|
|
||||||||
Departments of 1 Internal Medicine and 2 Biochemistry, National Cardiovascular Center, Osaka 565 - 8565; 3 Department of Internal Medicine, Osaka Seamen's Insurance Hospital, Osaka 552-0021; and 4 Institute for Medical Research and Development, Suntory Limited, Gunma 370-0503, Japan
| |
ABSTRACT |
|---|
|
|
|---|
To investigate hemodynamic and hormonal effects of
ghrelin, a novel growth hormone (GH)-releasing peptide, we gave six
healthy men an intravenous bolus of human ghrelin (10 µg/kg) or
placebo and vice versa 1-2 wk apart in a randomized fashion.
Ghrelin elicited a marked increase in circulating GH (15-fold). The
elevation of GH lasted longer than 60 min after the bolus injection.
Injection of ghrelin significantly decreased mean arterial pressure
(
12 mmHg, P < 0.05) without a significant change in
heart rate (
4 beats/min, P = 0.39). Ghrelin significantly
increased cardiac index (+16%, P < 0.05) and stroke
volume index (+22%, P < 0.05). We also examined
ghrelin receptor [GH secretagogues receptor (GHS-R)] gene expression
in the aortas, the left ventricles, and the left atria of rats by
RT-PCR. GHS-R mRNA was detectable in the rat aortas, left ventricles,
and left atria, suggesting that ghrelin may cause cardiovascular
effects through GH-independent mechanisms. In summary, human
ghrelin elicited a potent, long-lasting GH release and had beneficial
hemodynamic effects via reducing cardiac afterload and increasing
cardiac output without an increase in heart rate.
hemodynamics; hormones; vasodilation
| |
INTRODUCTION |
|---|
|
|
|---|
RECENTLY, GROWTH HORMONE (GH) activity has been proposed to be associated with myocardial growth and cardiac function (1, 6, 20). In addition to the physiological stimulation by hypothalamic GH-releasing hormone (GHRH), the release of GH from the pituitary is stimulated by small synthetic molecules called GH secretagogues (GHS) (5, 13, 16). They act through a GHS receptor (GHS-R), a G protein-coupled receptor (11), for which the ligand was unknown until we successfully isolated an endogenous ligand specific for GHS-R, ghrelin, from the stomach in December 1999 (12). Human ghrelin is a 28-amino-acid peptide containing an n-octanoyl modification at serine-3 and is homologous to rat ghrelin apart from two amino acids. If ghrelin possesses GH-releasing activity in humans, ghrelin may have beneficial effects in patients with chronic heart failure through a GH-dependent mechanism. On the other hand, ghrelin may have direct cardiovascular effects through GH-independent mechanisms because ghrelin peptide and mRNA are detected in a variety of tissues including the heart and blood vessels and because a specific binding for GHS exists not only in the hypothalamus and pituitary but also in the heart (8). However, the effects of ghrelin in humans are totally unknown. Thus, the purpose of this study was to investigate hemodynamic and hormonal effects of intravenous ghrelin in healthy volunteers.
| |
METHODS |
|---|
|
|
|---|
Study subjects. We studied six healthy male hospital staff members, aged 30 ± 1 yr, who weighed 68 ± 5 kg. None of them had any history of cardiovascular, renal, respiratory, hepatic, or metabolic disease, and none were taking any drugs. Physical examination and electrocardiographic and echocardiographic findings were also normal. The study was approved by the ethics committee of the National Cardiovascular Center, and all subjects gave written informed consent.
Preparation of synthetic human ghrelin.
Human ghrelin was obtained from the Peptide Institute, Osaka, Japan.
The homogeneity of human ghrelin was confirmed by reverse-phase, high-performance liquid chromatography (RP-HPLC) and amino acid analysis. Ghrelin was dissolved in distilled water with 4%
D-mannitol and was sterilized by passage through a
0.22-µm filter (Millipore). Ghrelin was stored as 1 ml volumes (each
containing 600 µg ghrelin) at
80°C until the time of preparation
for administration.
Study protocol.
The subjects were studied on 2 separate days (1 day, ghrelin; 1 day,
placebo) 1-2 wk apart in a randomized, crossover fashion. This
study was performed after the subjects fasted overnight, because plasma
ghrelin level has been shown to be altered by food intake
(19). A 7.5 French Swan-Ganz catheter
(TOO21H-7.5F, Baxter) was positioned in the pulmonary artery through a
jugular vein to measure pulmonary arterial pressure and pulmonary
capillary wedge pressure. Cardiac output was determined by
thermodilution method in triplicate (7). A 22-gauge
cannula was inserted into a radial artery for measurement of heart rate
and systemic arterial pressure. Another 22-gauge cannula was inserted
into a forearm vein for infusion of ghrelin. Ghrelin (10 µg/kg) was
dissolved in 5 ml saline. After an equilibration period of 60 min,
baseline measurements were performed. Then, 5 ml of ghrelin solution or placebo (0.9% saline) was administered as an intravenous bolus. Hemodynamic measurements were repeatedly performed until 120 min after
the injection. Blood sampling was repeated at 15 points (
10, 0, 1, 3, 5, 10, 15, 20, 30, 40, 50, 60, 80, 100, and 120 min after ghrelin
injection). Plasma half-life of ghrelin was calculated using WinNonlin
library (noncompartmental model, Scientific Consulting).
RIA for plasma ghrelin.
RIA for plasma ghrelin was performed as described previously
(10). In brief, a polyclonal antibody was raised against
the COOH terminus fragment (13-28) of rat ghrelin in
a rabbit. A maleimide-activated mariculture keyhole limpet
hemocyanin-[Cys]-ghrelin-(13-28) conjugate was used
for immunization. [Tyr0]-rat ghrelin
(13-28) was radioiodinated by the lactoperoxidase method. A monoiodinated ligand was purified by RP-HPLC on a
µBondasphere C18 column (3.9 × 150 mm, Waters, Milford,
MA). The tracer was stable for 3 mo and stored at
20°C in 0.1%
bovine serum albumin. The RIA incubation mixture consisted of 100 µl
of unknown sample, 100 µl of normal rabbit serum, and 200 µl of
antiserum at a dilution of 1:10,000. After 12 h incubation
at 4°C, 100 µl of 125I-labeled ligand (15,000 cpm) was
added to the mixture. After 36 h incubation at 4°C, 100 µl of
anti-rabbit goat antibody was added. Free and bound tracers were
separated by centrifugation at 3,000 rpm for 30 min after incubation
for 24 h at 4°C. After aspiration of supernatant, radioactivity
in the pellet was quantified with a gamma counter (ARC-600, Aloka,
Tokyo, Japan). The minimum detectable dose of ghrelin was <6
fmol/tube. The antiserum exhibited 100% cross-reactivity with rat or
human ghrelin (13-28). No significant cross-reactivity with other peptides was observed. Intraobserver variability of ghrelin measurement was less than 6%, and its
interobserver variability was less than 9%.
Other biochemical measurements. Serum GH was measured with an immunoradiometric assay kit (Ab Bead HGH Eiken, Eiken Chemical, Tokyo, Japan). Serum follicle-stimulating hormone (FSH), luteinizing hormone (LH), prolactin (PRL), and thyroid-stimulating hormone (TSH) were measured using immunoradiometric assay kits (SPAC-S FSH, LH, Prolactin, and TSH, Daiichi Radioisotope Laboratories, Tokyo, Japan). Plasma adrenocorticotropin (ACTH) was measured with an immunoradiometric assay (ACTH IRMA Mitsubishi, Mitsubishi Chemical, Tokyo, Japan). Plasma cortisol was measured with a radioimmunoassay kit (Gamma-Coat Cortisol, Date Behring). Serum insulin-like growth factor-1 (IGF-1) was determined by an immunoradiometric assay kit (Somatomedin CII Bayer, Bayer Medical, Tokyo, Japan). Plasma norepinephrine and epinephrine were measured with HPLC. Plasma cAMP and cGMP were determined with specific RIA kits (cAMP assay kit, cGMP assay kit, Yamasa Shoyu, Chiba, Japan).
RT-PCR analysis. mRNA expression of GHS-R, a specific receptor for ghrelin, was examined in the descending aorta, the left ventricle, and the left atrium of male Wistar rats. Total RNA was extracted from the tissues and was converted to cDNA by reverse transcription (RT). PCR was performed for 35 cycles (5 s at 98°C, 10 s at 65°C, and 1 min at 72°C) with specific primers (sense, GAGATCGCTCAGATCAGCCAGTAC and antisense, TAATCCCCAAACTGAGGTTCTGC). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA was amplified as the control.
All animal experiments were conducted in accordance with the principles and procedures outlined in the National Cardiovascular Center Guide for the Care and Use of Laboratory Animals, which adheres strictly to the National Institutes of Health animal experimental guidelines, with the approval of the National Cardiovascular Center Animal Experimental Committee.Statistical analysis. Data were expressed as means ± SE. Comparisons of the time course of parameters between two groups were made by two-way ANOVA for repeated measures, followed by Newman-Keuls test. A P value < 0.05 was considered statistically significant.
| |
RESULTS |
|---|
|
|
|---|
All study subjects tolerated this study protocol, although ghrelin caused a slight warm feeling and sleepiness in four subjects.
Hormonal response to ghrelin.
Plasma ghrelin level increased about 61-fold of baseline value ~1 min
after ghrelin injection. The plasma ghrelin level disappeared with
half-lives of 10 min (Fig.
1A). Injection of ghrelin
elicited a marked increase in circulating GH, with the peak level (15× baseline value) occurring 20 min after administration (Fig.
1B). The elevation of GH level lasted >60 min after the
bolus injection. Ghrelin significantly increased circulating levels of
PRL, ACTH, and cortisol, whereas it did not significantly alter FSH,
LH, or TSH level (Table 1). No
significant change in serum IGF-1 was observed throughout the study
protocol. Ghrelin significantly increased plasma epinephrine but not
norepinephrine. Ghrelin significantly increased plasma cAMP but not
plasma cGMP. These hormonal parameters remained unchanged during
placebo injection.
|
|
Hemodynamic response to ghrelin.
Injection of ghrelin significantly decreased mean arterial pressure to
a minimum level (
12 mmHg, P < 0.05; Fig.
2) without a significant change in heart
rate (
4 beats/min, P = 0.39). The hypotensive effect of
ghrelin lasted for 100 min after the injection. No significant change
in mean pulmonary arterial pressure or pulmonary capillary wedge
pressure was observed (data not shown). Cardiac index significantly
rose to the maximum level 15 min after injection of ghrelin (+16%,
P < 0.05) and returned to near preinjection level at
60 min. Stroke volume index also rose to the maximum level 15 min after
injection (+22%, P < 0.05). Consequently, ghrelin markedly decreased systemic vascular resistance (
24%,
P < 0.05). These hemodynamic parameters remained
unchanged after placebo injection.
|
Detection of GHS-R expression.
GHS-R mRNA was detectable by RT-PCR in the rat aorta as well as the
left ventricle and left atrium (Fig. 3).
|
| |
DISCUSSION |
|---|
|
|
|---|
This is the first study to examine hemodynamic and hormonal effects of ghrelin in humans. In the present study, we demonstrated that 1) intravenous injection of ghrelin elicited a potent, long-lasting GH release in healthy volunteers and 2) ghrelin decreased mean arterial pressure and increased cardiac output but did not increase heart rate.
Ghrelin is a novel GH-releasing peptide, isolated from the stomach, that acts through a mechanism independent from that of hypothalamic GHRH (12). The GH-releasing effects of ghrelin are thought to be mediated by specific receptors, GHS-R, mainly present at the pituitary and hypothalamic level. Taken together with the fact that intravenously administered ghrelin induced a potent GH release in humans, the data suggest that this molecule is produced in and secreted from the stomach and circulates in the bloodstream to act on the pituitary. A single injection of ghrelin resulted in a relatively long-lasting elevation of circulating GH, although plasma ghrelin level decayed soon after a single intravenous administration. Replacement therapy with GH has been reported to have beneficial effects on myocardial structure and function in patients with chronic heart failure (6, 20). Thus it may be interesting to investigate whether ghrelin administration is beneficial in patients with heart failure by inducing potent, long-lasting GH release.
Ghrelin also exhibited stimulatory effects on PRL, ACTH, and cortisol secretion, which is consistent with the effects of hexarelin (HEX), a synthetic GH-releasing peptide (14). GHS-R, a specific receptor for ghrelin and HEX, has been shown to exist abundantly in the hypothalamus and pituitary (11). Thus the hormonal effects of ghrelin may be due to direct effects at the pituitary level as well as in the hypothalamus. The stimulatory effect of ghrelin on cortisol secretion seems to be due to its ACTH-releasing property, because the cortisol-releasing activity of HEX is lost in the presence of hypothalamo-pituitary disconnection (17). Ghrelin significantly increased plasma epinephrine, but not norepinephrine, level. Considering the presence of GHS-binding sites in the adrenal (8), the epinephrine-releasing effect of ghrelin may be due to direct effects on the adrenal.
To our knowledge, GHRH, another physiological GH-releasing factor, has no direct cardiovascular effects because the GHRH receptor is restricted to specific tissues including pituitary membranes (15). In contrast, ghrelin peptide and its specific binding sites are detected in a variety of tissues including the heart and blood vessels (8, 10, 12). In the present study, we first demonstrated that ghrelin induced a marked, long-lasting hypotensive effect, although activation of the hypothalamic-pituitary-adrenal (HPA) axis is known to be associated with hypertension. A single injection of ghrelin did not significantly increase circulating IGF-1, which has been shown to cause vasodilation through a direct stimulatory effect on nitric oxide synthesis (3). In addition, we recently found that ghrelin induced hypotension in hypophysectomized rats in which ghrelin could not stimulate the release of either GH or IGF-1 (unpublished data). Furthermore, we showed that the GHS-R gene was abundantly expressed in the rat aorta. Ghrelin injection significantly increased plasma cAMP level in association with decreases in mean arterial pressure. These findings raise the possibility that ghrelin has a direct vasorelaxant effect. Further studies are necessary to elucidate the relationship between ghrelin and the HPA axis. Surprisingly, the hypotensive effect of ghrelin was not associated with an increase in heart rate or plasma norepinephrine. It is interesting to speculate that ghrelin may inhibit activation of the sympathetic nervous system during hypotension, which may be beneficial in treating patients with congestive heart failure. Unlike ghrelin, HEX, a GHS, does not induce a hypotensive effect, although HEX has a positive inotropic effect in humans (2). It is interesting to speculate that different affinities for GHS-R in the vasculature may contribute to the differential vascular effects of ghrelin and HEX.
This study also demonstrated that ghrelin significantly increased cardiac index and stroke volume index. Considering the hypotensive effect of ghrelin, we believe that a decrease in cardiac afterload may be responsible for the increased cardiac index. Alternatively, because GH upregulates sarcoplasmic Ca2+-ATPase and thereby enhances myocardial contractility (18), part of the cardiac effects of ghrelin may be mediated by GH. Interestingly, the GHS-R gene was abundantly expressed in the myocardium. Thus it is possible that ghrelin may have some direct actions on myocardium. It is also possible that increased plasma epinephrine by ghrelin might indirectly increase cardiac index and stroke volume index. Further studies are necessary to examine the potential mechanisms responsible for these cardiovascular effects of ghrelin.
Study limitations. In the present study, hormonal responses to ghrelin were examined after the subjects fasted overnight, because plasma ghrelin level has been shown to be altered by food intake (19). On the other hand, fasting may alter GH responses to ghrelin and contribute to the uncoupling of the GH/IGF-1 axis in study subjects (4, 9). Further studies are necessary to investigate the effects of food intake on GH/IGF-1 responses to ghrelin.
Summary. Human ghrelin elicited a potent, long-lasting GH release and had beneficial hemodynamic effects via reducing cardiac afterload and increasing cardiac output without increasing heart rate. Based on the results of this preliminary study, we believe that the long-term effects of ghrelin in patients with chronic heart failure should be examined in a randomized, large-scale study.
Perspectives
GH supplement has been reported to improve myocardial structure and function in patients with idiopathic dilated cardiomyopathy, a condition in which compensatory cardiac hypertrophy is believed to be deficient (6). Given the potent GH-releasing activity and direct cardiovascular effects of ghrelin, it may be interesting to investigate whether ghrelin administration is beneficial in patients with intractable chronic heart failure.| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by the Promotion of Fundamental Studies in Health Science of the Organization for Pharmaceutical Safety and Research of Japan and a Japan Heart Foundation Research Grant.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: N. Nagaya, Dept. of Internal Medicine, National Cardiovascular Center, 5-7-1 Fujishirodai, Suita, Osaka 565-8565, Japan.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 25 August 2000; accepted in final form 17 January 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Amato, G,
Carella C,
Fazio S,
La Montagna G,
Cittadini A,
Sabatini D,
Marciano-Mone C,
Sacca L,
and
Bellastella A.
Body composition, bone metabolism, heart structure and function in growth hormone deficient adults before and after growth hormone replacement therapy at low doses.
J Clin Endocrinol Metab
77:
1671-1676,
1993[Abstract].
2.
Bisi, G,
Podio V,
Valetto MR,
Broglio F,
Bertuccio G,
Del Rio G,
Arvat E,
Boghen MF,
Deghenghi R,
Muccioli G,
Ong H,
and
Ghigo E.
Acute cardiovascular and hormonal effects of GH and hexarelin, a synthetic GH-releasing peptide, in humans.
J Endocrinol Invest
22:
266-272,
1999[Web of Science][Medline].
3.
Boger, RH,
Skamira C,
Bode-Boger SM,
Brabant G,
Muhlen A,
and
Frolich J.
Nitric oxide may mediate the hemodynamic effects of recombinant growth hormone in patients with acquired growth hormone deficiency: a double-blind, placebo-controlled study.
J Clin Invest
98:
2706-2713,
1996[Web of Science][Medline].
4.
De Marinis, L,
Mancini A,
Valle D,
Izzi D,
Bianchi A,
Gentilella R,
Giampietro A,
Desenzani P,
and
Giustina A.
Role of food intake in the modulation of hexarelin-induced growth hormone release in normal human subjects.
Horm Metab Res
32:
152-156,
2000[Web of Science][Medline].
5.
Deghenghi, R,
Cananzi MM,
Torsello A,
Battisti C,
Muller EE,
and
Locatelli V.
GH-releasing activity of hexarelin. A new growth hormone releasing peptide, in infants and adult rats.
Life Sci
54:
1321-1328,
1994[Web of Science][Medline].
6.
Fazio, S,
Sabatini D,
Capaldo B,
Vigorito C,
Giordano A,
Guida R,
Pardo F,
Biondi B,
and
Sacca L.
A preliminary study of growth hormone in the treatment of dilated cardiomyopathy.
N Engl J Med
334:
809-814,
1996
7.
Ganz, W,
Donoso R,
Marcus HS,
Forrester JS,
and
Swan HJ.
A new technique for measurement of cardiac output by thermodilution in man.
Am J Cardiol
27:
392-396,
1971[Web of Science][Medline].
8.
Ghigo, E,
Arvat E,
Broglio F,
Giordano R,
Gianotti L,
Muccioli G,
Papotti M,
Graziani A,
Bisi G,
Deghenghi R,
and
Camanni F.
Endocrine and nonendocrine activities of growth hormone secretagogues in humans.
Horm Res
51:
9-15,
1999.
9.
Heinrichs, C,
Colli M,
Yanovski JA,
Laue L,
Gerstl NA,
Kramer AD,
Uyeda JA,
and
Baron J.
Effects of fasting on the growth plate: systemic and local mechanisms.
Endocrinology
138:
5359-5365,
1997
10.
Hosoda, H,
Kojima M,
Matsuo H,
and
Kangawa K.
Ghrelin and des-acyl ghrelin: two major forms of rat ghrelin peptide in gastrointestinal tissue.
Biochem Biophys Res Commun
279:
909-913,
2000[Web of Science][Medline].
11.
Howard, AD,
Fieghner SD,
Cully DF,
Arena JP,
Liberator PA,
and
Rosenblum CI.
A receptor in pituitary and hypothalamus that functions in growth hormone release.
Science
273:
974-977,
1996[Abstract].
12.
Kojima, M,
Hosoda H,
Date Y,
Nakazato M,
Matsuo H,
and
Kangawa K.
Ghrelin is a growth-hormone-releasing acylated peptide from stomach.
Nature
402:
656-660,
1999[Medline].
13.
Locatelli, V,
and
Torsello A.
Growth hormone secretagogues: focus on the growth hormone releasing peptides.
Pharmacol Res
36:
415-423,
1997[Web of Science][Medline].
14.
Massoud, AF,
Hindmarsh PC,
and
Brook CGD
Hexarelin-induced growth hormone, cortisol, and prolactin release: a dose-response study.
J Clin Endocrinol Metab
81:
4338-4341,
1996[Abstract].
15.
Petersenn, S,
and
Schulte HM.
Structure and function of the growth-hormone-releasing hormone receptor.
Vitam Horm
59:
35-69,
2000[Medline].
16.
Smith, RG,
Cheng K,
Schoen WR,
Pong SS,
Hickey G,
and
Jacks T.
A nonpeptidyl growth hormone secretagogue.
Science
260:
1640-1643,
1993
17.
Smith, RG,
Van der Ploeg LH,
Howard AD,
Feighner SD,
Cheng K,
Hickey GJ,
Wyvratt MJ, Jr,
Fisher MH,
Nargund RP,
and
Patchett AA.
Peptidomimetic regulation of growth hormone secretion.
Endocr Rev
18:
621-645,
1997
18.
Tajima, M,
Weinberg EO,
Bartunek J,
Jin H,
Yang R,
Paoni NF,
and
Lorell BH.
Treatment with growth hormone enhances contractile reserve and intracellular calcium transients in myocytes from rats with postinfarction heart failure.
Circulation
99:
127-134,
1999
19.
Tschop, M,
Smiley DL,
and
Heiman ML.
Ghrelin induces adiposity in rodents.
Nature
407:
908-913,
2000[Medline].
20.
Volterrani, M,
Desenzani P,
Lorusso R,
d'Aloia A,
Manelli F,
and
Giustina A.
Hemodynamic effects of intravenous growth hormone in congestive heart failure.
Lancet
349:
1067-1068,
1997[Web of Science][Medline].
This article has been cited by other articles:
![]() |
C. M. MacLean, A.-T. Casanova, L. Baselgia-Jeker, N. Neave, F. Larsen, L. Skillern, J. Drewe, and C. Beglinger Effect of Food on the Pharmacokinetics and Pharmacodynamics of an Oral Ghrelin Agonist (ARD-07) in Healthy Subjects J. Clin. Pharmacol., May 1, 2009; 49(5): 553 - 559. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. I. Messini, K. Dafopoulos, N. Chalvatzas, P. Georgoulias, and I. E. Messinis Effect of ghrelin on gonadotrophin secretion in women during the menstrual cycle Hum. Reprod., April 1, 2009; 24(4): 976 - 981. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fry and A. V. Ferguson Ghrelin modulates electrical activity of area postrema neurons Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2009; 296(3): R485 - R492. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Lasseter, L. Shaughnessy, D. Cummings, J. C. Pezzullo, W. Wargin, R. Gagnon, J. Oliva, and G. Kosutic Ghrelin Agonist (TZP-101): Safety, Pharmacokinetics and Pharmacodynamic Evaluation in Healthy Volunteers: A Phase I, First-in-Human Study J. Clin. Pharmacol., February 1, 2008; 48(2): 193 - 202. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. T. Vestergaard, N. H. Andersen, T. K. Hansen, L. M. Rasmussen, N. Moller, K. E. Sorensen, E. Sloth, and J. O. L. Jorgensen Cardiovascular effects of intravenous ghrelin infusion in healthy young men Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H3020 - H3026. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-N. Ma, H. H. Schiffer, A. E. Knapp, J. Wang, K. K. Wong, E. A. Currier, M. Owens, N. R. Nash, L. R. Gardell, M. R. Brann, et al. Identification of the Atypical L-Type Ca2+ Channel Blocker Diltiazem and Its Metabolites As Ghrelin Receptor Agonists Mol. Pharmacol., August 1, 2007; 72(2): 380 - 386. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tawadros, L.A. Salamonsen, E. Dimitriadis, and C. Chen Facilitation of decidualization by locally produced ghrelin in the human endometrium Mol. Hum. Reprod., July 1, 2007; 13(7): 483 - 489. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Arepally, B. P. Barnett, E. Montgomery, and T. H. Patel Catheter-directed Gastric Artery Chemical Embolization for Modulation of Systemic Ghrelin Levels in a Porcine Model: Initial Experience Radiology, July 1, 2007; 244(1): 138 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. T. Vestergaard, T. K. Hansen, L. C. Gormsen, P. Jakobsen, N. Moller, J. S. Christiansen, and J. O. L. Jorgensen Constant intravenous ghrelin infusion in healthy young men: clinical pharmacokinetics and metabolic effects Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1829 - E1836. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Baessler, M. Fischer, B. Mayer, M. Koehler, S. Wiedmann, K. Stark, A. Doering, J. Erdmann, G. Riegger, H. Schunkert, et al. Epistatic interaction between haplotypes of the ghrelin ligand and receptor genes influence susceptibility to myocardial infarction and coronary artery disease Hum. Mol. Genet., April 15, 2007; 16(8): 887 - 899. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Iantorno, H. Chen, J.-a Kim, M. Tesauro, D. Lauro, C. Cardillo, and M. J. Quon Ghrelin has novel vascular actions that mimic PI 3-kinase-dependent actions of insulin to stimulate production of NO from endothelial cells Am J Physiol Endocrinol Metab, March 1, 2007; 292(3): E756 - E764. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Kraemer and V. D. Castracane Exercise and Humoral Mediators of Peripheral Energy Balance: Ghrelin and Adiponectin Experimental Biology and Medicine, February 1, 2007; 232(2): 184 - 194. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Wertz-Lutz, T. J. Knight, R. H. Pritchard, J. A. Daniel, J. A. Clapper, A. J. Smart, A. Trenkle, and D. C. Beitz Circulating ghrelin concentrations fluctuate relative to nutritional status and influence feeding behavior in cattle J Anim Sci, December 1, 2006; 84(12): 3285 - 3300. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Tritos and E. G. Kokkotou The Physiology and Potential Clinical Applications of Ghrelin, a Novel Peptide Hormone Mayo Clin. Proc., May 1, 2006; 81(5): 653 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
J Tack, I Depoortere, R Bisschops, C Delporte, B Coulie, A Meulemans, J Janssens, and T Peeters Influence of ghrelin on interdigestive gastrointestinal motility in humans Gut, March 1, 2006; 55(3): 327 - 333. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Kleinz, J. J. Maguire, J. N. Skepper, and A. P. Davenport Functional and immunocytochemical evidence for a role of ghrelin and des-octanoyl ghrelin in the regulation of vascular tone in man Cardiovasc Res, January 1, 2006; 69(1): 227 - 235. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Davenport, T. I. Bonner, S. M. Foord, A. J. Harmar, R. R. Neubig, J.-P. Pin, M. Spedding, M. Kojima, and K. Kangawa International Union of Pharmacology. LVI. Ghrelin Receptor Nomenclature, Distribution, and Function Pharmacol. Rev., December 1, 2005; 57(4): 541 - 546. [Abstract] [Full Text] [PDF] |
||||
![]() |
C D R Murray, N M Martin, M Patterson, S A Taylor, M A Ghatei, M A Kamm, C Johnston, S R Bloom, and A V Emmanuel Ghrelin enhances gastric emptying in diabetic gastroparesis: a double blind, placebo controlled, crossover study Gut, December 1, 2005; 54(12): 1693 - 1698. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wu, W. Dong, M. Zhou, X. Cui, H. Hank Simms, and P. Wang Ghrelin improves tissue perfusion in severe sepsis via downregulation of endothelin-1 Cardiovasc Res, November 1, 2005; 68(2): 318 - 326. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-B. Xu, J.-J. Pang, J.-M. Cao, C. Ni, R.-K. Xu, X.-Z. Peng, X.-X. Yu, S. Guo, M.-C. Chen, and C. Chen GH-releasing peptides improve cardiac dysfunction and cachexia and suppress stress-related hormones and cardiomyocyte apoptosis in rats with heart failure Am J Physiol Heart Circ Physiol, October 1, 2005; 289(4): H1643 - H1651. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Zaloga Ghrelin, Diet, and Pulmonary Function Chest, September 1, 2005; 128(3): 1084 - 1086. [Full Text] [PDF] |
||||
![]() |
K. Wynne, K. Giannitsopoulou, C. J. Small, M. Patterson, G. Frost, M. A. Ghatei, E. A. Brown, S. R. Bloom, and P. Choi Subcutaneous Ghrelin Enhances Acute Food Intake in Malnourished Patients Who Receive Maintenance Peritoneal Dialysis: A Randomized, Placebo-Controlled Trial J. Am. Soc. Nephrol., July 1, 2005; 16(7): 2111 - 2118. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kojima and K. Kangawa Ghrelin: Structure and Function Physiol Rev, April 1, 2005; 85(2): 495 - 522. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Nagaya, J. Moriya, Y. Yasumura, M. Uematsu, F. Ono, W. Shimizu, K. Ueno, M. Kitakaze, K. Miyatake, and K. Kangawa Effects of Ghrelin Administration on Left Ventricular Function, Exercise Capacity, and Muscle Wasting in Patients With Chronic Heart Failure Circulation, December 14, 2004; 110(24): 3674 - 3679. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Henriques-Coelho, J. Correia-Pinto, R. Roncon-Albuquerque Jr, M. J. Baptista, A. P. Lourenco, S. M. Oliveira, A. Brandao-Nogueira, A. Teles, J. M. Fortunato, and A. F. Leite-Moreira Endogenous production of ghrelin and beneficial effects of its exogenous administration in monocrotaline-induced pulmonary hypertension Am J Physiol Heart Circ Physiol, December 1, 2004; 287(6): H2885 - H2890. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Pemberton, H. Tokola, Z. Bagi, A. Koller, J. Pontinen, A. Ola, O. Vuolteenaho, I. Szokodi, and H. Ruskoaho Ghrelin induces vasoconstriction in the rat coronary vasculature without altering cardiac peptide secretion Am J Physiol Heart Circ Physiol, October 1, 2004; 287(4): H1522 - H1529. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wu, M. Zhou, X. Cui, H. H. Simms, and P. Wang Upregulation of cardiovascular ghrelin receptor occurs in the hyperdynamic phase of sepsis Am J Physiol Heart Circ Physiol, September 1, 2004; 287(3): H1296 - H1302. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lin, N. Gletsu, K. Fugate, D. McClusky, L. H. Gu, J.-L. Zhu, B. J. Ramshaw, D. A. Papanicolaou, T. R. Ziegler, and C. D. Smith The Effects of Gastric Surgery on Systemic Ghrelin Levels in the Morbidly Obese Arch Surg, July 1, 2004; 139(7): 780 - 784. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Salfen, J. A. Carroll, D. H. Keisler, and T. A. Strauch Effects of exogenous ghrelin on feed intake, weight gain, behavior, and endocrine responses in weanling pigs J Anim Sci, July 1, 2004; 82(7): 1957 - 1966. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. van der Lely, M. Tschop, M. L. Heiman, and E. Ghigo Biological, Physiological, Pathophysiological, and Pharmacological Aspects of Ghrelin Endocr. Rev., June 1, 2004; 25(3): 426 - 457. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J Iglesias, R. Pineiro, M. Blanco, R. Gallego, C. Dieguez, O. Gualillo, J. R Gonzalez-Juanatey, and F. Lago Growth hormone releasing peptide (ghrelin) is synthesized and secreted by cardiomyocytes Cardiovasc Res, June 1, 2004; 62(3): 481 - 488. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-J. Pang, R.-K. Xu, X.-B. Xu, J.-M. Cao, C. Ni, W.-L. Zhu, K. Asotra, M.-C. Chen, and C. Chen Hexarelin protects rat cardiomyocytes from angiotensin II-induced apoptosis in vitro Am J Physiol Heart Circ Physiol, March 1, 2004; 286(3): H1063 - H1069. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Poykko, E. Kellokoski, S. Horkko, H. Kauma, Y. A. Kesaniemi, and O. Ukkola Low Plasma Ghrelin Is Associated With Insulin Resistance, Hypertension, and the Prevalence of Type 2 Diabetes Diabetes, October 1, 2003; 52(10): 2546 - 2553. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. A. Cupples Peptides that regulate food intake Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2003; 284(6): R1370 - R1374. [Full Text] [PDF] |
||||
![]() |
D. E. Cummings and M. H. Shannon Roles for Ghrelin in the Regulation of Appetite and Body Weight Arch Surg, April 1, 2003; 138(4): 389 - 396. [Full Text] [PDF] |
||||
![]() |
J. J. Kuo, O. B. Jones, and J. E. Hall Chronic cardiovascular and renal actions of leptin during hyperinsulinemia Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2003; 284(4): R1037 - R1042. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Baldanzi, N. Filigheddu, S. Cutrupi, F. Catapano, S. Bonissoni, A. Fubini, D. Malan, G. Baj, R. Granata, F. Broglio, et al. Ghrelin and des-acyl ghrelin inhibit cell death in cardiomyocytes and endothelial cells through ERK1/2 and PI 3-kinase/AKT J. Cell Biol., December 23, 2002; 159(6): 1029 - 1037. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.L. Barreiro, F. Gaytan, J.E. Caminos, L. Pinilla, F.F. Casanueva, E. Aguilar, C. Dieguez, and M. Tena-Sempere Cellular Location and Hormonal Regulation of Ghrelin Expression in Rat Testis Biol Reprod, December 1, 2002; 67(6): 1768 - 1776. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lucidi, G. Murdolo, C. Di Loreto, A. De Cicco, N. Parlanti, C. Fanelli, F. Santeusanio, G. B. Bolli, and P. De Feo Ghrelin Is Not Necessary for Adequate Hormonal Counterregulation of Insulin-Induced Hypoglycemia Diabetes, October 1, 2002; 51(10): 2911 - 2914. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Nagaya, M. Uematsu, M. Kojima, Y. Date, M. Nakazato, H. Okumura, H. Hosoda, W. Shimizu, M. Yamagishi, H. Oya, et al. Elevated Circulating Level of Ghrelin in Cachexia Associated With Chronic Heart Failure: Relationships Between Ghrelin and Anabolic/Catabolic Factors Circulation, October 23, 2001; 104(17): 2034 - 2038. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |