|
|
||||||||
1 Ocean Research Institute, the University of Tokyo, Nakano-ku, Tokyo 164 - 8639; 2 Nippon Paint Company Limited, Shinagawa-ku, Tokyo 140 - 8675; and 3 Department of Biological Sciences, Tokyo Institute of Technology, Midori-ku, Yokohama 226 - 8501, Japan
| |
ABSTRACT |
|---|
|
|
|---|
C-type natriuretic peptide (CNP) is recognized as a paracrine factor acting locally in the brain and periphery. To assess the role of CNP in teleost fish, a cDNA encoding a CNP precursor was initially cloned from the eel brain. CNP message subsequently detected by ribonuclease protection assay, using the cDNA as probe, was most abundant in the brain followed by liver, gut, gills, and heart. Expression was generally higher in freshwater (FW) than in seawater (SW) eels, but not in the brain. Plasma CNP concentration measured by a newly developed homologous radioimmunoassay for eel CNP was higher in FW than in SW eels. The CNP concentration was also higher in the heart of FW eels but not in the brain. These results show that CNP is abundantly synthesized in peripheral tissues of FW eels and secreted constitutively into the circulation. Therefore, CNP is a circulating hormone as well as a paracrine factor in eels. Together with our previous demonstration that CNP-specific receptor expression is enhanced in FW eels, it appears that CNP is a hormone important for FW adaptation. Because atrial NP (ANP) promotes SW adaptation in eels, CNP and ANP, despite high sequence identity, appear to have opposite effects on environmental adaptation of the euryhaline fish.
cDNA cloning of eel CNP; natriuretic peptide family; tissue distribution of CNP mRNA; radioimmunoassay of eel CNP; osmoregulation
| |
INTRODUCTION |
|---|
|
|
|---|
C-TYPE NATRIURETIC PEPTIDE (CNP) belongs to a family of peptides that shares a unique 17-amino acid ring structure within the molecule. Among the family members, atrial NP (ANP) and brain NP (BNP) are circulating hormones secreted from the heart and play important roles in cardiovascular and body fluid homeostasis (2, 33). By contrast, CNP is principally an autocrine/paracrine factor whose function has not yet been fully elucidated. CNP was first identified in 1990 in the brain of mammals and fish as a third member of the NP family (22, 30, 36) and was initially thought to be a neuropeptide. Since then, its presence and gene expression have been demonstrated in a number of peripheral tissues including the adrenal medulla, intestine, kidney, vascular endothelium, and chondrocytes (19). Because CNP concentration in plasma is extremely low in mammals (4, 7), CNP may function as a paracrine factor in these peripheral organs.
Comparative biochemical studies of the NP family members have been carried out extensively in a variety of vertebrate species, and their structures have been determined. Comparison of the amino acid sequences revealed that, of the NP family, CNP is most highly conserved among the members, suggesting its important function throughout vertebrates (5, 33). In cartilaginous fishes that diverged earlier from the main trunk of vertebrate evolution than did bony fishes, only CNP has been identified in the heart and brain (25, 31, 32). Thus CNP may be an ancestral molecule of the NP family. Unlike ANP and BNP genes that are localized in tandem on the same chromosome, the CNP gene is on a different chromosome (39). It is likely, therefore, that the ANP (or BNP) gene was duplicated from the CNP gene after the divergence of cartilaginous fishes, and the duplication of ANP/BNP gene occurred later in vertebrate phylogeny. For these reasons, CNP may be a good material in which to pursue the original function of the NP family, but its function is the least understood among the family members.
Except in mammals, the components of the NP system including the receptors have been well characterized only in a teleostean species, the eel. Currently, three ligands [ANP, ventricular NP (VNP), and CNP] and four NP receptors (NPR-A, NPR-B, NPR-C, and NPR-D) have been identified in this species (33). With respect to the ligands, ANP, CNP, and VNP were isolated from the atrium, brain, and ventricle, respectively, and cDNA clones were obtained for ANP and VNP (37, 38). However, cDNA for eel CNP has not yet been cloned. The biological action of ANP has been well characterized in eels; it has been revealed that ANP is important for seawater (SW) adaptation (33). However, an osmoregulatory role of CNP has not yet been examined in the eel except that the expression of NPR-B, a specific receptor for CNP (16), is augmented in the osmoregulatory organs of freshwater (FW) eels (14).
In the present study, we initially isolated a cDNA clone encoding eel CNP from the eel brain and characterized it. Using the cDNA as a probe, we examined the expression of CNP mRNA in various tissues of FW and SW eels by RNase protection assay and RT-PCR. Based on the sequence information, mature eel CNP-22 was synthesized and a homologous radioimmunoassay for eel CNP was established. Using the radioimmunoassay, we measured CNP concentrations in plasma and in major CNP-producing tissues in both FW and SW eels. The results showed that CNP synthesis is strongly enhanced in FW eels and that a large amount of CNP is circulating in the blood of FW eels, suggesting that CNP may be involved in adaptation of the euryhaline fish to FW environments.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Animals
Cultured, immature eels, Anguilla japonica, were purchased from a local dealer. They were maintained without feeding in a 1-ton FW tank or a half-ton SW tank for at least 2 wk before use. For the experiments comparing FW and SW eels, eels were purchased at the same time and acclimated for the same period to either medium. Water in the tank was continuously circulated, aerated, and regulated at 18°C.cDNA Cloning of Eel CNP
Materials. Restriction enzymes, DNA ligation kit, and random primer DNA labeling kit were obtained from Takara; the plasmid vector pBluescript II and RNA transcription kit from Stratagene; nitrocellulose filters (BA 85, 0.45 µm) from Schleicher and Schuell; Magnagraph from Micron Separations; RNA size markers and RNase A from Boehringer Mannheim; RNase T1 from Gibco; 32P-labeled nucleotides from New England Nuclear Research Division; X-Omat AR X-ray film from Kodak; and 5'-end labeling kit from Amersham.
Screening. A previously constructed eel brain cDNA library (13) was used for screening of eel CNP cDNA. The probe for screening was 50-mer oligonucleotide, GGCTGGAACCGAGGCTGCTTTGGCCTCAAGCTGGATCGGATTGGCTCCCT, synthesized based on the amino acid sequence of eel CNP (36); the codons were chosen based on the codon usage frequency. Approximately 7 × 105 plaques from the eel brain cDNA library were plated at a density of 30,000 plaques/15-cm plate. Duplicate plaque lifts were prepared with nitrocellulose filters. The filters were prehybridized for 2 h and then hybridized for 16 h at 37°C in the presence of probes labeled with 32P by 5'-end labeling kit. Prehybridization and hybridization buffer contained 6× NaCl/Cit (0.15 M NaCl and 15 mM sodium citrate, pH 7.0), 5× Denhardt's solution (0.1% each of bovine serum albumin, polyvinylpyrrolidone, and Ficoll), and 0.1% SDS. After hybridization, filters were washed twice with 2× NaCl/Cit containing 0.05% SDS at room temperature for 5 min, once with 2× NaCl/Cit at 37°C for 1 h, and then with 1× NaCl/Cit at 37°C for 1 h. After autoradiography, double positive plaques were rescreened until a cDNA clone was isolated. DNA sequences were determined by the dideoxynucleotide chain-termination method (26) using a DNA sequencer (4000LS Long ReadIRTM).
Northern blot analysis. Total RNA (20 µg) obtained from eel brain was separated by electrophoresis with 1% agarose gel containing 2.2 M formamide, 20 mM MOPS, 8 mM sodium acetate, and 1 mM EDTA, pH 7.0. After electrophoresis, the separated RNA was transferred to a nylon membrane and chemically cross-linked with ultraviolet light. The membrane was prehybridized for 3 h at 42°C in 50% formamide, 5× SSPE (0.15 M NaCl, 15 mM NaH2PO4, and 1 mM EDTA, pH 7.0), 5× Denhardt's solution, 100 µg/ml denatured herring sperm DNA, and 1% SDS and then hybridized with 1× 106 cpm/ml of 5'-end 32P-labeled probe for 16 h. The membrane was washed twice with 2× NaCl/Cit containing 0.05% SDS at room temperature for 5 min and once with 1× NaCl/Cit containing 0.1% SDS at 60°C for 1 h. The membrane was then exposed to an imaging plate for 10 h, which was observed in a FLA 2000 imaging analyzer (Fuji Film).
Detection of CNP mRNA Expression
RNase protection analysis.
After anesthesia in 0.1% (wt/vol) tricaine methanesulphonate, the
brain, gill, cardiac atrium, ventricle, liver, esophagus, stomach,
intestine, kidney, and head kidney including interrenal tissues were
immediately dissected out from three FW and three SW eels. Total RNA
was extracted from pooled tissues by the acid guanidinium
thiocyanate/phenol/chloroform method (3). For the synthesis of antisense cRNA probe, template DNA was prepared by subcloning the 169-bp SalI-HincII fragment of the
eel CNP cDNA into pBluescript II and linearizing it with
SalI. Antisense cRNA probe was transcribed in vitro using T3
RNA polymerase and
-[32P]UTP. After the transcription
reaction, the template DNA was removed by digestion with RNase-free
DNase I. The radioactive cRNA probe (1 × 105 cpm) was
annealed with 10 µg of RNA for 12 h at 45°C in 80% formamide, 40 mM PIPES, 5 mM EDTA, and 400 mM NaCl, pH 6.4. Nonannealing nucleotides were then digested with RNases A and T1 at final
concentrations of 40 and 2 µg, respectively, in a buffer containing
10 mM Tris · HCl, 300 mM NaCl, and 5 mM EDTA, pH 7.4, at 30°C
for 1 h. The protected fragment was purified by phenol/chloroform
extraction, precipitated with ethanol, and electrophoresed in a 5%
polyacrylamide gel containing 7 M urea. The gels were dried and exposed
to X-Omat AR films with an intensifying screen at
80°C.
Analysis by RT-PCR. Total RNA was extracted using Isogen (Nippon Gene) from various tissues of three FW and three SW eels. The cartilaginous tissue (gill arch) and arterial tissue (dorsal aorta) were added, because local synthesis and action of CNP have been demonstrated in these tissues of mammals (6, 9). RT was performed using Superscript First-Strand Synthesis System for RT-PCR (Life Technologies, Takara). The reaction mixture containing 50 U of Superscript II reverse transcriptase, 20 mM Tris · HCl (pH 8.4), 50 mM KCl, 5 mM MgCl2, 10 mM dithiothreitol, 0.5 mM dNTPs, 0.5 µg of oligo(dT)12-18 primer, and 5 µg RNA was incubated at 42°C for 50 min and then at 70°C for 15 min. For detection of CNP gene transcripts, 25 µl of Ex Taq buffer containing 1 µl reverse-transcribed mixture (Takara), 0.2 mM dNTPs, 0.4 µM sense and antisense primers, and 0.625 U of Ex Taq (Takara) was prepared on ice, and 28 cycles of thermal sequential steps, 94°C for 30 s, 57°C for 30 s, and 72°C for 45 s, were started immediately. Primers used were eel CNP-(82-101), 5'-GAGCTAGACCAGAGACAACA-3', and eel CNP-(795-813), 5'-GGACCTTCACACTGCACTT-3'. Furthermore, to determine the source of CNP secreted into the circulation in FW eel, we collected the heart (atrium plus ventricle), anterior intestine (including esophagus and stomach), and gills from six FW eels (body weight: 185.0 ± 3.1 g) and six SW eels (body weight: 182.3 ± 7.1 g) to compare the CNP expression, because these tissues expressed more CNP message in FW than in SW fish in the above experiment in spite of high variability of data. In this experiment, cycles for thermal sequential steps were increased to 30 to enhance the sensitivity of detection. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene transcripts were used as an internal standard. GAPDH is expressed ubiquitously in most tissues and used as an internal control for specific gene expression (41). A partial cDNA sequence for eel GAPDH (deposited to DNA Data Bank of Japan: AB049458) was obtained by RT-PCR using consensus primers designed from corresponding sequences of other fish GAPDH. From the obtained eel sequence, a sense primer, 5'-CATTGGTCGCCTGGTCCTCA-3', and an antisense primer, 5'-ATGCCCGTCAGCTTCCCGTT-3', were designed. RT-PCR for detection of GAPDH gene transcripts was carried out by the same protocol as for CNP except for annealing temperature (62°C). PCR products were electrophoresed onto 1.5% agarose gels and stained with ethidium bromide; the signal intensity was quantified on a Fuji FLA-2000 imaging analyzer.
Radioimmunoassay for Eel CNP
Antibody production. Synthetic eel CNP-22 was conjugated with bovine thyroglobulin and injected alone or in combination with an equal volume of Freund's complete adjuvant (Difco Laboratories) into 10 Japanese White rabbits. To raise specific antisera that do not cross-react with eel ANP and VNP that have >60% sequence identity to CNP, we initially injected the antigen at low doses (30 µg) with the complete adjuvant and then left the animals uninjected for 1 mo to select the clone(s) in vivo; then the titer of the selected clone(s) was increased gradually by increasing the dose of antigen over 8 mo as described previously (34). However, only two of 10 rabbits raised antisera that are usable for radioimmunoassay in terms of specificity, affinity, and titer.
Iodination of ligand.
Eel CNP-22 with a tyrosine residue added to the NH2
terminus (eel [Tyr0]CNP) was synthesized and iodinated by
the lactoperoxidase method as described previously (34).
Eel 125I-labeled [Tyr0]CNP was purified by
reverse-phase HPLC in an ODS-120T column with a linear gradient of
acetonitrile in 0.1% trifluoroacetic acid from 15 to 60% for 60 min.
This HPLC condition can separate monoiodinated CNP from noniodinated
CNP as well as from di-iodinated CNP. The purified monoiodinated CNP
was dissolved in assay buffer (10 nM phosphate buffer, pH 7.4, containing 140 mM NaCl, 10 mM 2K-EDTA, 20 mM glycine, 10 mM
-aminocapronic acid, 1 mM sodium azide, and 0.1% Triton X-100)
containing 5% BSA (RIA grade, Sigma) as a quencher and stored in
aliquots at
20°C until use. The labeled ligands were used within 2 mo of iodination. The specific activity was calculated as 2,160 Ci/mmol
on the day of iodination.
Procedures for radioimmunoassay. The radioimmunoassay was performed by a double antibody method as reported previously (34). Briefly, samples were mixed with anti-CNP serum (#1, 1:5,000 dilution) and preincubated for 20 h at 4°C. Eel 125I-[Tyr0]CNP (5,000 cpm) was then added, incubated further for 24 h at 4°C, and bound radioligands were separated from unbound forms after the addition of goat anti-rabbit IgG serum and polyethylene glycol 8000 (Sigma). The amount of CNP in the sample was read on the standard curve for eel CNP-22 after fitting to a logistic curve. The nonspecific binding of radioligand to the tube was 1.4 ± 0.1% (n = 3), and the radioligand bound to the antibody without cold ligands was 17.3 ± 1.4% (n = 3). The recovery of eel CNP added to the plasma was 93.5 ± 2.9% (n = 3).
Preparation of plasma and tissue samples.
Six FW and eight SW eels were anesthetized as above, and 2-2.5 ml
of blood was collected from the caudal vein into the chilled syringe
containing 1.2 mg 2K-EDTA/ml blood. Subsequently, the brain and the
heart were dissected out, the latter being separated into atrium and
ventricle and frozen on dry ice. The blood was centrifuged at
2,200 g for 15 min, and plasma was stored at
20°C until assayed. The tissues were boiled for 5 min in 1 ml of 0.1 M
acetic acid, homogenized at 4°C for 90 s in Polytron homogenizer at the maximum speed, and centrifuged at 250,000 g for
15 min. The supernatant was lyophilized and reconstituted in 1 ml assay buffer for radioimmunoassay.
Statistical analysis. Differences in CNP concentrations between FW and SW eels were compared with Student's t-test. The values are expressed as means ± SE.
| |
RESULTS |
|---|
|
|
|---|
Isolation of Eel CNP cDNA
By screening 7 × 105 plaques, we detected 32 positives, 14 of which were plaque purified and sequenced. Sequencing of these clones revealed that a clone named
eCnp1.6 contained an
insert of 1.6 kb covering the entire CNP coding region (Fig.
1). The prepro-CNP consisted of 131 amino
acid residues with two Met residues at the translation initiation site.
A signal sequence consisting of 20 amino acid residues, assessed by
analogy to shark pro-CNP (31), was present at the
NH2 terminus of prepro-CNP and the mature CNP-22 was
present at the COOH terminus. In the 3'-untranslated region, six
repetitions of ATTTA sequence and two polyadenylation signals were
detected. Except for the CNP-22 sequence in which only four amino acid
residues are different between eel and mammals, eel CNP sequence
exhibited <15% identity with other CNPs identified to date (Fig.
2). The Northern blot analysis showed
that the predominant mRNA expressed in the eel brain had a size of
~1.6 kb (Fig. 3).
|
|
|
RNase Protection Assay and RT-PCR
The RNase protection analysis showed that high levels of transcripts of eel CNP gene were detected in the brain of both FW and SW eels (Fig. 4). Low levels were found in the atrium, ventricle, and liver of FW eels but not in SW eels. No apparent signals were detected in other tissues examined with this method. However, RT-PCR detected more extensive expression of CNP signals in various tissues such as the gills, digestive tract, and kidney (Fig. 5). The expression was generally higher in FW than in SW eels. Quantitative analysis using eel GAPDH as an internal control showed that CNP message was highly expressed in the brain and liver and moderately in the gills, heart, and digestive tract (Fig. 6). The high expression in the liver is due to the low relative expression of GAPDH with the same amount of mRNA. The level of expression did not differ in the brain and liver of FW and SW eels but appeared higher in the gill and heart of FW eels than of SW eels. Statistical comparisons using six fish in each group showed that the difference was significant in the heart (1.80 ± 0.10 in FW vs. 1.46 ± 0.10 in SW by the ratio of CNP-GAPDH) and digestive tract (0.89 ± 0.03 in FW vs. 0.63 ± 0.07 in SW), but not in the gill.
|
|
|
Measurement of Plasma and Tissue CNP Concentrations
The antiserum used in the radioimmunoassay for eel CNP (#1) had ~1% cross-reactivity with human CNP and <0.1% cross-reactivity with dogfish CNP, human ANP, and human BNP. More importantly, the antiserum had <0.1% cross-reactivity with eel ANP and VNP. The minimum detectable quantity of eel CNP was 0.63 fmol/tube, and half-maximal effective dose of the standard curve was 4.8 fmol/tube (Fig. 7). Because of the high sensitivity, plasma CNP concentration could be measured directly with less than 0.1 ml of plasma without extraction. Serial dilutions of eel plasma with assay buffer produced curves parallel to the standard curve for synthetic eel CNP-22 (Fig. 7).
|
Plasma CNP concentration measured by the homologous radioimmunoassay
was more than fivefold higher in eels adapted to FW than those adapted
to SW (Fig. 8A). Both atrial
and ventricular concentrations of CNP were also higher in FW eels than
in SW eels; however, CNP concentration in the brain did not differ
between the two groups (Fig. 8B).
|
| |
DISCUSSION |
|---|
|
|
|---|
cDNA Cloning and mRNA Expression of Eel CNP
The amino acid sequence of CNP has been determined in a variety of vertebrate species ranging from cartilaginous fish to mammals. However, its cDNA has been cloned only from the shark (25) and frog (15) in nonmammalian species except for venom-specific CNP from the snake Bothrops jararaca (21). In the present study, we isolated and sequenced a cDNA of eel CNP, thus adding a teleostean species to the list of CNP cDNAs. Comparing the prepro-CNP sequences known to date, we find that only mature CNP-22 sequence is conserved across different species. The high variability of the pro-CNP sequence is consistent with the fact that CNP is an ancestral molecule of the NP family and thus has the longest history of evolution among the family members (33). Conversely, the high conservation of mature CNP-22 sequence indicates its important physiological function throughout vertebrate species, probably through the restraint imposed by the interaction with its specific receptor, NPR-B.The synthesis and storage of CNP have been demonstrated in a number of tissues and its local regulatory function has been suggested in mammals (19). In the brain, CNP is dipsogenic (24) and inhibits vasopressin secretion (28). CNP has been established as an endothelium-derived relaxing factor and growth-regulating factor involved in vascular remodeling (9). CNP is also involved locally in the proliferation and growth of chondrocytes (6) and osteoblasts (29). The presence of CNP and its local action are likely in the kidney (40) and intestine (10). The current study showed that CNP message was abundantly expressed in the brain, followed by the liver, heart, intestine, and gills of the eel. However, biological actions of CNP in these tissues have not been examined yet in eels, except for the observation of a weak inhibitory action on intestinal NaCl absorption (17). Compared with mammals, the expression of CNP gene was low in the blood vessel, cartilage, and kidney of eels.
CNP as a Circulating Hormone in Eels
In mammals, ANP and BNP are circulating hormones secreted from the heart in response to an increase in blood volume (23). However, CNP is principally an autocrine/paracrine factor, and its plasma concentration is extremely low compared with ANP and BNP (4, 7). In eels, ANP and VNP are cardiac hormones circulating in the blood whose secretion is regulated by plasma osmolality rather than blood volume (12). Because CNP is isolated from the brain in the eel as well (36), CNP may be a paracrine factor in the brain of this fish. However, the present study showed that CNP circulates at high concentrations in the blood of FW eels. CNP is also a circulating hormone as well as a paracrine factor in the dogfish Triakis scyllia (32). It seems, therefore, that CNP, which still retains the ancestral nature of the NP family, is both a paracrine factor and a circulating hormone in phylogenetically ancient vertebrates. After gene duplication, however, ANP and BNP (VNP) took over the endocrine role and have been synthesized and secreted from the heart. Consequently, the role of CNP has been limited to a local paracrine action in higher vertebrates.One of the major sources of plasma CNP in the eel may be the heart, as demonstrated in the shark (32). The supportive data are that both atrium and ventricle synthesize and store substantial amounts of CNP and that enhanced synthesis of cardiac CNP is correlated well with increased plasma CNP concentration as observed in FW eels. The brain synthesizes and stores CNP most abundantly, but there were no differences between FW and SW eels. Compared with the high ANP content in the heart, the cardiac CNP content seems insufficient to be a source of plasma CNP. However, it is shown that ANP is stored in the granules and secreted in response to osmotic or volemic stimuli (2, 33), whereas cardiac CNP may be released constitutively into the circulation without being stored in the granules. A rather low level of CNP mRNA in the heart compared with the plasma CNP level may be due to its quick turnover as suggested by the presence of repetitive AUUUA sequences in the 3'-noncoding region (27). The mRNA of BNP also has similar repetitive sequences, and its product is secreted constitutively into the circulation (20).
Plasma ANP concentration increases transiently for a few hours after FW eels are transferred to SW and returns to an FW level after adaptation to SW (11). However, plasma CNP concentration was higher in eels adapted to FW than those in SW as shown in this study. The difference in the response to environmental salinity also supports the constitutive nature of CNP secretion. ANP is stored in the atrial granules and secreted via a regulatory pathway in response to an increase in plasma osmolality in eels (12). However, because ANP disappears quickly from the circulation (the half-life of eel ANP is ~90 s, H. Kaiya and Y. Takei, unpublished data), the increase in plasma ANP concentration is only transient. By contrast, high plasma CNP concentration is maintained in FW eels, probably because elevated constitutive secretion continues in association with the enhanced expression of CNP gene in FW environments.
Physiological Function of CNP in Eels
As discussed above, CNP synthesis and secretion are augmented in peripheral tissues of FW eels, so that significant amounts of CNP are circulating in the blood of FW eels. In a previous study, we showed that the CNP-specific receptor NPR-B is more abundantly expressed in osmoregulatory organs of FW eels than in those of SW eels (14). Thus a CNP/NPR-B system may play a role in adaptation of eels to FW environments. The way in which CNP promotes FW adaptation is not fully understood; however, our recent data show that the infusion of CNP into FW eels increases plasma Na+ concentration and enhances radioactive 22Na uptake from the environment (Y. Takei and J. C. Rankin, unpublished data). These results indicate that CNP increases Na+ uptake by the gill and promotes FW adaptation. CNP may act in a paracrine fashion as well as from the blood in the gills, because the gills synthesize appreciable amounts of CNP as observed in the present study.Perspectives
Although ANP and CNP are members of the same hormone family, ANP appears to be involved in SW adaptation of eels (33), whereas CNP may be involved in FW adaptation as suggested in this study. Therefore, although ANP and CNP share high sequence similarity (71.4%), they promote euryhaline eels' adaptation to opposite osmotic environments, indicating that the NP family is important for the excellent osmotic adaptability of eels. This dissociation of the effects can be achieved by the distinct specific receptors [ANP for NPR-A or guanylyl cyclase (GC)-A and CNP for NPR-B or GC-B]. The eel has another member of the NP family, VNP, that also shares high sequence identity with ANP and CNP. Because VNP has considerably high affinity to NPR-B as well as NPR-A in eels (14), it is likely that VNP assists ANP and CNP to promote the euryhaline fish's adaptation to SW and FW, respectively.ANP and CNP are oligopeptide hormones that are secreted immediately in response to changes in environmental salinity. It is generally thought that these fast-acting hormones stimulate the secretion of slow-acting hormones that are important for long-term adaptation to a new environment. Long-acting osmoregulatory hormones in teleost fish that have been suggested thus far are prolactin for FW adaptation (8) and cortisol and growth hormone for SW adaptation (1, 18). Interestingly, plasma prolactin concentration is maintained at a high level when euryhaline fish are in FW as is CNP, whereas plasma cortisol and growth hormone concentrations increase only transiently after the transfer of the fish from FW to SW as observed with ANP (11). Therefore, it is likely that ANP and CNP stimulate the release of these long-acting hormones for SW and FW adaptation, respectively. In fact, eel ANP stimulates cortisol secretion in SW eels but not in FW eels (35). Therefore, it is interesting to examine whether ANP stimulates growth hormone secretion and whether CNP stimulates prolactin secretion in the euryhaline teleost species.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. S. Hyodo and H. Sakaguchi of Ocean Research Institute and Dr. M. Itakura of Tokyo Institute of Technology for discussion. We also thank S. Hasegawa of Ocean Research Institute and S. Satoh and K. Tanaka of Tokyo Institute of Technology for excellent technical assistance.
| |
FOOTNOTES |
|---|
This work was supported by grants-in-aid for Specially Promoted Grant (01902008) and for Creative Basic Research (12NP0201) from the Ministry of Education, Science, Sports and Culture of Japan; by a research grant for Cardiovascular Diseases from the Ministry of Health and Welfare of Japan; and by an SRF Grant for Biomedical Research.
Address for reprint requests and other correspondence: Y. Takei, Div. of Physiology, Dept. of Marine Bioscience, Ocean Research Institute, Univ. of Tokyo, 1-15-1 Minamidai, Nakano-ku, Tokyo 164-8639, Japan (E-mail: takei{at}ori.u-tokyo.ac.jp).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 18 September 2000; accepted in final form 9 February 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Balment, RJ,
Hazon N,
and
Perrott MN.
Control of corticosteroid secretion and its relation to osmoregulation in lower vertebrates.
In: Comparative Physiology of Environmental Adaptations. I. Adaptation to Salinity and Dehydration, edited by Kirsch R,
and Lahlou B.. Basel: Karger, 1987, p. 92-102.
2.
Brenner, BM,
Ballermann BJ,
Gunning ME,
and
Zeidel ML.
Diverse biological actions of atrial natriuretic peptide.
Physiol Rev
70:
665-699,
1990
3.
Chomczynski, P,
and
Sacchi N.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[Web of Science][Medline].
4.
Clavell, AL,
Stingo AJ,
Wei CM,
Heublein DM,
and
Burnett JC, Jr.
C-type natriuretic peptide: a selective cardiovascular peptide.
Am J Physiol Regulatory Integrative Comp Physiol
264:
R290-R295,
1993
5.
Evans, DH.
An emerging role for a cardiac peptide hormone in fish osmoregulation.
Annu Rev Physiol
52:
43-60,
1990[Web of Science][Medline].
6.
Hagiwara, H,
Sakaguchi H,
Itakura M,
Yoshimoto T,
Furuya M,
Tanaka S,
and
Hirose S.
Autocrine regulation of rat chondrocyte proliferation by natriuretic peptide C and its receptor, natriuretic peptide receptor B.
J Biol Chem
269:
10729-10733,
1994
7.
Hama, N,
Itoh H,
Shirakami G,
Suga S,
Komatsu Y,
Yoshimasa T,
Tanaka I,
Mori K,
and
Nakao K.
Detection of C-type natriuretic peptide in human circulation and marked increase of plasma CNP level in septic shock patients.
Biochem Biophys Res Commun
198:
1177-1182,
1994[Web of Science][Medline].
8.
Hirano, T,
Ogasawara T,
Bolton JP,
Collie NL,
Hasegawa S,
and
Iwata M.
Osmoregulatory role of prolactin in lower vertebrates.
In: Comparative Physiology of Environmental Adaptations. I. Adaptation to Salinity and Dehydration, edited by Kirsch R,
and Lahlou R.. Basel: Karger, 1987, p. 112-124.
9.
Itoh, H,
Suga S,
Ogawa Y,
Komatsu Y,
Tamura N,
Igaki T,
Yamashita J,
Ikeda T,
Doi K,
Chun TT,
Inoue M,
Matsuda K,
Yoshimura T,
Ueda M,
Ban T,
and
Nakao K.
Significance of vascular natriuretic peptide system in vascular remodeling in humans and its application to gene therapy.
Ann NY Acad Sci
811:
533-541,
1997[Web of Science][Medline].
10.
Kagawa, K,
Suzuki S,
Matsushita K,
Uemura N,
Morita H,
and
Hosomi H.
Relationship between the suppressive actions on intestinal absorption and on cGMP production for the natriuretic peptide family in dogs.
Clin Exp Pharmacol Physiol
21:
83-92,
1994[Web of Science][Medline].
11.
Kaiya, H,
and
Takei Y.
Atrial and ventricular natriuretic peptide concentrations in plasma of freshwater- and seawater-adapted eels.
Gen Comp Endocrinol
102:
183-190,
1996[Web of Science][Medline].
12.
Kaiya, H,
and
Takei Y.
Osmotic and volaemic regulation of atrial and ventricular natriuretic peptide secretion in conscious eels.
J Endocrinol
149:
441-447,
1996
13.
Kashiwagi, M,
Katafuchi T,
Kato A,
Inuyama H,
Ito T,
Hagiwara H,
Takei Y,
and
Hirose S.
Cloning and properties of a novel eel natriuretic peptide receptor, NPR-D.
Eur J Biochem
233:
102-109,
1995[Web of Science][Medline].
14.
Katafuchi, T,
Takashima A,
Kashiwagi M,
Hagiwara H,
Takei Y,
and
Hirose S.
Cloning and expression of eel natriuretic peptide receptor B (NPR-B) and comparison with the mammalian counterparts.
Eur J Biochem
222:
835-842,
1994[Web of Science][Medline].
15.
Kojima, M,
Ohyama Y,
Miyamoto K,
Minamino N,
Kangawa K,
and
Matsuo H.
Cloning and characterization of a novel natriuretic peptide in frog (Rana catesbeiana).
J Biol Chem
269:
13136-13140,
1994
16.
Koller, KJ,
Lowe DG,
Bennett GL,
Minamino N,
Kangawa K,
Matsuo H,
and
Goeddel DV.
Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide.
Science
252:
120-123,
1991
17.
Loretz, CA,
and
Takei Y.
Natriuretic peptide inhibition of intestinal salt absorption in the Japanese eel: physiological significance.
Fish Physiol Biochem
17:
319-324,
1997.
18.
McCormick, SD.
Hormonal control of gill Na+,K+-ATPase and chloride cell function.
In: Cellular and Molecular Approaches to Fish Ionic Regulation, edited by Wood CM,
and Shuttleworth TJ.. San Diego: Academic, 1995, p. 285-316.
19.
Minamino, N,
Aburaya M,
Kojima M,
Miyamoto K,
Kangawa K,
and
Matsuo H.
Distribution of C-type natriuretic peptide and its messenger RNA in rat central nervous system and peripheral tissue.
Biochem Biophys Res Commun
197:
326-335,
1993[Web of Science][Medline].
20.
Mukoyama, M,
Nakao K,
Hosoda K,
Suga S,
Saito Y,
Ogawa Y,
Shirakami G,
Jougasaki M,
Obata K,
Yasue H,
Kambayashi Y,
Inoue K,
and
Imura H.
Brain natriuretic peptide as a novel cardiac hormone in humans.
J Clin Invest
87:
1402-1412,
1991.
21.
Murayama, M,
Hayashi MAF,
Ohi H,
Ferreira LAF,
Hermann VV,
Saito H,
Fujita Y,
Higuchi S,
Fernandes BL,
Yamane T,
and
de Camargo ACM
Cloning and sequence analysis of a Bothrops jararaca cDNA encoding a precursor of seven bradykinin-potentiating peptides and a C-type natriuretic peptide.
Proc Natl Acad Sci USA
94:
1189-1193,
1997
22.
Price, DA,
Doble KE,
Lee TD,
Galli SM,
Dunn BM,
Parten B,
and
Evans DH.
The sequencing, synthesis, and biological actions of an ANP-like peptide isolated from the brain of killifish, Fundulus heteroclitus.
Biol Bull
187:
279-285,
1990[Web of Science].
23.
Ruskoaho, H.
Atrial natriuretic peptide: synthesis, release, and metabolism.
Pharmacol Rev
44:
479-602,
1992[Web of Science][Medline].
24.
Samson, WK,
Skala KD,
and
Huang FLS
CNP-22 stimulates, rather than inhibits, water drinking in the rat: evidence for a unique biological action of the C-type natriuretic peptide.
Brain Res
568:
285-288,
1991[Web of Science][Medline].
25.
Schofield, JP,
Jones DS,
and
Forrest JN, Jr.
Identification of C-type natriuretic peptide in heart of spiny dogfish shark (Squalus acanthias).
Am J Physiol Renal Fluid Electrolyte Physiol
261:
F734-F739,
1991
26.
Seino, S,
Seino M,
Nishi S,
and
Bell GI.
Structure of the human insulin receptor gene and characterization of its promotor.
Proc Natl Acad Sci USA
86:
114-118,
1989
27.
Shaw, G,
and
Kamen R.
A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation.
Cell
46:
659-667,
1986[Web of Science][Medline].
28.
Shirakami, G,
Itoh H,
Suga S,
Komatsu Y,
Hama N,
Mori K,
and
Nakao K.
Central action of C-type natriuretic peptide on vasopressin secretion in conscious rats.
Neurosci Lett
159:
25-28,
1993[Web of Science][Medline].
29.
Suda, M,
Tanaka K,
Fukushima M,
Natsui K,
Yasoda A,
Komatsu Y,
Ogawa Y,
Itoh H,
and
Nakao K.
C-type natriuretic peptide as an autocrine/paracrine regulator of osteoblast. Evidence for possible presence of bone natriuretic peptide system.
Biochem Biophys Res Commun
223:
1-6,
1996.
30.
Sudoh, T,
Minamino N,
Kangawa K,
and
Matsuo H.
C-type natriuretic peptide (CNP): a new member of natriuretic peptide family identified in porcine brain.
Biochem Biophys Res Commun
168:
863-870,
1990[Web of Science][Medline].
31.
Suzuki, R,
Takahashi A,
Hazon N,
and
Takei Y.
Isolation of high-molecular-weight C-type natriuretic peptide from the heart of a cartilaginous fish (European dogfish, Scyliorhinus canicula).
FEBS Lett
282:
321-325,
1991[Web of Science][Medline].
32.
Suzuki, R,
Togashi K,
Ando K,
and
Takei Y.
Distribution and molecular forms of C-type natriuretic peptide in plasma and tissues of a dogfish shark, Triakis scyllia.
Gen Comp Endocrinol
96:
378-384,
1994[Web of Science][Medline].
33.
Takei, Y.
Structural and functional evolution of the natriuretic peptide system in vertebrates.
Int Rev Cytol
194:
1-66,
2000[Web of Science][Medline].
34.
Takei, Y,
Ando K,
and
Kawakami M.
Atrial natriuretic peptide in eel plasma, heart and brain characterized by homologous radioimmunoassay.
J Endocrinol
135:
325-331,
1992
35.
Takei, Y,
and
Balment RJ.
Biochemistry and physiology of a family of natriuretic peptide in eels.
Fish Physiol Biochem
11:
183-188,
1993.
36.
Takei, Y,
Takahashi A,
Watanabe TX,
Nakajima K,
Sakakibara S,
Takao T,
and
Shimonishi Y.
Amino acid sequence and relative biological activity of a natriuretic peptide isolated from eel brain.
Biochem Biophys Res Commun
170:
883-891,
1990[Web of Science][Medline].
37.
Takei, Y,
Ueki M,
and
Nishizawa T.
Eel ventricular natriuretic peptide: cDNA cloning and mRNA expression.
J Mol Endocrinol
13:
339-345,
1994
38.
Takei, Y,
Ueki M,
Takahashi A,
and
Nishizawa T.
Cloning, sequence analysis, tissue-specific expression, and prohormone isolation of eel atrial natriuretic peptide.
Zoolog Sci
14:
993-999,
1997[Web of Science][Medline].
39.
Tamura, N,
Ogawa Y,
Yasoda A,
Itoh H,
Saito Y,
and
Nakao K.
Two cardiac peptide genes (atrial natriuretic peptide and brain natriuretic peptide) are organized in tandem in the mouse and human genomes.
J Mol Cell Cardiol
28:
1811-1815,
1996[Web of Science][Medline].
40.
Terada, Y,
Tomita K,
Nonoguchi H,
Yang T,
and
Marumo F.
PCR localization of C-type natriuretic peptide and B-type receptor mRNAs in rat nephron segments.
Am J Physiol Renal Fluid Electrolyte Physiol
267:
F215-F222,
1994
41.
Zhao, J,
Araki N,
and
Nishimoto SK.
Quantitation of matrix Gla protein mRNA by competitive polymerase chain reaction using glyceraldehyde-3-phosphate dehydrogenase as an internal control.
Gene
155:
159-165,
1995[Web of Science][Medline].
This article has been cited by other articles:
![]() |
K. R. Johnson and K. R. Olson The response of non-traditional natriuretic peptide production sites to salt and water manipulations in the rainbow trout J. Exp. Biol., September 15, 2009; 212(18): 2991 - 2997. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sengenes, A. Zakaroff-Girard, A. Moulin, M. Berlan, A. Bouloumie, M. Lafontan, and J. Galitzky Natriuretic peptide-dependent lipolysis in fat cells is a primate specificity Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2002; 283(1): R257 - R265. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takei and S. Hirose The natriuretic peptide system in eels: a key endocrine system for euryhalinity? Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2002; 282(4): R940 - R951. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |