|
|
||||||||
Departments of 1 Biological Sciences, 3 Molecular Biology and Biochemistry, and the 2 Cardiac Membrane Research Laboratory, Simon Fraser University, Burnaby, British Columbia V5A 1S6, Canada
| |
ABSTRACT |
|---|
|
|
|---|
A reduction in
temperature lowers the Ca2+ sensitivity of skinned cardiac
myofilaments but this effect is attenuated when native cardiac troponin
C (cTnC) is replaced with skeletal TnC. This suggests that
conformational differences between the two isoforms mediate the
influence of temperature on contractility. To investigate this
phenomenon, the functional characteristics of bovine cTnC (BcTnC) and
that from rainbow trout, Oncorhynchus mykiss, a cold water
salmonid (ScTnC), have been compared. Rainbow trout maintain cardiac
function at temperatures cardioplegic to mammals. To determine whether
ScTnC is more sensitive to Ca2+ than BcTnC, F27W mutants
were used to measure changes in fluorescence with in vitro
Ca2+ titrations of site II, the activation site.
When measured under identical conditions, ScTnC was more sensitive to
Ca2+ than BcTnC. At 21°C, pH 7.0, as indicated by
K1/2 (
log[Ca] at half-maximal fluorescence,
where [Ca] is calcium concentration), ScTnC was 2.29-fold more
sensitive to Ca2+ than BcTnC. When pH was kept constant
(7.0) and temperature was lowered from 37.0 to 21.0°C and then to
7.0°C, the K1/2 of BcTnC decreased by 0.13 and
0.32, respectively, whereas the K1/2 of ScTnC
decreased by 0.76 and 0.42, respectively. Increasing pH from 7.0 to 7.3 at 21.0°C increased the K1/2 of both BcTnC and ScTnC by 0.14, whereas the K1/2 of both isoforms
was increased by 1.35 when pH was raised from 7.0 to 7.6 at 7.0°C.
calcium affinity; fluorescence; contractility
| |
INTRODUCTION |
|---|
|
|
|---|
CONTRACTION OF STRIATED MUSCLE is initiated by the binding of Ca2+ to troponin C (TnC), a troponin subunit located on the thin filament, triggering a series of structural alterations through the components of the thin filament. This cascade of reactions culminates in cross-bridge cycling between actin and myosin and force generation by the cell. Mammalian cardiac and slow skeletal muscle contain the cardiac isoform of TnC (cTnC), which consists of two homologous, globular domains each containing two possible Ca2+ binding sites. The NH2-terminal, regulatory domain contains sites I and II, whereas the COOH-terminal domain contains sites III and IV. The regulatory domain of cTnC contains only a single functional Ca2+ binding site (site II), as the Ca2+ coordinating characteristics of site I have been disrupted through changes in protein sequence. Therefore the binding of Ca2+ to site II is believed to be solely responsible for initiating the conformational response and triggering cardiac myofilament contraction (32, 33). Sites III and IV in the COOH terminus, or high-affinity domain, bind either Ca2+ or Mg2+ and remain saturated with these divalent metals under physiological conditions.
A reduction in environmental temperature reduces the maximum Ca2+-activated force (Cmax) in cardiac muscle and reduces the sensitivity of the contractile element to calcium concentration ([Ca2+]) (5, 19, 21, 40). However, replacement of native cTnC with mammalian skeletal TnC (sTnC) in rat cardiac muscle relieves the desensitizing effect of low temperature on contractility (20), suggesting that differences in the structures of cTnC and sTnC affect the impact of temperature on cardiomyocyte Ca2+ sensitivity.
Insight into the specific molecular mechanisms by which temperature affects cTnC structure may be determined by looking at the structure/function of cTnC isoforms from ectothermic species such as the rainbow trout (Oncorhynchus mykiss), a salmonid fish that remains active at temperatures (5-21°C) that are cardioplegic to mammalian species. One adaptive feature of the salmonid heart may be its contractile element sensitivity to Ca2+. Over physiological temperatures, Ca2+ sensitivity of salmonid cardiac myofibrils is much greater than those isolated from rat (6) and other mammals.
The purpose of this study is to determine whether the differences in
primary structure between BcTnC and ScTnC result in differences in the
Ca2+ sensitivity of the two molecules. If ScTnC is more
sensitive to Ca2+ than BcTnC, then this result would
suggest that cTnC is at least partially responsible for the differences
in the Ca2+ sensitivity between intact salmonid and
mammalian cardiac myofibrils. To accomplish this, Ca2+
binding to site II in these two cTnC isoforms was measured in solution
over a range of temperatures (7-37°C) using F27W mutants of
BcTnC and ScTnC. We have previously shown that the tryptophan acts as a
fluorescent reporter of Ca2+ binding to site II
(28). In mammals, cardiac temperature and intracellular pH
are homeostatically regulated at ~37.0°C and 7.0, respectively.
However, in poikilotherms, as body temperature changes so does blood
and tissue pH to keep the relative alkalinity ([OH
]/[H+]) approximately constant. The
observed relationship, called
-stat regulation, is
0.016 to
0.019 pH units/°C. To determine the effects of such pH regulation
on Ca2+ affinity, measurements were made under two
different pH regimes. In the first, pH was kept at 7.0 under all
temperatures measured and, in the second, pH was allowed to vary in an
-stat manner. In the
-stat experiments pH was 7.0, 7.3, and 7.6 at 37.0°C, 21.0°C, and 7.0°C, respectively.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of BcTnC and ScTnC F27W mutants. Replacement of the phenylalanine at residue 27 with a tryptophan was done in both the bovine and salmonid cTnC cDNA that was cloned into pET-23a vectors (Novagen, Mississauga, ON, Canada) using the Quick Change Site Directed Mutagenesis Kit (Stratagene, La Jolla, CA). In brief, the parental wild-type plasmids containing gene inserts were used as templates for the extension of sense and antisense oligonucleotide primers. Primers contained the tryptophan point mutation, and amplification was done using Pfu DNA polymerase (Stratagene) and temperature cycling. The sequences of the oligonucleotide primers were as follows: ScTnC sense, CGGCCTTTGACATCTGGATCCAG; ScTnC antisense, CTCCGCATCCTGGATCCAGATGT; BcTnC sense, GCTGCCTTCGACATCTGGGTGCT; BcTnC antisense, CTCTGCCCCCAGCACCCAGATGT. Cassettes (358 nucleotides) containing the mutation were then cut out of the plasmids using the restriction enzymes Xba I and Bsm I (New England Biolabs, Mississauga, ON). Following digestion, the cassette and plasmid were purified by gel electrophoresis using low-melting-point agarose. The bands corresponding to the correct size of nucleotide sequence were cut from the gel and purified using phenol/chloroform and ethanol/sodium acetate precipitation. Products were then ligated using T4 DNA ligase (GIBCO BRL, Life Technologies, Gaithersburg, MD). The nucleotide sequences of the two newly mutated plasmids were confirmed by sequencing. From this point on, BcTnC will refer to F27WBcTnC, whereas ScTnC will refer to F27WScTnC.
Subcloning into pGex for protein expression. For protein expression, the mutated cTnC cDNAs were subcloned into the pGex expression vector from Pharmacia Biotech (Baie d'Urfé, QC, Canada) and expressed in the Escherichia coli strain BL21(DE3) (Novagen) as glutathione-S-transferase (GST) fusion proteins. BamH I and EcoR I restriction sites were engineered, respectively, onto the 3' and 5' ends of the BcTnC gene, thereby allowing directional cloning of the cDNA into pGex. Similarly, Sma I and EcoR I sites were added, respectively, to the 3' and 5' ends of ScTnC. The pET plasmids containing the insert were used as templates for the extension of a 5' sense primer and a 3' antisense primer, with each containing the appropriate restriction sites, using Accurase DNA polymerase (DNmp, Farnborough Hants, UK) and temperature cycling. The oligonucleotide primers used were as follows: ScTnC, 3'-TCACCCGGGAATCGAAGGTCGTATGAACGACATCTACAAAGCCGCGG; BcTnC, 3'-TCAGGATCCATCGAAGGTCGTATGGATGACATCTATAAGGCGGCGG; 5' antisense for both inserts, TGCGAATTCTTATTCTACTCCTTTCATGAACTC. After PCR, amplification and mutagenesis the products were purified using ethanol/sodium acetate precipitation, dissolved in HPLC-grade water, and then digested using the appropriate combination of restriction enzymes. Aliquots of pGex vector were also digested with the corresponding restriction enzymes [BamH I and EcoR I (Pharmacia Biotech) for BcTnC; Sma I (GIBCO BRL) and EcoR I for ScTnC]. After digestion reactions reached completion, inserts and vector were purified by gel electrophoresis using low-melting-point agarose followed by phenol/chloroform and ethanol/sodium-acetate precipitation. The inserts were then ligated into the appropriately digested vector using T4 DNA ligase (Stratagene). Following ligation, the sequence of the insert was confirmed at the University of British Columbia, Nucleic Acid/Protein Service Unit (Vancouver, BC) using AmpliTaq Dye Terminator Cycle Sequencing.
Expression and digestion of GST-cTnC fusion protein.
The pGex vectors containing the ScTnC and BcTnC inserts were
transformed into the E. coli strain BL21 for protein
expression. The fusion protein GST-cTnC was expressed and purified
according to the manufacturer's recommendations. In brief, 15 ml of
bacto-tryptone and yeast extract (TY) media plus ampicillin
(100 µM final concentration) were inoculated with the bacteria and
allowed to grow for 4-6 h to a cell density that gave an
absorbance at 600 nm (A600) of 0.6. This culture served as
an inoculum for flasks of 1.5 l of TY plus ampicillin. Once
inoculated, the culture was grown overnight to an A600 of
0.6-0.8, then isopropyl-1-thio-
-D-galactoside
(IPTG) was added to a final concentration of 0.1 mM to induce
expression of the fusion protein GST-cTnC. After 6 h, the cells
were precipitated from the culture supernatant by centrifugation (7,700 g for 10 min). Cell pellets were stored frozen at
20°C
until needed.
20°C until needed.
The identities of ScTnC and BcTnC were confirmed as follows. Each
protein was electrophoresed on a SDS-page gel and then electroblotted onto a polyvinylidene difluoride membrane. Putative mutants of F27WcTnC
were analyzed for total amino acid content, and the first 5 amino acids
from the amino terminal end of the isolated protein were determined by
microsequencing at the University of Victoria Protein Chemistry Center
(Victoria BC). Collectively, these tests confirmed the identity of both
ScTnC and BcTnC.
Solutions used in fluorescence studies.
The program MaxChelator 6.5 (4) was used to estimate the
pCa (
log[Ca2+]) under all conditions at which
fluorescence of the cTnC isoforms was to be measured (buffer
composition, temperature, pH). To calculate the initial pCa and the
change in pCa of the solutions during Ca2+ titration, the
apparent Ca2+ affinity constants
(K'Ca) of EGTA were determined under all
conditions at which fluorescence of the cTnC isoforms was to be
measured according to Bers et al. (4), using a
Ca2+ electrode. In brief, miniature Ca2+
electrodes, made according to Baudet et al. (3) using the highly specific Ca2+ ligand ETH 129, were calibrated using
Ca2+ standards (Orion Research, Boston, MA) of pCa 2-5
and produced a standard curve with a Nerstian slope of ~29 mV/pCa
unit. The output of the electrode was read with an Orion model EA940
Expandable IonAnalyzer pH meter. Using this standard curve and
Ca2+ solutions containing EGTA, this electrode was accurate
to a pCa of ~8.0. The pCa values of all of the solutions, at the
conditions under which they were to be used, were measured with the
electrode during Ca2+ titration and expressed in mV. These
data along with the corresponding total [Ca2+] values and
Ca2+ electrode calibration data were used to calculate the
concentration of Ca2+ bound to EGTA and the ratio of bound
Ca2+ to free Ca2+ according to the method of
Bers et al. (4). Scatchard plots of these data were used
to determine K'Ca and the actual total EGTA concentration (4). For reasons that are not apparent, electrode stability in one (7°C, pH 7.0) of the five different solutions was not acceptable. The K'Ca
used for this solution was calculated as 0.94 × 106
M
1 by extrapolation from that derived in solutions at
higher temperatures but otherwise under identical conditions (e.g., pH,
buffer, and ionic strength). The temperature coefficient that we
determined was 0.048 × 106 M
1/°C, and
this value compares favorably with that determined by Bers et al.
(4).
|
-stat. For the measurement of Ca2+
binding in the MOPS buffers (pH 7.0), three different recipes were
formulated, and then pH was adjusted to 7.0 at 37.0°C (buffer E), 21.0°C (buffer F), and 7.0°C (buffer
G). One TES buffer was formulated, and then pH was adjusted to 7.0 at 37.0°C (buffer H). The dpK/dT of TES (
0.02 pH
units/°C) is similar to
-stat, so the pH of the TES buffer
adjusted to pH 7.0 at 37.0°C increased accordingly as the temperature
of the buffer was decreased.
Buffers E-H all contained (in mM) 1.0 EGTA, 0.03 CaCl2, 112.0 KCl and 50 of the appropriate buffer at the
appropriate pH (final ionic strength = 150 mM). For buffers
E-G, the concentration of MOPS free acid and its
sodium salt required to equal 50 mM varied according to the temperature
at which the buffer was to be used. The basal pCa values of the
solutions at their respective temperatures were: buffer E,
7.97; buffer F, 7.66; buffer G, 7.36; and
buffer H at 21.0°C was 8.08 and buffer H at
7.0°C was 8.90, reflecting the effects of pH and temperature on the
K'Ca of EGTA.
Preparation of F27WcTnC for fluorescence studies.
Each isoform was dissolved in 6 M urea to a final concentration of 10 mg of lyophilized protein/ml. Samples were immediately diluted with an
equal volume of buffer E. This volume was then aliquoted
into four fractions, and individual fractions were dialyzed against 500 volumes of buffers E-H as appropriate with two changes. The pair of ScTnC and BcTnC isoforms to be measured under the same
conditions was dialyzed simultaneously in the same vessel/buffer. After
dialysis, the proteins were removed from the dialysis bags and stored
frozen at
80°C until required. All plasticware used for the
preparation of proteins and buffers were rinsed with 6 N HCl prior to use.
Fluorescence studies. The cTnC samples were diluted to 2.5 µM with the required buffer in a quartz cuvette (1 cm2). Fluorescence was measured using an SLM Instruments (Urbana, IL) model 4800C spectrofluorometer, which had a NesLab (Portsmouth, NJ) water bath attached to maintain the cuvette at the desired temperature. Compressed air was used to keep the reaction chamber free of moisture to avoid condensation on the cuvette at 7.0°C.
The protein samples were titrated by pipetting Ca2+ stock (0.101 M or 0.051 M) in 1-µl increments into the cuvette containing an active stir bar. After 60 s of mixing, fluorescence was measured over a 10-s period. Pilot studies indicated that the fluorescence emission was stable after 60 s at each pCa. The cuvette was only exposed to the excitation beam for 10 s at each pCa. The maximum number of fluorescence measurements per titration experiment was 16. Fluorescence was measured during Ca2+ titration of the F27WcTnC isoforms using an excitation wavelength of 276 nm and an emission wavelength of 330 nm. The relative fluorescence was calculated as the ratio of the fluorescence of the protein and an internal rhodamine standard. Before the beginning of fluorescence measurements, the current gain setting of each photomultiplier tube of the spectrofluorometer was adjusted so that the relative fluorescence of the Ca2+ saturated cTnC mutants was equal to unity for each isoform under each condition measured (temperature, pH). The resultant spectra of ScTnC at basal and saturating [Ca2+] at 21.0°C pH 7.0 were similar to that published by Moyes et al. (28). The relative fluorescence of ScTnC (21.0°C, pH 7.0) at basal [Ca2+] was 0.83 ± 0.01 (n = 9) and when saturated with [Ca2+] was 1.00 ± 0.01 (n = 9). For BcTnC these values were 0.75 ± 0.01 (n = 10) and 1.01 ± 0.01 (n = 10), respectively. These data demonstrate that the fluorescence of the mutant proteins was stable and that the cTnC was not affected by the brief exposure to the ultraviolet excitation during the titration.Data manipulation and statistical analysis.
The Ca2+-dependent component of the fluorescence
measurements from each titration was determined by subtracting the
fluorescence at basal [Ca2+] from all measurements and
then expressing the resultant values as a percentage of the maximum
fluorescence. Each data set was fitted using a Hill equation with the
program Origin 6.0. (Microcal Software, Northhampton, MA)
|
2, which
was used as a goodness of fit index of the Hill equation to our data,
ranged from 0.0042 ± 0.0005 (ScTnC 7.0°C, pH 7.6) to
0.0002 ± 0.0001 (BcTnC 21.0°C, pH 7.0). Because some of the curves showed deviations from Hill equation predictions, the data were
also fitted with a multi-function two-site binding nonlinear equation
and by interpolation of pCa values at 50% fluorescence from the spline
curve fits (data not shown). The K1/2 values
derived from these two alternative procedures were never more than
0.8% different from those calculated using the Hill equation. The
effects of temperature, pH, and isoform on K1/2
values as determined by the Hill equation curve fitting were analyzed
statistically using a one-way repeated measures ANOVA followed by
Bonferroni post hoc tests using the statistical software package
SigmaStat. The values reported for K1/2 are
expressed as means ± SE in pCa units. Two means were considered
to be significantly different when the P value was less than
0.05.
| |
RESULTS |
|---|
|
|
|---|
Effect of temperature on Ca2+ binding
in BcTnC and ScTnC.
When pH was kept constant (7.0), a reduction in temperature lowered the
Ca2+ sensitivity of both isoforms. The
K1/2 of BcTnC was reduced by 0.13 when
temperature was lowered from 37°C to 21°C and then by 0.32 when
temperature was reduced from 21.0 to 7.0°C (Fig.
1A, Table
2). The K1/2
of ScTnC for Ca2+ was reduced by 0.76 when temperature was
lowered from 37.0 to 21.0°C and then by 0.42 when temperature was
lowered from 21.0 to 7.0°C (Fig. 1B, Table 2). Visual
comparison of the titration curves obtained for ScTnC at 7.0°C, pH
7.0; 21.0°C, pH 7.0; and 37.0°C, pH 7.0, reveals that the curve
obtained at 37.0°C is aberrant (Fig. 1B). The fluorescence
of ScTnC at 37.0°C did not reach an asymptote even at pCa 3.0;
however, it was arbitrarily taken as maximal.
|
|
Effect of pH on Ca2+ binding in BcTnC and ScTnC. When temperature was kept constant at either 21.0°C or 7.0°C, an increase in pH increased the Ca2+ sensitivity of both BcTnC (Fig. 1C, Table 2) and ScTnC (Fig. 1D, Table 2). At 21.0°C the increase in pH from 7.0 to 7.3 increased the K1/2 of Ca2+ binding by 0.14 for both BcTnC and ScTnC (Table 2). At 7.0°C, the increase in pH from 7.0 to 7.6 increased the K1/2 of both BcTnC and ScTnC by 1.35 (Fig. 1D, Table 2). When the titration data were fit with the Hill equation, some of the data were not adequately described by the resultant curves, particularly at the higher pCa values. More specifically, the fluorescence of ScTnC appears to be non-Hillian as Ca2+ increases from pCa 8 to ~6.5 at 21.0°C, pH 7.3, and 7.0°C, pH 7.6 (Fig. 1F).
Effect of pH and temperature on Ca2+
binding in BcTnC and ScTnC.
When temperature was decreased from 37.0 to 21°C and pH was increased
according to
-stat regulation (pH 7.0
7.3), the affinity of
BcTnC for Ca2+ did not change (Fig. 1E, Table
2). However, the K1/2 of BcTnC was increased by
0.89 when temperature was decreased from 21.0 to 7.0°C and pH was
increased from 7.3 to 7.6 (Table 2). The K1/2 of
ScTnC was decreased by 0.62 when temperature was reduced from 37.0°C
to 21.0°C and pH was increased from 7.0 to 7.3 (Table 2). When
temperature was further decreased to 7.0°C, pH 7.6, the
K1/2 increased by 0.79 (Fig. 1F,
Table 2).
Difference in Ca2+ sensitivity
between isoforms.
When measured under identical experimental conditions (temperature,
pH), ScTnC was more sensitive to Ca2+ than BcTnC (Fig.
2A). When Ca2+
binding was measured at 37.0°C pH 7.0, the
K1/2 of ScTnC was 0.99 greater than BcTnC. At
21.0°C, pH values of 7.0 and 7.3, the difference between isoforms was
0.36 in both cases (Table 2). When measured at 7.0°C and pH values of
7.0 and 7.6, the difference in K1/2 between
isoforms was 0.26 for both pH values (Table 2). Comparison of the
isoforms under the experimental conditions closest to their respective
physiological conditions (ScTnC, 7.0°C, pH 7.6; BcTnC, 37.0°C, pH
7.0) reveals that ScTnC was significantly more sensitive to
Ca2+ than BcTnC (Fig. 2B). The
K1/2 of ScTnC under these conditions was 1.17 more (14.8-fold) than BcTnC (Table 2). A consistent finding when
comparing the shape of the titration curves of the two isoforms of cTnC
under identical conditions is that as ScTnC begins loading
Ca2+ at lower [Ca2+] than BcTnC.
|
| |
DISCUSSION |
|---|
|
|
|---|
The engineering of fluorescent probes into TnC through
phenylalanine-to-tryptophan mutation has been used previously to study the Ca2+ binding dynamics of this molecule (12, 24,
25, 28, 31, 34, 41). The effectiveness of tryptophan at residue
27 in reporting Ca2+ binding to site II in BcTnC and
ScTnC without significantly affecting the tertiary structure
of the molecule has been previously established (28). In
this study, we demonstrated that the far ultraviolet circular
dichroism of wild-type BcTnC and ScTnC were nearly identical to the F27W mutants under both Ca2+-free and
Ca2+-saturating conditions (28). These results
suggest that the F27W mutation does not have a significant effect on
the
-helical structure of the proteins or how the degree of
-helicity changes with Ca2+ binding. In the present
study, the K1/2 values of Ca2+
binding to the two mutant proteins are also within the range previously
reported for that of Ca2+-triggered tension generation in
cardiac myocytes under similar conditions (21, 23, 26, 27, 29,
44). Pearlstone et al. (31) using a series of
tryptophan mutants of sTnC, have also demonstrated that
Ca2+ affinity measured with fluorescence is similar to when
measured directly by Ca2+ binding (7). For
these reasons, we believe that the F27W mutation is accurately
reporting on the Ca2+-induced conformational response of
BcTnC and ScTnC without significantly altering the functional
characteristics of the molecule. As the recombinant cTnCs were studied
in isolation from troponin I and troponin T, the modulatory effect of
these proteins on Ca2+ binding has been removed. Hence, a
direct comparison of Ca2+ binding by the two isoforms is
possible under very specific conditions.
The effect of temperature on Ca2+ sensitivity. It has been clearly demonstrated that a reduction in environmental temperature reduces the sensitivity of the contractile element to [Ca2+] in cardiac myofibrils isolated from mammals, frogs, and salmonids (5, 6, 19, 21, 40). This effect of lowered temperature is exploited as a cardioprotectant during surgery, as in addition to inhibiting electrical activity, it also acts to desensitize the cells to Ca2+, thereby reducing the possibility of contracture when intracellular [Ca2+] rises during the imposed ischemia. The results of the present study suggest that it is the effect of temperature on the Ca2+ binding characteristics of cTnC that is at least partly responsible for this effect. The decrease in the K1/2 of both ScTnC and BcTnC as temperature was decreased from 37.0 to 21.0°C and from 21.0 to 7.0°C (at constant pH) indicates that the molecule was becoming desensitized to Ca2+ in the absence of other thin filament proteins. This decrease was equal to 0.048 pCa units/°C for ScTnC and 0.008 pCa units/°C for BcTnC when temperature was decreased from 37 to 21°C. When temperature was decreased from 21.0 to 7.0°C, this decrease in K1/2 was equal to 0.030 pCa units/°C for ScTnC and 0.022 pCa units/°C for BcTnC.
The shape of the curve produced by the titration of ScTnC at 37.0°C is anomalous. In all previous studies that describe the change in fluorescence as Ca2+ binds to TnC or of Ca2+ triggering tension generation achieve asymptotic levels at pCa values of 3.5 or higher. The change in the Ca2+ binding properties of ScTnC at 37°C likely indicates loss of tertiary structure and perhaps denaturation. On the one hand, this is not surprising, as temperatures above 25°C are lethal to salmonids. Previous studies have demonstrated that the function of various enzymes from cold-adapted organisms may degrade as temperature increases significantly above that normally experienced (8, 11, 14, 35, 37, 43). On the other hand, this finding is somewhat surprising, given how highly conserved cTnC is (13 differences out of 161 amino acids) between the two species. This therefore suggests that the sequence differences between the two isoforms have significant effects on the thermal stability of the molecule. This is the first known study that has examined the effects of temperature on Ca2+ binding in cTnC. The effect of low temperature on avian sTnC has been studied using an N-domain mutant (residues 1-90) containing an F29W mutation. In this study the authors showed that Ca2+ sensitivity increased 4.4-fold when temperature was decreased from 20°C, pH 7.0, to 1.0°C, pH 7.0, as reflected in K1/2 values of 5.90 and 6.54, respectively (12). This increase in K1/2 is equal to 0.03 pCa units/°C. How temperature effects the interaction of cTnC with the other components of the thin filament is not known. The binding of Ca2+ to the low-affinity binding sites of TnC leads to the exposure of a hydrophobic surface in the NH2-terminal domain as the molecule "opens" (42). The hydrophobic patch is believed to interact with troponin I to remove the inhibitory effect on troponin I on cross-bridge formation (13). However, there is a comparatively smaller conformational response in the NH2 terminal domain of avian cTnC than avian sTnC, and a smaller hydrophobic surface is revealed when Ca2+ binds the protein (39). The only study that has looked at the effects of low temperature on the structure of TnC was done using a NH2-terminal mutant of sTnC (42). These authors used nuclear magnetic resonance to examine the solution structure of the NH2-terminal domain of BsTnC and demonstrated that low temperature (4.0°C) imparts a structural change on the molecule, causing the apo-NTnC domain to contract. It is suggested that this low-temperature effect could increase the activation energy required to trigger the conformational response (42). Full-length mammalian sTnC is 66.7% identical in amino acid sequence to mammalian cTnC, and the two isoforms display distinct functional differences (1, 17, 18, 20, 39) and differ in the number of functional Ca2+ binding sites. For these reasons, prediction of how lowered environmental temperature would affect the structure of mammalian cTnC from data on sTnC is tenuous. The Hill coefficient is typically used to describe the cooperativity of Ca2+ binding to a single molecule with multiple binding sites (sTnC) or of Ca2+-activated tension in a functioning myofibril. However, as this study examined Ca2+ binding of cTnC, which has a single activation site, cooperativity is highly unlikely. For this reason, the Hill coefficient is used only as a parameter of curve fitting, and a physiological interpretation of these differences has been avoided (Table 3).
|
Effect of pH on Ca2+ sensitivity in
BcTnC and ScTnC.
The purpose of measuring Ca2+ sensitivity while keeping
temperature constant but altering pH was to determine the physiological role of
-stat regulation in maintaining cTnC function in salmonid myocytes. It has been suggested that the rise in pH that occurs when
the body temperature of a poikilotherm decreases acts to compensate for
the effect of lowered temperature on Ca2+ sensitivity
(6). A similar compensatory effect of pH on the Km of M4-lactate
dehydrogenase from different fish species and rabbits has been
demonstrated in response to temperature reduction (38).
The increase in Ca2+ sensitivity of BcTnC and ScTnC when pH
was increased at both 21.0°C and 7.0°C is supported by previous
studies looking at the effects of pH on Ca2+ sensitivity of
ventricular myofibrillar ATPase activity isolated from rat and rainbow
trout ventricles (6). In this previous study, an increase
in pH increased the Ca2+ sensitivity of both mammalian and
salmonid ventricular myofibrillar ATPase. The effect of pH on the
Ca2+ sensitivity of cardiac myocytes is well established
(10, 15, 22, 36), and TnC has been demonstrated to be at
least partly responsible (2, 9, 26, 27, 29, 30). Through
manipulation of the first 41 residues of BcTnC, Ding et al.
(9) have demonstrated that this region contains a pH
"sensor" capable of altering the effect of pH on myocyte contractility.
7.3), the increase in
K1/2 was equal to 0.047 pCa units/pH unit for
both isoforms, whereas at 7.0°C (pH 7.0
7.6), the increase in
K1/2 was equal to 0.23 pCa units/pH unit for
both isoforms. It is not known why the effect of pH was greater at
7.0°C. It is clear, however, that an increase in pH, as would occur
during
-stat regulation, sensitizes the cTnC molecule to
Ca2+, and this effect could help maintain contractility in
the salmonid myocyte at low temperatures.
The unexpected non-Hillian increase in fluorescence of ScTnC at pH
values greater than 7.0 as Ca2+ increases in the range of
pCa 8 to ~6.5 suggests that an increase in pH alters the nature of
Ca2+ binding to ScTnC. The mechanism of this effect is not
known at this time but is clearly species dependent and deserves
further investigation.
Differences between isoforms. The differences in amino acid sequence between ScTnC and BcTnC appear to have a significant effect on their ability to bind Ca2+. The higher Ca2+ sensitivity of tension generation of salmonid ventricular fibers compared with those of a rat (6) seems to be due, at least in part, to the enhanced Ca2+ sensitivity of ScTnC. The differences in Ca2+ sensitivity of ScTnC and BcTnC under their respective physiologically relevant conditions is 14.8-fold. As there is complete sequence identity of site II between the two isoforms, the variation in Ca2+ sensitivity must be as a result of differences elsewhere in the protein, for example, the region of cTnC that encompasses the nonfunctional Ca2+ binding site I (the first 41 residues of the protein). Gulati et al. (16) have demonstrated that this region of cTnC, while unable to bind Ca2+, is critical to the normal function of the protein. Manipulation of the protein sequence in this region has a significant effect on the tension-generating abilities of skinned cardiac trabeculae (16).
In summary, although the sensitivity of both isoforms was reduced when temperature was lowered and pH was maintained at 7.0, ScTnC was always more sensitive to Ca2+ than BcTnC when measured under identical conditions. An increase in pH at either 21.0°C or 7.0°C increases the Ca2+ affinity of both isoforms to a similar degree.Perspectives
The results of this study suggest that ScTnC is at least partially responsible for the higher Ca2+ sensitivity of the intact salmonid cardiac myofibril, as it was clearly shown that this isoform is significantly more sensitive to Ca2+ than BcTnC. Visual comparison of the shape of ScTnC and BcTnC Ca2+ titration curves under identical conditions reveals that ScTnC begins to load Ca2+ at a higher pCa than BcTnC; as a result, the curve has a "shoulder" at low Ca2+ concentrations and therefore a distinctive shape. One possibility is that, at higher pH values, a second Ca2+ binding site is observed in the ScTnC isoform, but clearly, further experiments are required to test this hypothesis. While extreme caution must be taken when extrapolating the Ca2+ sensitivity of isolated cTnC to the Ca2+ sensitivity of intact cardiac myofibrils, previous studies have demonstrated that the contractility of chemically skinned cardiac myocytes can be manipulated by cTnC replacement (20).Comparing the NH2-terminal region (residues 1-41) of BcTnC and ScTnC reveals that there are a total of five amino acid differences. Of these, three have the potential of having functional consequences either individually or in concert. The first of these is at residue 2 in ScTnC, where asparagine has replaced aspartate; the second is at residue 29, in which glutamine has replaced leucine; and the third is at residue 30, in which aspartate has replaced glycine (28). The location of a negatively charged side chain, aspartate, could have significant effects on the tertiary structure of the molecule, as could the removal of an additional hydrophobic side chain, leucine. One possibility is that site I is functional in ScTnC due to the insertion of aspartate into this region of the protein; however, further study is required.
| |
ACKNOWLEDGEMENTS |
|---|
We acknowledge the generous gift of bovine cTnC wild-type cDNA from Dr. J. A. Putkey at the University of Texas Medical School, Houston, TX.
| |
FOOTNOTES |
|---|
This work was funded by an National Sciences and Engineering Research Council (NSERC)-Canada operating grant to G. F. Tibbits, a Heart and Stroke Foundation of Canada Research Traineeship to T. E. Gillis, and an NSERC-Canada Undergraduate Student Research Award to C. R. Marshall.
Address for reprint requests and other correspondence: G. F. Tibbits, Cardiac Membrane Research Lab, Simon Fraser Univ., Burnaby, BC V5A 1S6, Canada (E-mail: tibbits{at}sfu.ca)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 24 November 1999; accepted in final form 13 July 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Babu, A,
Scordilis SP,
Sonnenblick EH,
and
Gulati J.
The control of myocardial contraction with skeletal fast muscle troponin C.
J Biol Chem
262:
5815-5822,
1987
2.
Ball, KL,
Johnson MD,
and
Solaro RJ.
Isoform specific interactions of troponin I and troponin C determine pH sensitivity of myofibrillar Ca2+ activation.
Biochemistry
33:
8464-8471,
1994[Medline].
3.
Baudet, S,
Hove-Madsen L,
and
Bers DM.
How to make and use calcium-specific mini- and microelectrodes.
Methods Cell Biol
40:
93-113,
1994[Web of Science][Medline].
4.
Bers, DM,
Patton CW,
and
Nuccitelli R.
A practical guide to the preparation of Ca2+ buffers.
Methods Cell Biol
40:
3-29,
1994[Web of Science][Medline].
5.
Brandt, PW,
and
Hibberd MG.
Proceedings: effect of temperature on the pCa-tension relation of skinned ventricular muscle of the cat.
J Physiol (Lond)
258:
76P-77P,
1976.
6.
Churcott, CS,
Moyes CD,
Bressler BH,
Baldwin KM,
and
Tibbits GF.
Temperature and pH effects on Ca2+ sensitivity of cardiac myofibrils: a comparison of trout with mammals.
Am J Physiol Regulatory Integrative Comp Physiol
267:
R62-R70,
1994
7.
Da Silva, AC,
de Araujo AH,
Herzberg O,
Moult J,
Sorenson M,
and
Reinach FC.
Troponin-C mutants with increased calcium affinity.
Eur J Biochem
213:
599-604,
1993[Web of Science][Medline].
8.
Davail, S,
Feller G,
Narinx E,
and
Gerday C.
Cold adaptation of proteins. Purification, characterization, and sequence of the heat-labile subtilisin from the Antarctic psychrophile Bacillus TA41.
J Biol Chem
269:
17448-53,
1994
9.
Ding, XL,
Akella AB,
and
Gulati J.
Contributions of troponin I and troponin C to the acidic pH-induced depression of contractile Ca2+ sensitivity in cardiotrabeculae.
Biochemistry
34:
2309-2316,
1995[Medline].
10.
Fabiato, A,
and
Fabiato F.
Effects of pH on the myofilaments and the sarcoplasmic reticulum of skinned cells from cardiac and skeletal muscles.
J Physiol (Lond)
276:
233-255,
1978
11.
Feller, G,
Lonhienne T,
Deroanne C,
Libioulle C,
Van Beeumen J,
and
Gerday C.
Purification, characterization, and nucleotide sequence of the thermolabile alpha-amylase from the Antarctic psychrotroph Alteromonas haloplanctis A23.
J Biol Chem
267:
5217-5221,
1992
12.
Foguel, D,
Suarez MC,
Barbosa C,
Rodrigues JJ, Jr,
Sorenson MM,
Smillie LB,
and
Silva JL.
Mimicry of the calcium-induced conformational state of troponin C by low temperature under pressure.
Proc Natl Acad Sci USA
93:
10642-10646,
1996
13.
Gagne, SM,
Tsuda S,
Li MX,
Smillie LB,
and
Sykes BD.
Structures of the troponin C regulatory domains in the apo and calcium- saturated states.
Nat Struct Biol
2:
784-789,
1995[Web of Science][Medline].
14.
Genicot, S,
Rentier-Delrue F,
Edwards D,
VanBeeumen J,
and
Gerday C.
Trypsin and trypsinogen from an Antarctic fish: molecular basis of cold adaptation.
Biochim Biophys Acta
1298:
45-57,
1996[Medline].
15.
Gulati, J,
and
Babu A.
Effect of acidosis on Ca2+ sensitivity of skinned cardiac muscle with troponin C exchange. Implications for myocardial ischemia.
FEBS Lett
245:
279-282,
1989[Web of Science][Medline].
16.
Gulati, J,
Babu A,
and
Su H.
Functional delineation of the Ca2+-deficient EF-hand in cardiac muscle, with genetically engineered cardiac-skeletal chimeric troponin C.
J Biol Chem
267:
25073-25077,
1992
17.
Gulati, J,
and
Rao VG.
The cardiac Ca2+-deficient EF-hand governs the phenotype of the cardiac-skeletal TnC-chimera in solution by Sr2+-induced tryptophan fluorescence emission.
Biochemistry
33:
9052-9056,
1994[Medline].
18.
Gulati, J,
Sonnenblick E,
and
Babu A.
The role of troponin C in the length dependence of Ca2+-sensitive force of mammalian skeletal and cardiac muscles.
J Physiol (Lond)
441:
305-24,
1991
19.
Harrison, SM,
and
Bers DM.
Influence of temperature on the calcium sensitivity of the myofilaments of skinned ventricular muscle from the rabbit.
J Gen Physiol
93:
411-428,
1989
20.
Harrison, SM,
and
Bers DM.
Modification of temperature dependence of myofilament Ca sensitivity by troponin C replacement.
Am J Physiol Cell Physiol
258:
C282-C288,
1990
21.
Harrison, SM,
and
Bers DM.
Temperature dependence of myofilament Ca2+ sensitivity of rat, guinea pig, and frog ventricular muscle.
Am J Physiol Cell Physiol
258:
C274-C281,
1990
22.
Hofmann, PA,
Miller WP,
and
Moss RL.
Altered calcium sensitivity of isometric tension in myocyte-sized preparations of porcine postischemic stunned myocardium.
Circ Res
72:
50-56,
1993
23.
Komukai, K,
Ishikawa T,
and
Kurihara S.
Effects of acidosis on Ca2+ sensitivity of contractile elements in intact ferret myocardium.
Am J Physiol Heart Circ Physiol
274:
H147-H154,
1998
24.
Li, MX,
Chandra M,
Pearlstone JR,
Racher KI,
Trigo-Gonzalez G,
Borgford T,
Kay CM,
and
Smillie LB.
Properties of isolated recombinant N and C domains of chicken troponin C.
Biochemistry
33:
917-925,
1994[Medline].
25.
Li, MX,
Gagne SM,
Tsuda S,
Kay CM,
Smillie LB,
and
Sykes BD.
Calcium binding to the regulatory N-domain of skeletal muscle troponin C occurs in a stepwise manner.
Biochemistry
34:
8330-8340,
1995[Medline].
26.
Metzger, JM.
Effects of troponin C isoforms on pH sensitivity of contraction in mammalian fast and slow skeletal muscle fibers.
J Physiol (Lond)
492:
163-72,
1996
27.
Metzger, JM,
Parmacek MS,
Barr E,
Pasyk K,
Lin WI,
Cochrane KL,
Field LJ,
and
Leiden JM.
Skeletal troponin C reduces contractile sensitivity to acidosis in cardiac myocytes from transgenic mice.
Proc Natl Acad Sci USA
90:
9036-9040,
1993
28.
Moyes, CD,
Borgford T,
LeBlanc L,
and
Tibbits GF.
Cloning and expression of salmon cardiac troponin C: titration of the low-affinity Ca2+-binding site using a tryptophan mutant.
Biochemistry
35:
11756-11762,
1996[Medline].
29.
Palmer, S,
and
Kentish JC.
The role of troponin C in modulating the Ca2+ sensitivity of mammalian skinned cardiac and skeletal muscle fibers.
J Physiol (Lond)
480:
45-60,
1994
30.
Parsons, B,
Szczesna D,
Zhao J,
Van Slooten G,
Kerrick WG,
Putkey JA,
and
Potter JD.
The effect of pH on the Ca2+ affinity of the Ca2+ regulatory sites of skeletal and cardiac troponin C in skinned muscle fibers.
J Muscle Res Cell Motil
18:
599-609,
1997[Web of Science][Medline].
31.
Pearlstone, JR,
Borgford T,
Chandra M,
Oikawa K,
Kay CM,
Herzberg O,
Moult J,
Herklotz A,
Reinach FC,
and
Smillie LB.
Construction and characterization of a spectral probe mutant of troponin C: application to analyses of mutants with increased Ca2+ affinity.
Biochemistry
31:
6545-6553,
1992[Medline].
32.
Putkey, JA,
Liu W,
and
Sweeney HL.
Function of the N-terminal calcium-binding sites in cardiac/slow troponin C assessed in fast skeletal muscle fibers.
J Biol Chem
266:
14881-14884,
1991
33.
Putkey, JA,
Sweeney HL,
and
Campbell ST.
Site-directed mutation of the trigger calcium-binding sites in cardiac troponin C.
J Biol Chem
264:
12370-12378,
1989
34.
Rao, VG,
Akella AB,
Su H,
and
Gulati J.
Molecular mobility of the Ca2+-deficient EF-hand of cardiac troponin C as revealed by fluorescence polarization of genetically inserted tryptophan.
Biochemistry
34:
562-568,
1995[Medline].
35.
Simpson, BK,
and
Haard NF.
Trypsin from Greenland cod, Gadus ogac. Isolation and comparative properties.
Comp Biochem Physiol B Biochem Mol Biol
79:
613-622,
1984.
36.
Solaro, RJ,
Lee JA,
Kentish JC,
and
Allen DG.
Effects of acidosis on ventricular muscle from adult and neonatal rats.
Circ Res
63:
779-787,
1988
37.
Somero, GN.
Biochemical mechanisms of cold adaptation and stenothermality in Antarctic fish.
In: Biology of Antarctic Fish, edited by di Prisco G,
Maresca B,
and Tota B.. Berlin: Springer-Verlag, 1991, p. 232-247.
38.
Somero, GN.
pH-temperature interactions on proteins: principles of optimal pH and buffer system design.
Mar Biol (Berl)
2:
163-178,
1981.
39.
Spyracopoulos, L,
Li MX,
Sia SK,
Gagne SM,
Chandra M,
Solaro RJ,
and
Sykes BD.
Calcium-induced structural transition in the regulatory domain of human cardiac troponin C.
Biochemistry
36:
12138-12146,
1997[Medline].
40.
Sweitzer, NK,
and
Moss RL.
The effect of altered temperature on Ca2+-sensitive force in permeabilized myocardium and skeletal muscle. Evidence for force dependence of thin filament activation.
J Gen Physiol
96:
1221-1245,
1990
41.
Trigo-Gonzalez, G,
Racher K,
Burtnick L,
and
Borgford T.
A comparative spectroscopic study of tryptophan probes engineered into high- and low-affinity domains of recombinant chicken troponin C.
Biochemistry
31:
7009-7015,
1992[Medline].
42.
Tsuda, S,
Miura A,
Gagne SM,
Spyracopoulos L,
and
Sykes BD.
Low-temperature-induced structural changes in the apo regulatory domain of skeletal muscle troponin C.
Biochemistry
38:
5693-5700,
1999[Medline].
43.
Vckovski, V,
Schlatter D,
and
Zuber H.
Structure and function of L-lactate dehydrogenases from thermophilic, mesophilic and psychrophilic bacteria. IX. Identification, isolation and nucleotide sequence of two L-lactate dehydrogenase genes of the psychrophilic bacterium Bacillus psychrosaccharolyticus.
Biol Chem Hoppe Seyler
371:
103-110,
1990[Web of Science][Medline].
44.
Wattanapermpool, J,
Reiser PJ,
and
Solaro RJ.
Troponin I isoforms and differential effects of acidic pH on soleus and cardiac myofilaments.
Am J Physiol Cell Physiol
268:
C323-C330,
1995
This article has been cited by other articles:
![]() |
G. L. J. Galli, D. E. Warren, and H. A. Shiels Ca2+ cycling in cardiomyocytes from a high-performance reptile, the varanid lizard (Varanus exanthematicus) Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2009; 297(6): R1636 - R1644. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Liang, F. Chung, Y. Qu, D. Pavlov, T. E. Gillis, S. B. Tikunova, J. P. Davis, and G. F. Tibbits Familial hypertrophic cardiomyopathy-related cardiac troponin C mutation L29Q affects Ca2+ binding and myofilament contractility Physiol Genomics, April 1, 2008; 33(2): 257 - 266. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Gillis, C. R. Marshall, and G. F. Tibbits Functional and evolutionary relationships of troponin C Physiol Genomics, December 19, 2007; 32(1): 16 - 27. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. Shiels, S. C. Calaghan, and E. White The Cellular Basis for Enhanced Volume-modulated Cardiac Output in Fish Hearts J. Gen. Physiol., June 26, 2006; 128(1): 37 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Anderson, H. Liu, A. Beyschau, and P. M. Cala Effects of cold cardioplegia on pH, Na, and Ca in newborn rabbit hearts Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H1090 - H1097. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Gillis, B. Liang, F. Chung, and G. F. Tibbits Increasing mammalian cardiomyocyte contractility with residues identified in trout troponin C Physiol Genomics, June 16, 2005; 22(1): 1 - 7. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Gillis, C. D. Moyes, and G. F. Tibbits Sequence mutations in teleost cardiac troponin C that are permissive of high Ca2+ affinity of site II Am J Physiol Cell Physiol, May 1, 2003; 284(5): C1176 - C1184. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Davis, J. A. Rall, P. J. Reiser, L. B. Smillie, and S. B. Tikunova Engineering Competitive Magnesium Binding into the First EF-hand of Skeletal Troponin C J. Biol. Chem., December 13, 2002; 277(51): 49716 - 49726. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. Shiels, M. Vornanen, and A. P. Farrell Effects of temperature on intracellular [Ca2+] in trout atrial myocytes J. Exp. Biol., December 1, 2002; 205(23): 3641 - 3650. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Hove-Madsen, A. Llach, and L. Tort The function of the sarcoplasmic reticulum is not inhibited by low temperatures in trout atrial myocytes Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2001; 281(6): R1902 - R1906. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |