA, Yu M., Orlova Petrukhin KE, Modyanov NN, and Sverdlov ED. Human Na+,K+-ATPase genes. beta -subunit gene family contains at least one gene and one pseudogene. FEBS Lett 257: 439-442, 1989[Web of Science][Medline].

31.   Weigel, NL. Steroid hormone receptors and their regulation by phosphorylation. Biochem J 319: 657-667, 1996.

32.   Wittbrodt, J, Meyer A, and Schartl M. More genes in fish? Bioessays 20: 511-515, 1998[Web of Science].

33.   Young, RM, Shull GE, and Lingrel JB. Multiple mRNAs from rat kidney and brain encode a single Na+,K+-ATPase beta  subunit protein. J Biol Chem 262: 4905-4910, 1987[Abstract/Free Full Text].

34.   Zadunaisky, JA. The chloride cell: the active transport of chloride and the paracellular pathways. In: Gills. Part B. Ion and water transfer. Fish Physiology, edited by Hoar WS, and Randall DJ.. New York: Academic, 1984, vol. 10, p. 129-176.


Am J Physiol Regul Integr Comp Physiol 279(1):R222-R229
0363-6119/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
J. Exp. Biol.Home page
S. S. Madsen, P. Kiilerich, and C. K. Tipsmark
Multiplicity of expression of Na+,K+-ATPase {alpha}-subunit isoforms in the gill of Atlantic salmon (Salmo salar): cellular localisation and absolute quantification in response to salinity change
J. Exp. Biol., January 1, 2009; 212(1): 78 - 88.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
S. Kalujnaia, I. S. McWilliam, V. A. Zaguinaiko, A. L. Feilen, J. Nicholson, N. Hazon, C. P. Cutler, and G. Cramb
Transcriptomic approach to the study of osmoregulation in the European eel Anguilla anguilla
Physiol Genomics, November 14, 2007; 31(3): 385 - 401.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Grosell, K. M. Gilmour, and S. F. Perry
Intestinal carbonic anhydrase, bicarbonate, and proton carriers play a role in the acclimation of rainbow trout to seawater
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R2099 - R2111.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A.-S. Martinez, C. P. Cutler, G. D. Wilson, C. Phillips, N. Hazon, and G. Cramb
Regulation of expression of two aquaporin homologs in the intestine of the European eel: effects of seawater acclimation and cortisol treatment
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2005; 288(6): R1733 - R1743.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
D. H. Evans, P. M. Piermarini, and K. P. Choe
The Multifunctional Fish Gill: Dominant Site of Gas Exchange, Osmoregulation, Acid-Base Regulation, and Excretion of Nitrogenous Waste
Physiol Rev, January 1, 2005; 85(1): 97 - 177.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
C. P. Cutler and G. Cramb
Branchial expression of an aquaporin 3 (AQP-3) homologue is downregulated in the European eel Anguilla anguilla following seawater acclimation
J. Exp. Biol., September 1, 2002; 205(17): 2643 - 2651.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
J.-H. Lignot, C. P. Cutler, N. Hazon, and G. Cramb
Immunolocalisation of aquaporin 3 in the gill and the gastrointestinal tract of the European eel Anguilla anguilla (L.)
J. Exp. Biol., September 1, 2002; 205(17): 2653 - 2663.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
J.-M. Chen, C. Cutler, C. Jacques, E. Denamur, G. Lecointre, B. Mercier, G. Cramb, and C. Ferec
A Combined Analysis of the Cystic Fibrosis Transmembrane Conductance Regulator: Implications for Structure and Disease Models
Mol. Biol. Evol., September 1, 2001; 18(9): 1771 - 1788.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (30)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cutler, C. P.
Right arrow Articles by Cramb, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cutler, C. P.
Right arrow Articles by Cramb, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online