|
|
||||||||
Department of Physiology, Medical School, Institute for Medical Sciences, Jeonbug National University, Jeonju 560-180, Korea
| |
ABSTRACT |
|---|
|
|
|---|
It has been shown that atrial natriuretic
peptide (ANP) influences proliferation of cardiac cells. To
define the possible role of C-type natriuretic peptide (CNP) in cardiac
hypertrophy, the influence of CNP on the secretion of ANP was studied
with the use of perfused nonbeating atria from monocrotaline-treated rats. Increases in atrial volume caused proportional increases in ANP
secretion that were markedly suppressed by CNP (10
6 M) in
nonhypertrophied left atria and control right atria but not in
hypertrophied right atria. However, increases in atrial volume and
mechanically stimulated extracellular fluid (ECF) translocation by CNP
were similar to those in the control group. Therefore, the secretion of
ANP in terms of ECF translocation was decreased by CNP in
nonhypertrophied left and control right atria but not in hypertrophied
atria. However, the inhibitory effect of 8-bromo-cGMP on the secretion
of ANP was observed in both atria. The cGMP productions from perfused
hypertrophied atria and their membranes exposed to CNP were
significantly lower than those from nonhypertrophied atria. No
significant difference in natriuretic peptide receptor-B transcript was
found. Therefore, attenuation of the inhibitory effect of CNP on the
ANP secretion in hypertrophied atria may be due to lack of cGMP
production. The results showing the relief of CNP-induced negative
inhibition of ANP secretion by atrial hypertrophy suggest that CNP may
be a contributing factor to delay the development of cardiac hypertrophy.
atrial natriuretic peptide; C-type natriuretic peptide; atrium; hypertrophy; monocrotaline; natriuretic peptide receptor; stretch; pulmonary hypertension
| |
INTRODUCTION |
|---|
|
|
|---|
THE NATRIURETIC PEPTIDE FAMILY is composed of atrial natriuretic peptide (ANP) (9), brain natriuretic peptide (BNP) (36), and C-type natriuretic peptide (CNP) (37), which are involved in the regulation of blood pressure and fluid homeostasis. ANP and BNP primarily originate from heart and activate natriuretic peptide receptor (NPR)-A (10). CNP, a third member of the natriuretic peptide family, is found principally in the central nervous system and vascular endothelial cells and activates NPR-B (24). CNP has both structural and physiological similarities with ANP and BNP. All natriuretic peptides have an important role in the regulation of body fluid and blood pressure. However, CNP elicits natriuretic, diuretic, and hypotensive effects that are less potent compared with those of ANP and BNP (23, 33, 37). Because of low plasma level, wider distributions of CNP, and its diverse biological actions, CNP is considered to have autocrine/paracrine functions as a local regulator (12, 33).
In the cardiac atria, the natriuretic peptide family and their receptors have been found (28, 30). There are a few reports about intracardiac effects of natriuretic peptides and their cross talk. ANP and CNP cause an inhibition of proliferation of cardiac fibroblasts and myocytes (3, 4, 15). ANP may regulate its own release via NPR-A by atrial myocytes in an autocrine/paracrine manner (27). Beaulieu et al. (1) have reported a regulatory function of CNP in the dog heart showing positive chronotropic and inotropic effects by stimulation of NPR-B receptors. Recently, we found possible intracardiac cross talk of natriuretic peptides showing negative regulation of ANP secretion by CNP through the NPR-B-cGMP pathway in isolated perfused beating atria (26).
On the other hand, cardiac hypertrophy induced by volume overload or chronic hypoxia causes an activation of ANP synthesis (8, 29-31, 34, 35) and modification of the ANP system (2, 20, 21), even though its physiological significance is still not clear. It is also reported that endogenous ANP suppressively regulates the development of cardiac myocyte hypertrophy (15), and cardiac hypertrophy is observed in transgenic mice lacking NPR-A (32). Therefore, the activation of the ANP system can be understandable as one of the cardiac compensatory mechanisms via the vasodilatory effect on the pulmonary arteriole (25), the inhibitory effect on cardiac myocyte and fibroblast hypertrophy (4, 15), and the diuretic effect (14) to reduce the severity of pulmonary hypertension and right ventricular hypertrophy. Recently, we have reported that atrial hypertrophy causes the modification of ANP release by stretch and endothelin-1 in isolated perfused nonbeating rat atria (20). However, it is not clear whether the intracardiac cross talk of natriuretic peptides is modified by atrial hypertrophy. Therefore, to determine the physiological role of CNP in atrial hypertrophy, the modification of the inhibitory effect of CNP on ANP secretion was investigated in hypertrophied atria obtained from monocrotaline (MCT)-treated rats.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Animals. Male Sprague-Dawley rats weighing 230-250 g were used. Rats were given a single subcutaneous injection of 60 mg/kg MCT or saline (18) and were killed at 4-5 wk.
Blood collection and tissue preparation.
On the day of the experiments, rats were killed by decapitation,
and blood was collected into a prechilled tube containing aprotinin
(200 kallikrein inhibitory units /ml), soybean trypsin inhibitor (SBTI;
50 N
-benzoyl-L-arginine ethyl ester
units/ml), phenylmethylsulfonyl fluoride (PMSF; 600 µM/ml), and EDTA
(2.7 mM/ml). Blood was centrifuged at 10,000 g for 15 min at
4°C, and plasma ANP was extracted using Sep-Pak C18
cartridge (Waters, Milford, MA). Both atria were separated, weighed,
and kept in 2 ml of 0.1 N acetic acid at 4°C. Tissues were boiled for
10 min, homogenized with Polytron homogenizer, and centrifuged at
10,000 g for 15 min at 4°C. The concentrations of ANP in
plasma extracts and tissue homogenates were measured by
radioimmunoassay (RIA) as described below.
Isolated perfused atrial preparation. Rats were killed by decapitation, and an isolated perfused atrial preparation was made by the method described previously (7, 19). Briefly, both atria were separately dissected from the heart, and a Tygon cannula containing three small catheters was inserted into the atrium. The cannulated atria were transferred, fitted into the organ chamber containing buffer solution (36.5°C), and fixed with a water-tight silicone rubber cap. The atrium was immediately perfused with oxygenated HEPES buffer solution at a rate of 0.4 ml/min with a peristatic pump. The composition of the buffer solution was as follows (in mM): 118 NaCl, 4.7 KCl, 2.5 CaCl2, 1.2 MgSO4, 25 NaHCO3, 10 HEPES, and 10 glucose plus 1% bovine serum albumin (BSA). The pericardial buffer solution containing [3H]inulin to measure the translocation of extracellular fluid (ECF) was also oxygenated by silicone tubing coils located inside the organ chamber. The pericardial space of the organ chamber was sealed and connected with a calibrated microcapillary tube, by which changes in atrial volume were monitored. The perfusate was collected at 2-min intervals at 4°C. After two collection periods, atrial distension was induced for 2 min by elevation of the position of the outflow catheter tip to 1 cmH2O, and atrial contraction was induced by lowering the position of the catheter tip to the basal level. Atrial pressure was subsequently increased from 0 to 2, 4, 6, and 10 cmH2O for 2 min every 8 min.
To define the inhibitory effect of CNP on the ANP secretion by atrial hypertrophy, both atria from MCT rats and control right atria were exposed to CNP (10
6 M) at the start of the
experiments. To determine whether the inhibitory effect of ANP
secretion by 8-bromo-cGMP (8-BrcGMP), a cell membrane-permeable cGMP,
is attenuated in hypertrophied atria, both atria from MCT rats were
also exposed to 8-BrcGMP (10
6 M).
RIA of ANP.
Immunoreactive ANP in the atrial perfusates was measured by use of
specific RIA, as described previously (6, 7). The secreted
amount of ANP was expressed as nanograms of ANP per minute per gram of
tissue. The molar concentration of ANP released was calculated as
follow (5)
|
Measurement of ECF translocation.
We have previously reported a two-step sequential mechanism of ANP
secretion from atria: 1) atrial release of ANP into
interstitial space by atrial stretch and 2) the secretion of
released ANP into atrial lumen concomitantly with ECF translocation by
contraction (5). The translocation of ECF is dependent on
atrial volume change. The ECF translocated from the atria was measured
as described previously (5). Radioactivity in atrial
perfusate and pericardial buffer solution was measured with a liquid
scintillation counter, and the amount of ECF translocated through the
atrial wall was calculated as follows
|
Preparation of perfused atrium for measurement of cGMP
production.
At the end of the experiments, atria were separated from atrial
cannula, lightly blotted, quickly frozen in liquid nitrogen, and stored
at
70°C until assay, as described elsewhere (26). Atrial tissues were minced in 2 ml of ice-cold trichloroacetic acid
(TCA; 6%) solution and homogenized at 4°C by three 30-s bursts of
maximal speed using Tissue Tearor (Biospec Products, Racine, WI). After
centrifugation at 1,000 g for 10 min at 4°C, supernatant was transferred to a polypropylene tube, subjected to ether extraction three times, and then dried using a Speed-Vac concentrator (Savant, Hicksville, NY). Dried samples were resuspended with 200 µl of sodium
acetate buffer.
Measurement of particulate guanylyl cyclase activity in atrial membranes. Atrium was homogenized at 4°C in 30 mM phosphate buffer (pH 7.2) containing 120 mM NaCl and 1 mM phenanthroline by three 30-s bursts of maximal speed using Tissue Tearor (Biospec Products). The homogenate was centrifuged at 1,500 g for 10 min at 4°C, and supernatant was recentrifuged at 40,000 g for 60 min at 4°C. The membrane pellet was washed three times with 50 mM Tris · HCl (pH 7.4) and resuspended in this solution. Protein contents were determined by bicinchoninic acid assay kit (Sigma Chemical, St. Louis, MO).
Particulate guanylyl cyclase (GC) activity was measured by the determination of cGMP generated in atrial tissue membranes according to a method described previously (22, 26). Five-microgram protein aliquots of the suspension were incubated at 37°C for 15 min in 50 mM Tris · HCl (pH 7.6; containing 1 mM isobutylmethylxanthine, 1 mM GTP, 0.5 mM ATP, 15 mM creatine phosphate, 80 µg/ml creatine phosphokinase, and 4 mM MgCl2) and 1 µM natriuretic peptides. Incubations were stopped by addition of 375 µl of cold 50 mM sodium acetate (pH 5.8) and by boiling for 5 min. Samples were then centrifuged at 10,000 g for 5 min at 4°C.RIA of cGMP. The amount of cGMP generated in the supernatant was measured by RIA (22, 26). Briefly, 2'-O-monosuccinylguanosine 3',5'-cyclic monophosphate tyrosyl methyl ester (cGMP-TME; Sigma Chemical) was iodinated by the chloramine-T method. Iodinated cGMP-TME was purified by a QAE Sephadex A-25 column (Sigma Chemical), and the specific activity of the iodinated tracer determined by RIA technique was 215 Ci/mmol (17).
Standards or samples were introduced in a final volume of 100 µl of 50 mM sodium acetate buffer (pH 4.8), and 100 µl each of diluted cGMP antiserum (Calbiochem-Novabiochem, San Diego, CA) and iodinated cGMP were added. After incubation at 4°C for 24 h, the bound form was separated from the free form by charcoal suspension. The measurement of cGMP generated was done on the day of experiments, and all samples in an experiment were analyzed in a single assay. Nonspecific binding of iodinated tracer was <2.4%. The 50% intercept was at 0.74 ± 0.03 pmol/tube (n = 10). The intra- and interassay coefficients of variation were 4.2% (n = 15) and 7.1% (n = 8), respectively. Results of the determinants were expressed as picomoles of cGMP generated per milligram of protein per minute.RT-PCR. RT-PCR was performed as described previously (21, 22). Total RNA was extracted from atria by use of TRI reagent (RNA/DNA/protein isolation reagent; MRC, Cincinnati, OH). One microgram of mRNA was suspended in 20 µl of RT buffer and reverse transcribed at room temperature for 10 min and at 42°C for 30 min. The reaction was stopped by heat inactivation for 5 min at 99°C and then chilled on ice. Complementary DNA products were amplified by PCR using primers. The sequences (5'-3') of the oligonucleotides and sizes of PCR products for NPR-B were as follows: sense, AACGGGCGCATTGTGTATATCTGCGGC; and antisense, TTATCACAGGATGGGTCG-TCCAAGTCA (692 bp). The temperature profile of amplification consisted of 30-s denaturation at 95°C, 1-min annealing at 60°C, and 2-min extension at 72°C for 30 (for glyceraldehyde-3-phosphate dehydrogenase; GAPDH) or 40 cycles (NPR-B). PCR products were separated in 2% agarose gels, and bands were visualized by ethidium bromide staining. The specificity of the amplified sequences was confirmed by DNA sequencing.
Statistical analysis. The results were given as means ± SE. Statistical significance of differences was performed by Student's t-test. The correlation coefficients were determined using least-squares linear regression analysis, and the comparison of slopes between ANP secretion and ECF translocation was performed by parallelism test. The critical level of significance was set at P value < 0.05.
| |
RESULTS |
|---|
|
|
|---|
The tissue weight of the right heart increased after injection of MCT. The ratio of right to left atrial weight increased from 1.04 ± 0.06 to 2.67 ± 0.15 (P < 0.001, n = 18) at 4 wk, and plasma concentration of ANP markedly increased (152.2 ± 23.5 vs. 460 ± 45.4 pg/ml, P < 0.01). The atrial concentration of ANP markedly decreased (124.4 ± 12.2 vs. 268.7 ± 26.2 ng/mg, P < 0.01) in hypertrophied right atria but not in nonhypertrophied left atria of MCT rats.
Stretch-induced ANP secretion by CNP from hypertrophied right atria
compared with nonhypertrophied left atria.
To evaluate changes in stretch-induced ANP secretion by CNP from
nonhypertrophied left atria in MCT rats, isolated perfused nonbeating
atria were used. The basal rate of ANP secretion was 5.83 ± 1.69 ng · min
1 · g
1 (n
= 10), which was suppressed by CNP (1.32 ± 0.34 ng · min
1 · g
1;
n = 11, P < 0.01; Fig.
1C). When atrial
pressure was increased from basal level to 2, 4, 6, or 10 cmH2O for 2 min by the elevation of outflow tip, atrial
volume (distension and reduction volume; DRV) was increased in
proportion to atrial pressure. Increases in DRV caused proportional
increases in ANP secretion that were suppressed by CNP. The basal rate
of ECF translocation was not changed, but the mechanically stimulated
ECF translocation was slightly increased by CNP (Fig. 1D).
Therefore, the secretion of ANP in relation to ECF translocation (ANP
concentration) was markedly decreased by CNP (Fig. 1E).
|
|
2.34, P = 0.42; Fig.
3D). Therefore, the concentration of ANP was significantly suppressed by CNP in nonhypertrophied left atria and control right atria but not in hypertrophied right atria, as shown in Fig.
4A.
|
|
Stretch-induced ANP secretion by 8-BrcGMP from hypertrophied right
atria.
To determine whether the inhibitory effect of ANP secretion by
8-BrcGMP, a cell membrane-permeable cGMP, is attenuated in hypertrophied atria, 8-BrcGMP (10
4 M) was perfused into
both left and right atria from MCT rats. Figure
5 shows the suppression of
stretch-induced ANP secretion by 8-BrcGMP in nonhypertrophied left
(n = 6, Fig. 5A) and hypertrophied right
atria (n = 6, Fig. 5B). Positive
relationships between changes in stretch-induced ANP secretion and ECF
translocation were shifted rightward and downward by 8-BrcGMP in both
atria. The slopes between those parameters made by 8-BrcGMP were
significantly different from corresponding control groups (0.35 ± 0.10 vs. 0.99 ± 0.14, P < 0.001 in
nonhypertrophied left atria; 0.39 ± 0.07 vs. 1.10 ± 0.21, P < 0.05 in hypertrophied right atria).
|
Activation of particulate GC by CNP in hypertrophied perfused atria
and tissue membranes.
To determine whether an attenuation of the inhibitory effect of CNP by
atrial hypertrophy may be due to the low amount of cGMP generation
through NPR-B, an isolated perfused nonbeating atrium exposed to CNP
was frozen in liquid nitrogen at the end of experiment, and cGMP was
extracted. CNP (10
6 M) elicited an increase in cGMP
production in nonhypertrophied left atria [3.40 ± 0.54 (n
= 7) vs. 2.21 ± 0.18 pmol/mg protein (n = 7), P < 0.025; Fig. 4B] and in control
right atria [3.35 ± 0.42 (n = 7) vs. 2.42 ± 0.25 pmol/mg protein (n = 7), P < 0.05; Fig. 4B]. In hypertrophied right atria, however, no
significant change in cGMP production by CNP was observed [1.90 ± 0.33 (n = 7) vs. 1.84 ± 0.29 pmol/mg protein
(n = 7), P = 0.45; Fig.
4B].
|
Gene expression of NPR-B in hypertrophied atria.
Figure 7 shows RT-PCR products for NPR-B
in both atria from control and MCT rats. Band of DNA was present in the
lanes corresponding to the expected size of the products for NPR-B. The
amount of PCR product for NPR-B corrected by GAPDH in hypertrophied
right atria was not different from that in nonhypertrophied left atria and control right atria (Fig. 7, n = 4).
|
| |
DISCUSSION |
|---|
|
|
|---|
The present study clearly shows that atrial hypertrophy caused an attenuation of the inhibitory effect of CNP on the ANP secretion, which may be partly due to the low amount of CNP-stimulated cGMP production in hypertrophied atria.
All of the natriuretic peptide family and their receptors are found in atrial myocytes and fibroblasts (13, 28, 30). Many investigators have tried to find out the intracardiac roles of natriuretic peptides and their cross talk. However, there are several reports about the possible intracardiac effect of ANP as an autocrine/paracrine factor. ANP inhibits catecholamine- and growth factor-induced DNA synthesis in cultured rat cardiac myocytes and fibroblasts (3, 4). Recently, Horio et al. (15) have also showed direct evidence for the inhibitory regulation of hypertrophy by endogenous ANP in cultured cardiac myocytes. Oliver et al. (32) have found hypertension and cardiac hypertrophy with interstitial fibrosis in NPR-A knockout mice. In contrast, transgenic mice overexpressing the ANP gene have a low heart weight under normoxia and a blunted right ventricular hypertrophy response to hypoxia-induced pulmonary hypertension. Taken together, the above reports suggest that ANP may play an important role in the regulation of cardiac hypertrophy/growth as an autocrine factor. Therefore, definition of the factors for the regulation of ANP secretion from hypertrophied heart is an important field for the understanding of pathogenesis of cardiac hypertrophy.
Cardiac hypertrophy associated with congestive heart failure induces reactivation of the ventricular ANP gene, which is markedly declined after birth, as well as atrial ANP. However, the significance of the activated ANP system is still unknown. It is reported that ANP may regulate its own release via NPR-A by atrial myocytes in a autocrine/paracrine manner (27). Recently, we found an accentuation of ANP secretion to endothelin (ET)-1 in hypertrophied atria (20) and the inhibitory regulation of ANP secretion by CNP via NPR-B-cGMP pathway in isolated perfused beating atria (26). Cardiac CNP level is extremely low, and plasma CNP level did not change in congestive heart failure (38). Therefore, the intracardiac effect of CNP as a local hormone may play an important role on the pathogenesis of cardiac hypertrophy. However, there is no report on the modification of intracardiac cross talk of ANP and CNP by atrial hypertrophy. The answer for this question may give us some idea for the physiological role of the endogenous CNP system in the pathogenesis of cardiac hypertrophy. In the present study, we found that an inhibitory effect of CNP on the ANP secretion was markedly attenuated in hypertrophied right atria. The ANP release in terms of ECF translocation by CNP was not changed in hypertrophied atria but decreased in nonhypertrophied atria. CNP specifically activates NPR-B, followed by increased cGMP production (24). Therefore, to determine whether the activation of GC through NPR-B may be impaired in hypertrophied atria, we measured the amount of cGMP production in atrial tissue exposed to CNP. The amount of cGMP generation in both hypertrophied atrial tissues and its membranes exposed to CNP was significantly lower than that in nonhypertrophied atrial tissues and membranes. However, suppression of ANP secretion by 8-BrcGMP (26), a cell membrane-permeable cGMP, was not affected by atrial hypertrophy. Therefore, the attenuation of the inhibitory effect of ANP secretion by CNP in hypertrophied atria may be due to the low amount of cGMP generation in tissue membranes exposed to CNP. In the present study, mRNA for NPR-B in hypertrophied atria was not different from that in nonhypertrophied atria. These results are not consistent with the report showing increased mRNA levels for NPR-A and NPR-B and decreased mRNA levels for NPR-C in progressive hypertrophied rat heart (2). The discrepancy may be due to the differences in method for the induction of cardiac hypertrophy and degree of hypertrophy. The possible explanation for the defect of cGMP generation in hypertrophied atria may be the low activity of GC or the enhanced activity of phosphodiesterase.
What is the significance of relief of negative inhibitory limb of CNP on the ANP secretion in cardiac hypertrophy? Progressive cardiac hypertrophy may lead to the activation of ANP synthesis and release with subsequent high concentration of plasma ANP and low concentration of atrial ANP (8, 29-31, 34). ANP stimulated by stretch and ET-1 (20) in hypertrophied atria may cause vasodilation of pulmonary artery (25) and diuresis (14), followed by the reduction of pressure and volume overload, and also inhibit cardiac hypertrophy (15, 16) as one of the compensatory mechanisms. In addition, the present study shows evidence that CNP may be another factor participating in the maintenance of a high level of plasma ANP in cardiac hypertrophy. Under normal conditions, CNP endogenously synthesized from cardiac myocytes and fibroblasts (13, 28) may act as an autocrine/paracrine regulator by inhibiting ANP secretion (26), atrial dynamics (1, 26), and cardiac growth (4, 12, 33) through NPR-B. CNP also has systemic effects such as vasodilation and diuresis but these are relatively weak compared with ANP. In the course of cardiac hypertrophy, CNP may relieve the negative inhibition of ANP secretion, followed by reduction of overload to the heart, even though the mechanisms are not clear at present.
The results showing the relief of negative limb of ANP secretion by CNP in hypertrophied atria suggest that CNP may be a contributing factor to delay the development of cardiac hypertrophy secondary to MCT-induced pulmonary hypertension.
Perspectives
Herein, we present an important finding that may provide a possible mechanism for the involvement of CNP in the development of cardiac hypertrophy. It has already been shown that ANP inhibits proliferation of cardiac fibroblasts, and cardiac hypertrophy with interstitial fibrosis is developed in NPR-A knockout mice. Although CNP also has the antigrowth effect of vascular smooth muscle, the involvement of CNP in the development of cardiac hypertrophy is not clear. Gene expression of cardiac CNP and its plasma level appear not to be influenced by cardiac hypertrophy, and a recent study using CNP knockout mice shows no evidence of cardiac hypertrophy. However, intracardiac action of CNP may be more important than that of ANP and BNP because of the high activity of cardiac GC-B compared with GC-A. CNP may act as a local hormone rather than a general hormone. Therefore, CNP may influence indirectly cardiac hypertrophy or development. Recently, we found the paracrine function of CNP in the heart to be a negative regulator of ANP secretion. The present study shows the attenuation of CNP-induced inhibition of ANP secretion by atrial hypertrophy due to the low activity of GC-B. Therefore, we suggest that CNP may be a contributing factor participating in the development of cardiac hypertrophy through the regulation of ANP secretion. Additional study is required to elucidate the cellular and molecular basis of regulation of GC-B by cardiac hypertrophy.| |
ACKNOWLEDGEMENTS |
|---|
We thank Kyong Sook Kim for administrative assistance.
| |
FOOTNOTES |
|---|
This work was supported by Korea Science and Engineering Foundation (98-0403-10-01-5) and Korea Research Foundation (2000-015-FP0023).
Address for reprint requests and other correspondence: S. H. Kim, 2-20 Keum-Am-Dong-San, Dept. of Physiology, Jeonbug National Univ., Medical School, Jeonju 560-180, Korea (E-mail shkim{at}moak.chonbuk.ac.kr).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 26 February 2001; accepted in final form 22 June 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Beaulieu, P,
Cardinal R,
Page P,
Francoeur F,
Trembly J,
and
Lambert C.
Positive chronotropic and inotropic effects of C-type natriuretic peptide in dogs.
Am J Physiol Heart Circ Physiol
273:
H1933-H1940,
1997.
2.
Brown, LA,
Nunez DJR,
and
Wilkins MR.
Differential regulation of natriuretic peptide receptor messenger RNAs during the development of cardiac hypertrophy in the rat.
J Clin Invest
92:
2702-2712,
1993.
3.
Calderone, A,
Thaik CM,
Takahashi N,
Chang DLF,
and
Colucci WS.
Nitric oxide, atrial natriuretic peptide, and cyclic GMP inhibit the growth-promoting effects of norepinephrine in cardiac myocytes and fibroblasts.
J Clin Invest
101:
812-818,
1998[Web of Science][Medline].
4.
Cao, L,
and
Gardner DG.
Natriuretic peptides inhibit DNA synthesis in cardiac fibroblasts.
Hypertension
25:
227-234,
1995
5.
Cho, KW,
Kim SH,
Hwang YH,
and
Seul KH.
Extracellular fluid translocation in perfused rabbit atria: implication in control of atrial natriuretic peptide secretion.
J Physiol (Lond)
468:
591-607,
1993
6.
Cho, KW,
Seul KH,
Kim SH,
Seul KM,
Ryu H,
and
Koh GY.
Reduction volume dependence of immunoreactive atrial natriuretic peptide secretion in isolated perfused rabbit atria.
J Hypertens
7:
371-375,
1989[Web of Science][Medline].
7.
Cho, KW,
Seul KH,
Ryu H,
Kim SH,
and
Koh GY.
Characteristics of distension-induced release of immunoreactive atrial natriuretic peptide in isolated perfused rabbit atria.
Regul Pept
22:
333-345,
1988[Web of Science][Medline].
8.
Comini, L,
Agnoletti G,
Panzali A,
Mantero G,
Pasini E,
Haia G,
Albertini A,
and
Ferrari R.
Activation of ANP synthesis during congestive heart failure in rats treated with monocrotaline.
Am J Physiol Heart Circ Physiol
268:
H391-H398,
1995
9.
DeBold, AJ.
Atrial natriuretic factor. A hormone produced by the heart.
Science
230:
767-770,
1985
10.
Drewett, JG,
and
Garbers DL.
The family of guanylyl cyclase receptors and their ligands.
Endocr Rev
15:
135-162,
1994
11.
Espiner, EA.
Physiology of natriuretic peptides.
J Intern Med
235:
527-541,
1994[Web of Science][Medline].
12.
Furuya, M,
Yoshida M,
Harayashi Y,
Ohnuma N,
Minamino N,
Kangawa K,
and
Matsuo H.
C-type natriuretic peptide is a growth inhibitor of rat vascular smooth muscle cells.
Biochem Biophys Res Commun
177:
927-931,
1991[Web of Science][Medline].
13.
Gerbes, AL,
and
Nemer M.
Detection of C-type natriuretic peptide compared with brain and atrial natriuretic peptide transcripts in human heart by the polymerase chain reaction.
Clin Investig
71:
672,
1993[Web of Science][Medline].
14.
Hirata, Y,
Suzuki E,
Hayakawa H,
Matsuoka H,
Sugimoto T,
Kojima M,
Kangawa K,
and
Matsuo H.
Role of endogenous ANP in sodium excretion in rats with experimental pulmonary hypertension.
Am J Physiol Heart Circ Physiol
262:
H1684-H1689,
1992
15.
Horio, T,
Nishikimi T,
Yoshihara F,
Matsuo H,
Takishita S,
and
Kangawa K.
Inhibitory regulation of hypertrophy by endogenous atrial natriuretic peptide in cultured cardiac myocytes.
Hypertension
35:
19-24,
2000
16.
Itoh, H,
Pratt RE,
and
Dzau VJ.
Atrial natriuretic polypeptide inhibits hypertrophy of vascular smooth muscle cells.
J Clin Invest
86:
1690-1697,
1990.
17.
Joseph, LJ,
Desai KB,
Mehta MN,
and
Mathiyarasu R.
Measurement of specific activity of radiolabelled antigens by a simple radioimmunoassay technique.
Nucl Med Biol
15:
589-590,
1988.
18.
Kay, JM,
Harris P,
and
Heath D.
Pulmonary hypertension in rats produced by the ingestion of Crotalaria spectabilis seeds.
Thorax
22:
176-170,
1967
19.
Kim, SH,
Cho KW,
Chang SH,
Kim SZ,
and
Chae SW.
Glibenclamide suppresses stretch-activated ANP secretion: involvements of K
20.
Kim SH, Lee KS, Seul KH, Kim SZ, and Cho KW. Accentuation of ANP
secretion to endothelin-1 in hypertrophied atria. Regul
Peptides. In press.
21.
Kim, SZ,
Cho KW,
and
Kim SH.
Modulation of endocardial natriuretic peptide receptors in right ventricular hypertrophy.
Am J Physiol Heart Circ Physiol
277:
H2280-H2289,
1999
22.
Kim, SZ,
Kim SH,
Park JK,
Koh GY,
and
Cho KW.
Presence and biological activity of C-type natriuretic peptide-dependent guanylate cyclase-coupled receptor in the penile corpus cavernosum.
J Urol
159:
1741-1746,
1998[Web of Science][Medline].
23.
Klinger, JR,
Siddiq FM,
Swift RA,
Jackson C,
Pietras L,
Warburton RR,
Alia C,
and
Hill NS.
C-type natriuretic peptide expression and pulmonary vasodilation in hypoxia-adapted rats.
Am J Physiol Lung Cell Mol Physiol
275:
L645-L652,
1998
24.
Koller, KJ,
Lowe DG,
Bennett GL,
Minamino N,
Kangawa K,
Matsuo H,
and
Goeddel DV.
Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide (CNP).
Science
252:
120-123,
1991
25.
Lee, KC,
and
Lappe RW.
Hypotensive response to atrial natriuretic factor in conscious chronic pulmonary hypertensive rats.
Eur J Pharmacol
158:
153-156,
1988[Web of Science][Medline].
26.
Lee, SJ,
Kim SZ,
Cui X,
Kim SH,
Lee KS,
Chung YJ,
and
Cho KW.
C-type natriuretic peptide inhibits ANP secretion and atrial dynamics in perfused atria: NPR-B-cGMP signaling.
Am J Physiol Heart Circ Physiol
278:
H208-H221,
2000
27.
Leskinen, H,
Vuolteenaho O,
Toth M,
and
Ruskoaho H.
Atrial natriuretic peptide (ANP) inhibits its own secretion via ANPA receptors: altered effect in experimental hypertension.
Endocrinology
138:
1893-1902,
1997
28.
Lin, X,
Hanze J,
Heese F,
Sodmann K,
and
Lang RE.
Gene expression of natriuretic peptide receptors in myocardial cells.
Circ Res
77:
750-758,
1995
29.
Matsubara, H,
Yamamoto J,
Hirata Y,
Mori Y,
Oikawa S,
and
Inada M.
Changes of atrial natriuretic peptide and its messenger RNA with development and regression of cardiac hypertrophy in renovascular hypertensive rats.
Circ Res
66:
176-184,
1990
30.
Nunez, DJ,
Dickson MC,
and
Brown MJ.
Natriuretic peptide receptor mRNAs in the rat and human heart.
J Clin Invest
90:
1966-1971,
1992.
31.
Oehlenschlager, WF,
Kurtz DT,
Baron DA,
and
Currie MG.
Enhanced activity of the cardiac endocrine system during right ventricular hypertrophy.
Mol Cell Endocrinol
62:
243-251,
1989[Web of Science][Medline].
32.
Oliver, PM,
Fox JE,
Kim R,
Rockman HA,
Kim HS,
Reddick RL,
Pandy KN,
Milgram SL,
Smithies O,
and
Maeda N.
Hypertension, cardiac hypertrophy, and sudden death in mice lacking natriuretic peptide receptor A.
Proc Natl Acad Sci USA
94:
14730-14735,
1997
33.
Porter, JG,
Catalano R,
McEnroe G,
Lewicki JA,
and
Protter AA.
C-type natriuretic peptide inhibits growth factor-dependent DNA synthesis in smooth muscle cells.
Am J Physiol Cell Physiol
263:
C1001-C1006,
1992
34.
Raine, AEG,
Erne P,
Burgisser RE,
Muller FB,
Bolli P,
Burkart F,
and
Buhler FR.
Atrial natriuretic peptide and atrial pressure in patients with congestive heart failure.
N Engl J Med
315:
533-537,
1986[Abstract].
35.
Shah, AM.
Paracrine modulation of heart cell function by endothelial cells.
Cardiovasc Res
31:
847-867,
1996[Web of Science][Medline].
36.
Sudoh, T,
Kangawa K,
Minamino N,
and
Matsuo H.
A new natriuretic peptide in porcine brain.
Nature
332:
78-81,
1988[Medline].
37.
Sudoh, T,
Minamino N,
Kangawa K,
and
Matsuo H.
C-type natriuretic peptide (CNP): a new member of natriuretic peptide family identified in porcine brain.
Biochem Biophys Res Commun
168:
863-870,
1990[Web of Science][Medline].
38.
Wei, CM,
Heublein DM,
Perrella MA,
Lerman A,
Rodeheffer RJ,
McGregor CG,
Edwards WD,
Schaff HV,
and
Burnett JC, Jr.
Natriuretic peptide system in human heart failure.
Circulation
88:
1004-1009,
1993
This article has been cited by other articles:
![]() |
J. H. Han, C. Cao, S. M. Kim, F. L. Piao, and S. H. Kim Attenuation of Lysophosphatidylcholine-Induced Suppression of ANP Release From Hypertrophied Atria Hypertension, February 1, 2004; 43(2): 243 - 248. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Han, C. Cao, S. Z. Kim, K. W. Cho, and S. H. Kim Decreases in ANP Secretion by Lysophosphatidylcholine Through Protein Kinase C Hypertension, June 1, 2003; 41(6): 1380 - 1385. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Kim, J. H. Han, C. Cao, S. Z. Kim, and K. W. Cho Postnatal changes in inhibitory effect of C-type natriuretic peptide on secretion of ANP Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2002; 282(6): R1672 - R1679. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |