AJP - Regu AJP: Cell Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 281: R1456-R1463, 2001;
0363-6119/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, S. H.
Right arrow Articles by Cho, K. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, S. H.
Right arrow Articles by Cho, K. W.
Vol. 281, Issue 5, R1456-R1463, November 2001

Attenuation of inhibitory effect of CNP on the secretion of ANP from hypertrophied atria

Suhn Hee Kim, Jeong Hee Han, Sung Hee Lim, Sook Jeong Lee, Sung Zoo Kim, and Kyung Woo Cho

Department of Physiology, Medical School, Institute for Medical Sciences, Jeonbug National University, Jeonju 560-180, Korea


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

It has been shown that atrial natriuretic peptide (ANP) influences proliferation of cardiac cells. To define the possible role of C-type natriuretic peptide (CNP) in cardiac hypertrophy, the influence of CNP on the secretion of ANP was studied with the use of perfused nonbeating atria from monocrotaline-treated rats. Increases in atrial volume caused proportional increases in ANP secretion that were markedly suppressed by CNP (10-6 M) in nonhypertrophied left atria and control right atria but not in hypertrophied right atria. However, increases in atrial volume and mechanically stimulated extracellular fluid (ECF) translocation by CNP were similar to those in the control group. Therefore, the secretion of ANP in terms of ECF translocation was decreased by CNP in nonhypertrophied left and control right atria but not in hypertrophied atria. However, the inhibitory effect of 8-bromo-cGMP on the secretion of ANP was observed in both atria. The cGMP productions from perfused hypertrophied atria and their membranes exposed to CNP were significantly lower than those from nonhypertrophied atria. No significant difference in natriuretic peptide receptor-B transcript was found. Therefore, attenuation of the inhibitory effect of CNP on the ANP secretion in hypertrophied atria may be due to lack of cGMP production. The results showing the relief of CNP-induced negative inhibition of ANP secretion by atrial hypertrophy suggest that CNP may be a contributing factor to delay the development of cardiac hypertrophy.

atrial natriuretic peptide; C-type natriuretic peptide; atrium; hypertrophy; monocrotaline; natriuretic peptide receptor; stretch; pulmonary hypertension


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE NATRIURETIC PEPTIDE FAMILY is composed of atrial natriuretic peptide (ANP) (9), brain natriuretic peptide (BNP) (36), and C-type natriuretic peptide (CNP) (37), which are involved in the regulation of blood pressure and fluid homeostasis. ANP and BNP primarily originate from heart and activate natriuretic peptide receptor (NPR)-A (10). CNP, a third member of the natriuretic peptide family, is found principally in the central nervous system and vascular endothelial cells and activates NPR-B (24). CNP has both structural and physiological similarities with ANP and BNP. All natriuretic peptides have an important role in the regulation of body fluid and blood pressure. However, CNP elicits natriuretic, diuretic, and hypotensive effects that are less potent compared with those of ANP and BNP (23, 33, 37). Because of low plasma level, wider distributions of CNP, and its diverse biological actions, CNP is considered to have autocrine/paracrine functions as a local regulator (12, 33).

In the cardiac atria, the natriuretic peptide family and their receptors have been found (28, 30). There are a few reports about intracardiac effects of natriuretic peptides and their cross talk. ANP and CNP cause an inhibition of proliferation of cardiac fibroblasts and myocytes (3, 4, 15). ANP may regulate its own release via NPR-A by atrial myocytes in an autocrine/paracrine manner (27). Beaulieu et al. (1) have reported a regulatory function of CNP in the dog heart showing positive chronotropic and inotropic effects by stimulation of NPR-B receptors. Recently, we found possible intracardiac cross talk of natriuretic peptides showing negative regulation of ANP secretion by CNP through the NPR-B-cGMP pathway in isolated perfused beating atria (26).

On the other hand, cardiac hypertrophy induced by volume overload or chronic hypoxia causes an activation of ANP synthesis (8, 29-31, 34, 35) and modification of the ANP system (2, 20, 21), even though its physiological significance is still not clear. It is also reported that endogenous ANP suppressively regulates the development of cardiac myocyte hypertrophy (15), and cardiac hypertrophy is observed in transgenic mice lacking NPR-A (32). Therefore, the activation of the ANP system can be understandable as one of the cardiac compensatory mechanisms via the vasodilatory effect on the pulmonary arteriole (25), the inhibitory effect on cardiac myocyte and fibroblast hypertrophy (4, 15), and the diuretic effect (14) to reduce the severity of pulmonary hypertension and right ventricular hypertrophy. Recently, we have reported that atrial hypertrophy causes the modification of ANP release by stretch and endothelin-1 in isolated perfused nonbeating rat atria (20). However, it is not clear whether the intracardiac cross talk of natriuretic peptides is modified by atrial hypertrophy. Therefore, to determine the physiological role of CNP in atrial hypertrophy, the modification of the inhibitory effect of CNP on ANP secretion was investigated in hypertrophied atria obtained from monocrotaline (MCT)-treated rats.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Animals. Male Sprague-Dawley rats weighing 230-250 g were used. Rats were given a single subcutaneous injection of 60 mg/kg MCT or saline (18) and were killed at 4-5 wk.

Blood collection and tissue preparation. On the day of the experiments, rats were killed by decapitation, and blood was collected into a prechilled tube containing aprotinin (200 kallikrein inhibitory units /ml), soybean trypsin inhibitor (SBTI; 50 Nalpha -benzoyl-L-arginine ethyl ester units/ml), phenylmethylsulfonyl fluoride (PMSF; 600 µM/ml), and EDTA (2.7 mM/ml). Blood was centrifuged at 10,000 g for 15 min at 4°C, and plasma ANP was extracted using Sep-Pak C18 cartridge (Waters, Milford, MA). Both atria were separated, weighed, and kept in 2 ml of 0.1 N acetic acid at 4°C. Tissues were boiled for 10 min, homogenized with Polytron homogenizer, and centrifuged at 10,000 g for 15 min at 4°C. The concentrations of ANP in plasma extracts and tissue homogenates were measured by radioimmunoassay (RIA) as described below.

Isolated perfused atrial preparation. Rats were killed by decapitation, and an isolated perfused atrial preparation was made by the method described previously (7, 19). Briefly, both atria were separately dissected from the heart, and a Tygon cannula containing three small catheters was inserted into the atrium. The cannulated atria were transferred, fitted into the organ chamber containing buffer solution (36.5°C), and fixed with a water-tight silicone rubber cap. The atrium was immediately perfused with oxygenated HEPES buffer solution at a rate of 0.4 ml/min with a peristatic pump. The composition of the buffer solution was as follows (in mM): 118 NaCl, 4.7 KCl, 2.5 CaCl2, 1.2 MgSO4, 25 NaHCO3, 10 HEPES, and 10 glucose plus 1% bovine serum albumin (BSA). The pericardial buffer solution containing [3H]inulin to measure the translocation of extracellular fluid (ECF) was also oxygenated by silicone tubing coils located inside the organ chamber. The pericardial space of the organ chamber was sealed and connected with a calibrated microcapillary tube, by which changes in atrial volume were monitored. The perfusate was collected at 2-min intervals at 4°C. After two collection periods, atrial distension was induced for 2 min by elevation of the position of the outflow catheter tip to 1 cmH2O, and atrial contraction was induced by lowering the position of the catheter tip to the basal level. Atrial pressure was subsequently increased from 0 to 2, 4, 6, and 10 cmH2O for 2 min every 8 min.

To define the inhibitory effect of CNP on the ANP secretion by atrial hypertrophy, both atria from MCT rats and control right atria were exposed to CNP (10-6 M) at the start of the experiments. To determine whether the inhibitory effect of ANP secretion by 8-bromo-cGMP (8-BrcGMP), a cell membrane-permeable cGMP, is attenuated in hypertrophied atria, both atria from MCT rats were also exposed to 8-BrcGMP (10-6 M).

RIA of ANP. Immunoreactive ANP in the atrial perfusates was measured by use of specific RIA, as described previously (6, 7). The secreted amount of ANP was expressed as nanograms of ANP per minute per gram of tissue. The molar concentration of ANP released was calculated as follow (5)
ANP released (&mgr;M)<IT>=</IT><FR><NU>immunoreactive ANP (pg<IT>·</IT>min<SUP>−1</SUP><IT>·</IT>g<SUP>−1</SUP>)</NU><DE>ECF translocation (&mgr;l<IT>·</IT>min<SUP>−1</SUP><IT>·</IT>g<SUP>−1</SUP>)<IT>·</IT>3,060</DE></FR>
The denominator 3,060 refers to the molecular mass for ANP-(1---28) (in Da), since the ANP secreted was found to be mainly the processed ANP (7).

Measurement of ECF translocation. We have previously reported a two-step sequential mechanism of ANP secretion from atria: 1) atrial release of ANP into interstitial space by atrial stretch and 2) the secretion of released ANP into atrial lumen concomitantly with ECF translocation by contraction (5). The translocation of ECF is dependent on atrial volume change. The ECF translocated from the atria was measured as described previously (5). Radioactivity in atrial perfusate and pericardial buffer solution was measured with a liquid scintillation counter, and the amount of ECF translocated through the atrial wall was calculated as follows
ECF translocation (&mgr;l<IT>·</IT>min<SUP>−1</SUP><IT>·</IT>g<SUP>−1</SUP>)<IT>=</IT><FR><NU>total radioactivity in perfusate (cpm/min)<IT>·</IT>1,000</NU><DE><AR><R><C>radioactivity in pericardial reservoir</C></R><R><C> (cpm/&mgr;l)<IT>·</IT>atrial wet wt (mg)</C></R></AR></DE></FR>
where cpm is counts/min.

Preparation of perfused atrium for measurement of cGMP production. At the end of the experiments, atria were separated from atrial cannula, lightly blotted, quickly frozen in liquid nitrogen, and stored at -70°C until assay, as described elsewhere (26). Atrial tissues were minced in 2 ml of ice-cold trichloroacetic acid (TCA; 6%) solution and homogenized at 4°C by three 30-s bursts of maximal speed using Tissue Tearor (Biospec Products, Racine, WI). After centrifugation at 1,000 g for 10 min at 4°C, supernatant was transferred to a polypropylene tube, subjected to ether extraction three times, and then dried using a Speed-Vac concentrator (Savant, Hicksville, NY). Dried samples were resuspended with 200 µl of sodium acetate buffer.

Measurement of particulate guanylyl cyclase activity in atrial membranes. Atrium was homogenized at 4°C in 30 mM phosphate buffer (pH 7.2) containing 120 mM NaCl and 1 mM phenanthroline by three 30-s bursts of maximal speed using Tissue Tearor (Biospec Products). The homogenate was centrifuged at 1,500 g for 10 min at 4°C, and supernatant was recentrifuged at 40,000 g for 60 min at 4°C. The membrane pellet was washed three times with 50 mM Tris · HCl (pH 7.4) and resuspended in this solution. Protein contents were determined by bicinchoninic acid assay kit (Sigma Chemical, St. Louis, MO).

Particulate guanylyl cyclase (GC) activity was measured by the determination of cGMP generated in atrial tissue membranes according to a method described previously (22, 26). Five-microgram protein aliquots of the suspension were incubated at 37°C for 15 min in 50 mM Tris · HCl (pH 7.6; containing 1 mM isobutylmethylxanthine, 1 mM GTP, 0.5 mM ATP, 15 mM creatine phosphate, 80 µg/ml creatine phosphokinase, and 4 mM MgCl2) and 1 µM natriuretic peptides. Incubations were stopped by addition of 375 µl of cold 50 mM sodium acetate (pH 5.8) and by boiling for 5 min. Samples were then centrifuged at 10,000 g for 5 min at 4°C.

RIA of cGMP. The amount of cGMP generated in the supernatant was measured by RIA (22, 26). Briefly, 2'-O-monosuccinylguanosine 3',5'-cyclic monophosphate tyrosyl methyl ester (cGMP-TME; Sigma Chemical) was iodinated by the chloramine-T method. Iodinated cGMP-TME was purified by a QAE Sephadex A-25 column (Sigma Chemical), and the specific activity of the iodinated tracer determined by RIA technique was 215 Ci/mmol (17).

Standards or samples were introduced in a final volume of 100 µl of 50 mM sodium acetate buffer (pH 4.8), and 100 µl each of diluted cGMP antiserum (Calbiochem-Novabiochem, San Diego, CA) and iodinated cGMP were added. After incubation at 4°C for 24 h, the bound form was separated from the free form by charcoal suspension. The measurement of cGMP generated was done on the day of experiments, and all samples in an experiment were analyzed in a single assay. Nonspecific binding of iodinated tracer was <2.4%. The 50% intercept was at 0.74 ± 0.03 pmol/tube (n = 10). The intra- and interassay coefficients of variation were 4.2% (n = 15) and 7.1% (n = 8), respectively. Results of the determinants were expressed as picomoles of cGMP generated per milligram of protein per minute.

RT-PCR. RT-PCR was performed as described previously (21, 22). Total RNA was extracted from atria by use of TRI reagent (RNA/DNA/protein isolation reagent; MRC, Cincinnati, OH). One microgram of mRNA was suspended in 20 µl of RT buffer and reverse transcribed at room temperature for 10 min and at 42°C for 30 min. The reaction was stopped by heat inactivation for 5 min at 99°C and then chilled on ice. Complementary DNA products were amplified by PCR using primers. The sequences (5'-3') of the oligonucleotides and sizes of PCR products for NPR-B were as follows: sense, AACGGGCGCATTGTGTATATCTGCGGC; and antisense, TTATCACAGGATGGGTCG-TCCAAGTCA (692 bp). The temperature profile of amplification consisted of 30-s denaturation at 95°C, 1-min annealing at 60°C, and 2-min extension at 72°C for 30 (for glyceraldehyde-3-phosphate dehydrogenase; GAPDH) or 40 cycles (NPR-B). PCR products were separated in 2% agarose gels, and bands were visualized by ethidium bromide staining. The specificity of the amplified sequences was confirmed by DNA sequencing.

Statistical analysis. The results were given as means ± SE. Statistical significance of differences was performed by Student's t-test. The correlation coefficients were determined using least-squares linear regression analysis, and the comparison of slopes between ANP secretion and ECF translocation was performed by parallelism test. The critical level of significance was set at P value < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The tissue weight of the right heart increased after injection of MCT. The ratio of right to left atrial weight increased from 1.04 ± 0.06 to 2.67 ± 0.15 (P < 0.001, n = 18) at 4 wk, and plasma concentration of ANP markedly increased (152.2 ± 23.5 vs. 460 ± 45.4 pg/ml, P < 0.01). The atrial concentration of ANP markedly decreased (124.4 ± 12.2 vs. 268.7 ± 26.2 ng/mg, P < 0.01) in hypertrophied right atria but not in nonhypertrophied left atria of MCT rats.

Stretch-induced ANP secretion by CNP from hypertrophied right atria compared with nonhypertrophied left atria. To evaluate changes in stretch-induced ANP secretion by CNP from nonhypertrophied left atria in MCT rats, isolated perfused nonbeating atria were used. The basal rate of ANP secretion was 5.83 ± 1.69 ng · min-1 · g-1 (n = 10), which was suppressed by CNP (1.32 ± 0.34 ng · min-1 · g-1; n = 11, P < 0.01; Fig. 1C). When atrial pressure was increased from basal level to 2, 4, 6, or 10 cmH2O for 2 min by the elevation of outflow tip, atrial volume (distension and reduction volume; DRV) was increased in proportion to atrial pressure. Increases in DRV caused proportional increases in ANP secretion that were suppressed by CNP. The basal rate of ECF translocation was not changed, but the mechanically stimulated ECF translocation was slightly increased by CNP (Fig. 1D). Therefore, the secretion of ANP in relation to ECF translocation (ANP concentration) was markedly decreased by CNP (Fig. 1E).


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1.   A: pressure. B-E: effect of C-type natriuretic peptide (CNP; 10-6 M) on distension and reduction volume (DRV; B), atrial natriuretic peptide (ANP) secretion (C), extracellular fluid (ECF) translocation (D), and ANP concentration (conc; E) in isolated perfused nonbeating nonhypertrophied left atria from monocrotaline (MCT)-treated rats. Atrial volume change (DRV) increased by the elevation of intra-atrial pressure. A step-wise increase in DRV resulted in proportional increases in ANP secretion and concomitant ECF translocation. The stretch-activated ANP secretion was significantly suppressed by CNP. MCT,LT-CONT, nonhypertrophied left atria from MCT-treated rat as control (filled columns and ; n = 10); CNP, CNP-perfused atria (open columns and open circle ; n = 11). * P < 0.05, ** P < 0.01, and *** P < 0.001 vs. corresponding group.

In hypertrophied right atria, the basal rates of ANP secretion and ECF translocation were not changed by the addition of CNP (Fig. 2, C and D). Increases in DRV caused proportional increases in ANP secretion and ECF translocation. CNP caused no significant change in ANP secretion but a slight decrease in ECF translocation (Fig. 2, C and D). Therefore, the secretion of ANP in relation to ECF translocation (ANP concentration) was not changed by CNP (Fig. 2E).


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2.   A: pressure. B-E: effect of CNP (10-6 M) on DRV (B), ANP secretion (C), ECF translocation (D), and ANP concentration (E) in isolated perfused hypertrophied right atria from MCT-treated rats. MCT,HT-CONT, hypertrophied right atria from MCT-treated rat as control (n = 8); CNP, CNP-perfused atria (n = 11). Symbols are the same as in Fig. 1.

Figure 3 shows the relationships between DRV, changes in mechanically stimulated ECF translocation, and ANP secretion by CNP in nonhypertrophied left (Fig. 3, A and B) and hypertrophied right (Fig. 3, C and D) atria from MCT rats and control right atria (Fig. 3, E and F). There were positive correlations between DRV and ECF translocation in nonhypertrophied left atria (y = 0.021x + 8.86, r = 0.75, P < 0.001; Fig. 3A), hypertrophied right atria (y = 0.027x + 26.74, r = 0.61, P < 0.001; Fig. 3C), and control right atria (y = 0.012x + 35.8, r = 0.53, P < 0.001; Fig. 3E). There were also positive correlations between DRV and ECF translocation by CNP (y = 0.023x + 20.57, r = 0.75, P < 0.001 in Fig. 3A; y = 0.033x + 16.42, r = 0.79, P < 0.001 in Fig. 3C; and y = 0.019x + 31.1, r = 0.69, P < 0.001 in Fig. 3E), but the slopes were not significantly different from the corresponding control group. The linear correlations between ANP secretion and ECF translocation were shifted rightward and downward by CNP in nonhypertrophied left atria (y = 0.16x + 1.27 vs. y = 0.31x + 5.15, P < 0.05; Fig. 3B) and in control right atria (y = 0.58x + 2.57 vs. y = 0.90x + 4.33, P < 0.01; Fig. 3F). This means that CNP suppresses ANP release from atrial myocytes. In contrast, in hypertrophied right atria, CNP did not shift the relationships between ANP secretion and ECF translocation (y = 0.45x + 1.85 vs. y = 0.57x - 2.34, P = 0.42; Fig. 3D). Therefore, the concentration of ANP was significantly suppressed by CNP in nonhypertrophied left atria and control right atria but not in hypertrophied right atria, as shown in Fig. 4A.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   Relationships between changes in DRV, ECF translocation, and ANP secretion by CNP in nonhypertrophied left atria (A and B) and hypertrophied right atria (C and D) from MCT-treated rats and in right atria from control rats (E and F; n = 8). In nonhypertrophied left atria and control right atria, CNP shifted the relationships between ECF translocation and DRV (A and E) and ANP secretion and ECF translocation (B and F) rightward and downward. In hypertrophied right atria, however, CNP did not change the relationship between those parameters (C and D). Delta ECF translocation, change in ECF translocation.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 4.   Comparisons of CNP-inhibited ANP secretion in terms of ECF translocation (ANP concentration; A) and CNP-stimulated cGMP production (B) in isolated perfused nonhypertrophied left (MCT-LT) and hypertrophied right (MCT-RT) atria from MCT-treated rats and control right atria (CONT-RT). * P < 0.05, ** P < 0.01, and *** P < 0.001 vs. control group.

Stretch-induced ANP secretion by 8-BrcGMP from hypertrophied right atria. To determine whether the inhibitory effect of ANP secretion by 8-BrcGMP, a cell membrane-permeable cGMP, is attenuated in hypertrophied atria, 8-BrcGMP (10-4 M) was perfused into both left and right atria from MCT rats. Figure 5 shows the suppression of stretch-induced ANP secretion by 8-BrcGMP in nonhypertrophied left (n = 6, Fig. 5A) and hypertrophied right atria (n = 6, Fig. 5B). Positive relationships between changes in stretch-induced ANP secretion and ECF translocation were shifted rightward and downward by 8-BrcGMP in both atria. The slopes between those parameters made by 8-BrcGMP were significantly different from corresponding control groups (0.35 ± 0.10 vs. 0.99 ± 0.14, P < 0.001 in nonhypertrophied left atria; 0.39 ± 0.07 vs. 1.10 ± 0.21, P < 0.05 in hypertrophied right atria).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5.   Relationships between changes in stretch-induced ANP secretion and ECF translocation by 8-bromo-cGMP (8-BrcGMP; 10-4 M) in nonhypertrophied left atria (A) and hypertrophied right atria (B) from MCT-treated rats. 8-BrcGMP shifted the relationship between changes in ECF translocation and ANP secretion rightward and downward in both atria. MCT,LT-CONT, nonhypertrophied left atria from MCT-treated rat as control (A, ; n = 6); MCT,RT-CONT, hypertrophied right atria from MCT-treated rat as control (B, ; n = 6); 8-BrcGMP, 8-BrcGMP-perfused atria (open circle ; n = 6).

Activation of particulate GC by CNP in hypertrophied perfused atria and tissue membranes. To determine whether an attenuation of the inhibitory effect of CNP by atrial hypertrophy may be due to the low amount of cGMP generation through NPR-B, an isolated perfused nonbeating atrium exposed to CNP was frozen in liquid nitrogen at the end of experiment, and cGMP was extracted. CNP (10-6 M) elicited an increase in cGMP production in nonhypertrophied left atria [3.40 ± 0.54 (n = 7) vs. 2.21 ± 0.18 pmol/mg protein (n = 7), P < 0.025; Fig. 4B] and in control right atria [3.35 ± 0.42 (n = 7) vs. 2.42 ± 0.25 pmol/mg protein (n = 7), P < 0.05; Fig. 4B]. In hypertrophied right atria, however, no significant change in cGMP production by CNP was observed [1.90 ± 0.33 (n = 7) vs. 1.84 ± 0.29 pmol/mg protein (n = 7), P = 0.45; Fig. 4B].

Particulate GC activity was measured by determination of cGMP generated in protein aliquots of atrial membranes. Basal cGMP production from hypertrophied right atrial membrane was not different from control right and nonhypertrophied left atrial membrane (n = 5; Fig. 6). CNP caused an increase in cGMP production in both groups. However, an increase in cGMP production by CNP in hypertrophied right atrial membrane was significantly lower than that in both groups (P < 0.05).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 6.   Comparison of cGMP production through activation of guanylyl cyclase in atrial tissue membranes stimulated by CNP (10-6 M). CONT, control group (n = 6); CNP, CNP-perfused group (n = 6). * P and # P < 0.05 vs. CNP-stimulated control right atria and nonhypertrophied left atria, respectively.

Gene expression of NPR-B in hypertrophied atria. Figure 7 shows RT-PCR products for NPR-B in both atria from control and MCT rats. Band of DNA was present in the lanes corresponding to the expected size of the products for NPR-B. The amount of PCR product for NPR-B corrected by GAPDH in hypertrophied right atria was not different from that in nonhypertrophied left atria and control right atria (Fig. 7, n = 4).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 7.   Semiquantitative RT-PCR of mRNAs for natriuretic peptide receptor (NPR)-B in both atria from control (CONT) and MCT-treated rats. No significant differences in NPR-B mRNA corrected by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA between groups were observed. M, DNA molecular size marker (174 RF DNA, Hae III cut); lanes 1-4, left atria; lanes 5-8, right atria.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The present study clearly shows that atrial hypertrophy caused an attenuation of the inhibitory effect of CNP on the ANP secretion, which may be partly due to the low amount of CNP-stimulated cGMP production in hypertrophied atria.

All of the natriuretic peptide family and their receptors are found in atrial myocytes and fibroblasts (13, 28, 30). Many investigators have tried to find out the intracardiac roles of natriuretic peptides and their cross talk. However, there are several reports about the possible intracardiac effect of ANP as an autocrine/paracrine factor. ANP inhibits catecholamine- and growth factor-induced DNA synthesis in cultured rat cardiac myocytes and fibroblasts (3, 4). Recently, Horio et al. (15) have also showed direct evidence for the inhibitory regulation of hypertrophy by endogenous ANP in cultured cardiac myocytes. Oliver et al. (32) have found hypertension and cardiac hypertrophy with interstitial fibrosis in NPR-A knockout mice. In contrast, transgenic mice overexpressing the ANP gene have a low heart weight under normoxia and a blunted right ventricular hypertrophy response to hypoxia-induced pulmonary hypertension. Taken together, the above reports suggest that ANP may play an important role in the regulation of cardiac hypertrophy/growth as an autocrine factor. Therefore, definition of the factors for the regulation of ANP secretion from hypertrophied heart is an important field for the understanding of pathogenesis of cardiac hypertrophy.

Cardiac hypertrophy associated with congestive heart failure induces reactivation of the ventricular ANP gene, which is markedly declined after birth, as well as atrial ANP. However, the significance of the activated ANP system is still unknown. It is reported that ANP may regulate its own release via NPR-A by atrial myocytes in a autocrine/paracrine manner (27). Recently, we found an accentuation of ANP secretion to endothelin (ET)-1 in hypertrophied atria (20) and the inhibitory regulation of ANP secretion by CNP via NPR-B-cGMP pathway in isolated perfused beating atria (26). Cardiac CNP level is extremely low, and plasma CNP level did not change in congestive heart failure (38). Therefore, the intracardiac effect of CNP as a local hormone may play an important role on the pathogenesis of cardiac hypertrophy. However, there is no report on the modification of intracardiac cross talk of ANP and CNP by atrial hypertrophy. The answer for this question may give us some idea for the physiological role of the endogenous CNP system in the pathogenesis of cardiac hypertrophy. In the present study, we found that an inhibitory effect of CNP on the ANP secretion was markedly attenuated in hypertrophied right atria. The ANP release in terms of ECF translocation by CNP was not changed in hypertrophied atria but decreased in nonhypertrophied atria. CNP specifically activates NPR-B, followed by increased cGMP production (24). Therefore, to determine whether the activation of GC through NPR-B may be impaired in hypertrophied atria, we measured the amount of cGMP production in atrial tissue exposed to CNP. The amount of cGMP generation in both hypertrophied atrial tissues and its membranes exposed to CNP was significantly lower than that in nonhypertrophied atrial tissues and membranes. However, suppression of ANP secretion by 8-BrcGMP (26), a cell membrane-permeable cGMP, was not affected by atrial hypertrophy. Therefore, the attenuation of the inhibitory effect of ANP secretion by CNP in hypertrophied atria may be due to the low amount of cGMP generation in tissue membranes exposed to CNP. In the present study, mRNA for NPR-B in hypertrophied atria was not different from that in nonhypertrophied atria. These results are not consistent with the report showing increased mRNA levels for NPR-A and NPR-B and decreased mRNA levels for NPR-C in progressive hypertrophied rat heart (2). The discrepancy may be due to the differences in method for the induction of cardiac hypertrophy and degree of hypertrophy. The possible explanation for the defect of cGMP generation in hypertrophied atria may be the low activity of GC or the enhanced activity of phosphodiesterase.

What is the significance of relief of negative inhibitory limb of CNP on the ANP secretion in cardiac hypertrophy? Progressive cardiac hypertrophy may lead to the activation of ANP synthesis and release with subsequent high concentration of plasma ANP and low concentration of atrial ANP (8, 29-31, 34). ANP stimulated by stretch and ET-1 (20) in hypertrophied atria may cause vasodilation of pulmonary artery (25) and diuresis (14), followed by the reduction of pressure and volume overload, and also inhibit cardiac hypertrophy (15, 16) as one of the compensatory mechanisms. In addition, the present study shows evidence that CNP may be another factor participating in the maintenance of a high level of plasma ANP in cardiac hypertrophy. Under normal conditions, CNP endogenously synthesized from cardiac myocytes and fibroblasts (13, 28) may act as an autocrine/paracrine regulator by inhibiting ANP secretion (26), atrial dynamics (1, 26), and cardiac growth (4, 12, 33) through NPR-B. CNP also has systemic effects such as vasodilation and diuresis but these are relatively weak compared with ANP. In the course of cardiac hypertrophy, CNP may relieve the negative inhibition of ANP secretion, followed by reduction of overload to the heart, even though the mechanisms are not clear at present.

The results showing the relief of negative limb of ANP secretion by CNP in hypertrophied atria suggest that CNP may be a contributing factor to delay the development of cardiac hypertrophy secondary to MCT-induced pulmonary hypertension.

Perspectives

Herein, we present an important finding that may provide a possible mechanism for the involvement of CNP in the development of cardiac hypertrophy. It has already been shown that ANP inhibits proliferation of cardiac fibroblasts, and cardiac hypertrophy with interstitial fibrosis is developed in NPR-A knockout mice. Although CNP also has the antigrowth effect of vascular smooth muscle, the involvement of CNP in the development of cardiac hypertrophy is not clear. Gene expression of cardiac CNP and its plasma level appear not to be influenced by cardiac hypertrophy, and a recent study using CNP knockout mice shows no evidence of cardiac hypertrophy. However, intracardiac action of CNP may be more important than that of ANP and BNP because of the high activity of cardiac GC-B compared with GC-A. CNP may act as a local hormone rather than a general hormone. Therefore, CNP may influence indirectly cardiac hypertrophy or development. Recently, we found the paracrine function of CNP in the heart to be a negative regulator of ANP secretion. The present study shows the attenuation of CNP-induced inhibition of ANP secretion by atrial hypertrophy due to the low activity of GC-B. Therefore, we suggest that CNP may be a contributing factor participating in the development of cardiac hypertrophy through the regulation of ANP secretion. Additional study is required to elucidate the cellular and molecular basis of regulation of GC-B by cardiac hypertrophy.


    ACKNOWLEDGEMENTS

We thank Kyong Sook Kim for administrative assistance.


    FOOTNOTES

This work was supported by Korea Science and Engineering Foundation (98-0403-10-01-5) and Korea Research Foundation (2000-015-FP0023).

Address for reprint requests and other correspondence: S. H. Kim, 2-20 Keum-Am-Dong-San, Dept. of Physiology, Jeonbug National Univ., Medical School, Jeonju 560-180, Korea (E-mail shkim{at}moak.chonbuk.ac.kr).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 26 February 2001; accepted in final form 22 June 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Beaulieu, P, Cardinal R, Page P, Francoeur F, Trembly J, and Lambert C. Positive chronotropic and inotropic effects of C-type natriuretic peptide in dogs. Am J Physiol Heart Circ Physiol 273: H1933-H1940, 1997.

2.   Brown, LA, Nunez DJR, and Wilkins MR. Differential regulation of natriuretic peptide receptor messenger RNAs during the development of cardiac hypertrophy in the rat. J Clin Invest 92: 2702-2712, 1993.

3.   Calderone, A, Thaik CM, Takahashi N, Chang DLF, and Colucci WS. Nitric oxide, atrial natriuretic peptide, and cyclic GMP inhibit the growth-promoting effects of norepinephrine in cardiac myocytes and fibroblasts. J Clin Invest 101: 812-818, 1998[Web of Science][Medline].

4.   Cao, L, and Gardner DG. Natriuretic peptides inhibit DNA synthesis in cardiac fibroblasts. Hypertension 25: 227-234, 1995[Abstract/Free Full Text].

5.   Cho, KW, Kim SH, Hwang YH, and Seul KH. Extracellular fluid translocation in perfused rabbit atria: implication in control of atrial natriuretic peptide secretion. J Physiol (Lond) 468: 591-607, 1993[Abstract/Free Full Text].

6.   Cho, KW, Seul KH, Kim SH, Seul KM, Ryu H, and Koh GY. Reduction volume dependence of immunoreactive atrial natriuretic peptide secretion in isolated perfused rabbit atria. J Hypertens 7: 371-375, 1989[Web of Science][Medline].

7.   Cho, KW, Seul KH, Ryu H, Kim SH, and Koh GY. Characteristics of distension-induced release of immunoreactive atrial natriuretic peptide in isolated perfused rabbit atria. Regul Pept 22: 333-345, 1988[Web of Science][Medline].

8.   Comini, L, Agnoletti G, Panzali A, Mantero G, Pasini E, Haia G, Albertini A, and Ferrari R. Activation of ANP synthesis during congestive heart failure in rats treated with monocrotaline. Am J Physiol Heart Circ Physiol 268: H391-H398, 1995[Abstract/Free Full Text].

9.   DeBold, AJ. Atrial natriuretic factor. A hormone produced by the heart. Science 230: 767-770, 1985[Abstract/Free Full Text].

10.   Drewett, JG, and Garbers DL. The family of guanylyl cyclase receptors and their ligands. Endocr Rev 15: 135-162, 1994[Abstract/Free Full Text].

11.   Espiner, EA. Physiology of natriuretic peptides. J Intern Med 235: 527-541, 1994[Web of Science][Medline].

12.   Furuya, M, Yoshida M, Harayashi Y, Ohnuma N, Minamino N, Kangawa K, and Matsuo H. C-type natriuretic peptide is a growth inhibitor of rat vascular smooth muscle cells. Biochem Biophys Res Commun 177: 927-931, 1991[Web of Science][Medline].

13.   Gerbes, AL, and Nemer M. Detection of C-type natriuretic peptide compared with brain and atrial natriuretic peptide transcripts in human heart by the polymerase chain reaction. Clin Investig 71: 672, 1993[Web of Science][Medline].

14.   Hirata, Y, Suzuki E, Hayakawa H, Matsuoka H, Sugimoto T, Kojima M, Kangawa K, and Matsuo H. Role of endogenous ANP in sodium excretion in rats with experimental pulmonary hypertension. Am J Physiol Heart Circ Physiol 262: H1684-H1689, 1992[Abstract/Free Full Text].

15.   Horio, T, Nishikimi T, Yoshihara F, Matsuo H, Takishita S, and Kangawa K. Inhibitory regulation of hypertrophy by endogenous atrial natriuretic peptide in cultured cardiac myocytes. Hypertension 35: 19-24, 2000[Abstract/Free Full Text].

16.   Itoh, H, Pratt RE, and Dzau VJ. Atrial natriuretic polypeptide inhibits hypertrophy of vascular smooth muscle cells. J Clin Invest 86: 1690-1697, 1990.

17.   Joseph, LJ, Desai KB, Mehta MN, and Mathiyarasu R. Measurement of specific activity of radiolabelled antigens by a simple radioimmunoassay technique. Nucl Med Biol 15: 589-590, 1988.

18.   Kay, JM, Harris P, and Heath D. Pulmonary hypertension in rats produced by the ingestion of Crotalaria spectabilis seeds. Thorax 22: 176-170, 1967[Abstract/Free Full Text].

19.   Kim, SH, Cho KW, Chang SH, Kim SZ, and Chae SW. Glibenclamide suppresses stretch-activated ANP secretion: involvements of K<UP><SUB>ATP</SUB><SUP>+</SUP></UP> channels and L-type Ca2+ channel modulation. Pflügers Arch 434: 362-372, 1997[Web of Science][Medline].

20.  Kim SH, Lee KS, Seul KH, Kim SZ, and Cho KW. Accentuation of ANP secretion to endothelin-1 in hypertrophied atria. Regul Peptides. In press.

21.   Kim, SZ, Cho KW, and Kim SH. Modulation of endocardial natriuretic peptide receptors in right ventricular hypertrophy. Am J Physiol Heart Circ Physiol 277: H2280-H2289, 1999[Abstract/Free Full Text].

22.   Kim, SZ, Kim SH, Park JK, Koh GY, and Cho KW. Presence and biological activity of C-type natriuretic peptide-dependent guanylate cyclase-coupled receptor in the penile corpus cavernosum. J Urol 159: 1741-1746, 1998[Web of Science][Medline].

23.   Klinger, JR, Siddiq FM, Swift RA, Jackson C, Pietras L, Warburton RR, Alia C, and Hill NS. C-type natriuretic peptide expression and pulmonary vasodilation in hypoxia-adapted rats. Am J Physiol Lung Cell Mol Physiol 275: L645-L652, 1998[Abstract/Free Full Text].

24.   Koller, KJ, Lowe DG, Bennett GL, Minamino N, Kangawa K, Matsuo H, and Goeddel DV. Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide (CNP). Science 252: 120-123, 1991[Abstract/Free Full Text].

25.   Lee, KC, and Lappe RW. Hypotensive response to atrial natriuretic factor in conscious chronic pulmonary hypertensive rats. Eur J Pharmacol 158: 153-156, 1988[Web of Science][Medline].

26.   Lee, SJ, Kim SZ, Cui X, Kim SH, Lee KS, Chung YJ, and Cho KW. C-type natriuretic peptide inhibits ANP secretion and atrial dynamics in perfused atria: NPR-B-cGMP signaling. Am J Physiol Heart Circ Physiol 278: H208-H221, 2000[Abstract/Free Full Text].

27.   Leskinen, H, Vuolteenaho O, Toth M, and Ruskoaho H. Atrial natriuretic peptide (ANP) inhibits its own secretion via ANPA receptors: altered effect in experimental hypertension. Endocrinology 138: 1893-1902, 1997[Abstract/Free Full Text].

28.   Lin, X, Hanze J, Heese F, Sodmann K, and Lang RE. Gene expression of natriuretic peptide receptors in myocardial cells. Circ Res 77: 750-758, 1995[Abstract/Free Full Text].

29.   Matsubara, H, Yamamoto J, Hirata Y, Mori Y, Oikawa S, and Inada M. Changes of atrial natriuretic peptide and its messenger RNA with development and regression of cardiac hypertrophy in renovascular hypertensive rats. Circ Res 66: 176-184, 1990[Abstract/Free Full Text].

30.   Nunez, DJ, Dickson MC, and Brown MJ. Natriuretic peptide receptor mRNAs in the rat and human heart. J Clin Invest 90: 1966-1971, 1992.

31.   Oehlenschlager, WF, Kurtz DT, Baron DA, and Currie MG. Enhanced activity of the cardiac endocrine system during right ventricular hypertrophy. Mol Cell Endocrinol 62: 243-251, 1989[Web of Science][Medline].

32.   Oliver, PM, Fox JE, Kim R, Rockman HA, Kim HS, Reddick RL, Pandy KN, Milgram SL, Smithies O, and Maeda N. Hypertension, cardiac hypertrophy, and sudden death in mice lacking natriuretic peptide receptor A. Proc Natl Acad Sci USA 94: 14730-14735, 1997[Abstract/Free Full Text].

33.   Porter, JG, Catalano R, McEnroe G, Lewicki JA, and Protter AA. C-type natriuretic peptide inhibits growth factor-dependent DNA synthesis in smooth muscle cells. Am J Physiol Cell Physiol 263: C1001-C1006, 1992[Abstract/Free Full Text].

34.   Raine, AEG, Erne P, Burgisser RE, Muller FB, Bolli P, Burkart F, and Buhler FR. Atrial natriuretic peptide and atrial pressure in patients with congestive heart failure. N Engl J Med 315: 533-537, 1986[Abstract].

35.   Shah, AM. Paracrine modulation of heart cell function by endothelial cells. Cardiovasc Res 31: 847-867, 1996[Web of Science][Medline].

36.   Sudoh, T, Kangawa K, Minamino N, and Matsuo H. A new natriuretic peptide in porcine brain. Nature 332: 78-81, 1988[Medline].

37.   Sudoh, T, Minamino N, Kangawa K, and Matsuo H. C-type natriuretic peptide (CNP): a new member of natriuretic peptide family identified in porcine brain. Biochem Biophys Res Commun 168: 863-870, 1990[Web of Science][Medline].

38.   Wei, CM, Heublein DM, Perrella MA, Lerman A, Rodeheffer RJ, McGregor CG, Edwards WD, Schaff HV, and Burnett JC, Jr. Natriuretic peptide system in human heart failure. Circulation 88: 1004-1009, 1993[Abstract/Free Full Text].


Am J Physiol Regul Integr Comp Physiol 281(5):R1456-R1463
0363-6119/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
HypertensionHome page
J. H. Han, C. Cao, S. M. Kim, F. L. Piao, and S. H. Kim
Attenuation of Lysophosphatidylcholine-Induced Suppression of ANP Release From Hypertrophied Atria
Hypertension, February 1, 2004; 43(2): 243 - 248.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. H. Han, C. Cao, S. Z. Kim, K. W. Cho, and S. H. Kim
Decreases in ANP Secretion by Lysophosphatidylcholine Through Protein Kinase C
Hypertension, June 1, 2003; 41(6): 1380 - 1385.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. H. Kim, J. H. Han, C. Cao, S. Z. Kim, and K. W. Cho
Postnatal changes in inhibitory effect of C-type natriuretic peptide on secretion of ANP
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2002; 282(6): R1672 - R1679.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, S. H.
Right arrow Articles by Cho, K. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, S. H.
Right arrow Articles by Cho, K. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online