AJP - Regu Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 282: R1286-R1296, 2002; doi:10.1152/ajpregu.00653.2001
0363-6119/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (55)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tchkonia, T.
Right arrow Articles by Kirkland, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tchkonia, T.
Right arrow Articles by Kirkland, J. L.
Vol. 282, Issue 5, R1286-R1296, May 2002

Fat depot origin affects adipogenesis in primary cultured and cloned human preadipocytes

Tamara Tchkonia1, Nino Giorgadze1, Tamar Pirtskhalava1, Yourka Tchoukalova2, Iordanes Karagiannides1, R. Armour Forse3, Matthew DePonte4, Michael Stevenson4, Wen Guo1, Jianrong Han1, Gerri Waloga4, Timothy L. Lash1, Michael D. Jensen2, and James L. Kirkland1,5

1 Evans Department of Medicine and Departments of 3 Surgery and 5 Biochemistry, Boston University Medical Center, Boston, Massachusetts 02118; 2 Division of Endocrinology and Metabolism, Department of Internal Medicine, the Mayo Clinic, Rochester, Minnesota 55905; and 4 AdipoGenix, Boston, Massachusetts 02118


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Fat distribution varies among individuals with similar body fat content. Innate differences in adipose cell characteristics may contribute because lipid accumulation and lipogenic enzyme activities vary among preadipocytes cultured from different fat depots. We determined expression of the adipogenic transcription factors peroxisome proliferator activated receptor-gamma (PPAR-gamma ) and CCAAT/enhancer binding protein-alpha (C/EBP-alpha ) and their targets in abdominal subcutaneous, mesenteric, and omental preadipocytes cultured in parallel from obese subjects. Subcutaneous preadipocytes, which had the highest lipid accumulation, glycerol-3-phosphate dehydrogenase (G3PD) activity, and adipocyte fatty acid binding protein (aP2) abundance, had highest PPAR-gamma and C/EBP-alpha expression. Levels were intermediate in mesenteric and lowest in omental preadipocytes. Overexpression of C/EBP-alpha in transfected omental preadipocytes enhanced differentiation. The proportion of differentiated cells in colonies derived from single subcutaneous preadipocytes was higher than in mesenteric or omental clones. Only cells that acquired lipid inclusions exhibited C/EBP-alpha upregulation, irrespective of depot origin. Thus regional variation in adipogenesis depends on differences at the level of transcription factor expression and is a trait conferred on daughter cells.

adipocyte fatty acid binding protein; fatty acid binding protein; peroxisome proliferator activated receptor-gamma ; CCAAT/enhancer binding protein-alpha


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

REGIONAL DISTRIBUTION of fat tissue varies considerably, even among individuals with the same total body fat content. For several decades, it has been appreciated that fat tissue is regionally heterogeneous with respect to metabolic function (2, 29, 30). Fat cells isolated from different depots of rats and humans differ in size, responses to insulin and lipolytic agents, lipoprotein lipase release, lipid synthetic capacity, fatty acid incorporation, and other characteristics (2, 6, 11, 14, 18, 23, 36, 37, 47, 53, 56, 58). These observations lead to the following question: Is interdepot variation solely a result of influences extrinsic to adipose cells (including their hormonal and paracrine microenvironment, local nutrient availability, innervation, and anatomic constraints), or do intrinsic differences in the innate characteristics of adipose cells also contribute? The latter may be the case because regional variation in capacity for differentiation of preadipocytes cultured in identical conditions originating from various depots from the same individuals has been observed (1, 9, 10, 19, 32, 33, 61). A problem with the studies of effects of fat depot origin on human preadipocyte differentiation is that interdepot differences in extent of contamination of primary cultures with nonadipose cell types, such as mesothelial cells and fibroblasts, are a potential cause of apparent differences in adipogenesis. Additionally, it has not been clear if interdepot differences in human preadipocyte capacity for differentiation depend on variation at the level of adipogenic transcription factor expression or solely on later events during the differentiation process.

To explore the cellular and molecular basis for regional differences in human preadipocyte function, we determined effects of fat depot origin on the key adipogenic transcription factors, peroxisome proliferator activated receptor-gamma (PPAR-gamma ) and CCAAT/enhancer binding protein-alpha (C/EBP-alpha ), and downstream targets, glycerol-3-phosphate dehydrogenase (G3PD) and adipocyte fatty acid binding protein (aP2), in abdominal subcutaneous, mesenteric, and omental preadipocytes. Abdominal subcutaneous and omental preadipocytes were studied for the following reasons. Differences in lipid accumulation, lipogenic enzyme activities, and function of preadipocytes and fat cells isolated from these depots have been found (1, 6, 11, 23, 47, 53). Increased visceral relative to subcutaneous fat is associated with increased risk of atherosclerosis, diabetes, hypertension, and dyslipidemia (5, 8, 15, 16, 25, 35-37, 40, 44, 51). Little is known about the characteristics of preadipocytes from the other major visceral fat depot, the mesenteric depot, which were therefore also studied.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Human subjects. Fat tissue was resected during gastric bypass surgery for management of obesity from 16 subjects who had given informed consent. The protocol was approved by the Boston University Medical Center Institutional Review Board for Human Research. All subjects had fasted at least 10 h. Four of the subjects were men and 12 were women. Subjects were 42 ± 2 yr of age (mean ± SE; range 29-61). The subjects' mean body mass index was 54 ± 2 kg/m2. Subjects with malignancies were excluded. No subjects were taking thiazolidinediones or steroids. None had fasting plasma glucose levels over 120 mg%. Two to 10 g of abdominal subcutaneous (external to the fascia superficialis), mesenteric, and greater omental fat were obtained from each subject.

Preadipocyte culture. Fat tissue was minced and then digested in Hanks' balanced salt solution containing 1 mg/ml collagenase and 7.5% fetal bovine serum (FBS) in a 37°C shaking water bath until fragments were no longer visible and the digest had a milky appearance. Digests were filtered and centrifuged at 800 g for 10 min. The digests were treated with an erythrocyte lysis buffer to improve subsequent differentiation (20, 60). The cells were then plated by using a low-serum plating medium (1:1 DMEM:Ham's F12 that contained 0.5% bovine serum and antibiotics) at a density of 4 × 104 cells/cm2. Macrophages were rare (<5 per 106 cells as assessed by phase-contrast microscopy) in the replated cultures, irrespective of fat depot origin. Plating medium was changed every 2 days until confluence.

Preadipocyte cloning. Preadipocytes were isolated as described above and were plated at a density of 50 cells/96-well plate in plating medium. At this density, the probability of any one well's being seeded by more than one cell is <2% (32, 61). After 2 wk, colonies were evident and by 3 wk, some were near confluence. Cloning efficiency ranged from 10 to 30%. From 3 wk, the clones were exposed to the differentiation-inducing medium described below. The percentage of clones that contained at least one differentiated cell was determined 15, 30, 45, and 60 days after addition of differentiation-inducing medium by observers who did not know the fat depot origin of the cultures. Also, the percentage of cells within each of the colonies that had differentiated was determined after 30 days. A differentiated cell was considered to be one that contained doubly refractile inclusions visible by low-power phase-contrast microscopy, as previously described in cloned rat preadipocyte studies (32, 61). The lipid nature of these inclusions was confirmed by staining with oil red O. Human lung fibroblasts cultured under identical conditions never developed such lipid inclusions after up to 60 days of treatment with differentiation-inducing medium.

Preadipocyte differentiation. From confluence, first to fourth passage cells were either held in an undifferentiated state by using plating medium without serum, or were differentiated. For differentiation, a previously published method (21) was used with modifications that included the following. Mass cultures were treated for 7-10 days (4 h to 14 days in differentiation time course experiments) and clones for up to 60 days (as indicated in RESULTS and figure legends) with plating medium (without serum) enriched with 100 nM dexamethasone, 500 nM human insulin, 200 pM triiodothyronine, 0.5 µM rosiglitazone, antibiotics, and 540 µM IBMX (removed after 2 days). In preliminary studies, higher rosiglitazone and insulin concentrations did not further enhance differentiation of subcutaneous, mesenteric, or omental preadipocytes. Medium was changed every 2 days in mass cultures and weekly in clones.

DNA transfection. Omental preadipocytes were cotransfected with pMT2rC/EBP-alpha and pMSV-beta gal (Invitrogen) at a by molar ratio of 5:1 (transcription factor:reporter construct) by using the calcium phosphate precipitation method (62) without glycerol shock treatment to ensure that transfected cells detected by staining for beta -galactosidase would also be expressing C/EBP-alpha . Approximately 15% of transfected cells were positive for beta -galactosidase. Increased C/EBP-alpha expression in transfected cells was verified by Western immunoanalysis. Mock-control cells were transfected with a plasmid, PVG 9607(GAPDH) (41), that expresses glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and that had no effect on lipid accumulation compared with untransfected cells, and pMSV-beta gal, also at a 5:1 molar ratio. After 48 h of culture in differentiation medium, cultures were fixed in 3% formaldehyde and stained with the chromatographic beta -galactosidase substrate, x-gal, to identify transfected cells (57). Observers unaware of the origin of the cells assessed extent of differentiation by examining transfected cells for the presence of doubly refractile lipid inclusions by using low-power phase-contrast microscopy (32, 61). The proportion of transfected cells containing such inclusions was compared with that of parallel mock-control cultures.

Glycerol-3-phosphate dehydrogenase. Glycerol-3-phosphate dehydrogenase (G3PD) was measured in supernatants of cell homogenates by following NADH disappearance spectrophotometrically (39), as described previously (34). G3PD activity was below the detection limit of our assay in undifferentiated cells.

Western immunoblot analyses. Cultures were washed with PBS and scraped into RIPA buffer (64). SDS-PAGE was performed (43). The protein was transferred to Immobilon polyvinylidene difluoride membranes for probing, and the gels were stained to visualize banding and confirm protein integrity. Blotting paper was blocked for 1 h at room temperature in Tris-buffered saline containing 5% milk, 0.5% BSA, and 0.1% Tween 20. Incubation with anti-aP2 primary antibody (kindly provided by D. A. Bernlohr) was for 1 h at 24°C and with anti-PPAR-gamma antibody [cat. no. sc-7273 (E-8), Santa Cruz Biotechnology, Santa Cruz, CA] was for 4 h (45). Blots were incubated for 30 min at room temperature with secondary antibody conjugated to horseradish peroxidase. Visualization of secondary antibody binding was performed by chemiluminescence. Five micrograms of protein were loaded in each lane for measuring aP2 and 20 µg for measuring PPAR-gamma . In preliminary studies, linearity was confirmed over the range of aP2 and PPAR-gamma levels encountered in preadipocytes when these amounts of protein were loaded. Total protein contents (pg/cell) were 305 ± 32 and 310 ± 38 in undifferentiated and differentiated preadipocytes, respectively. Protein was quantified by densitometry.

Confocal immunofluorescence studies. Abdominal subcutaneous, mesenteric, and omental preadipocyte clones from three subjects were exposed to differentiation medium for 15, 55, and 55 days, respectively. The clones were washed twice with PBS, fixed in 1% paraformaldehyde for 20 min, and washed again with water. The clones were incubated for 10 min in DAKO serum-free protein blocking buffer (cat. no. X0909, DAKO, Carpinteria, CA) and 0.1% saponin (cat. no. S-7900, Sigma Chemicals, St. Louis, MO). Next, the clones were incubated for 1 h in 50 µl of a 1:37.5 dilution of rabbit polyclonal anti-C/EBP-alpha antibody (cat. no. sc-61, Santa Cruz Biotech) at room temperature, washed in PBS, and fluorescently labeled in a 1:200 dilution of a chicken anti-rabbit antibody conjugated with Alexa Fluor 488 fluorochrome (A-21441, Molecular Probes, Eugene, OR). After a final wash with PBS, images of the labeled cells were immediately collected on an LSM510 confocal system (Zeiss, Oberkochen, Germany) equipped with an Axiovert 100M inverted microscope and an LD-Achroplan 40×/0.6 NA objective lens. Excitation was from the 488-nm line of an argon/krypton laser. Emission was detected above 505 nm.

RNA analysis. For RNA analyses, RNA was isolated from preadipocytes by using the guanidinium thiocyanate-phenol method (7). RNA integrity was verified by using 1% formaldehyde-containing denaturing agarose gels. mRNA was measured by relative quantitative RT-PCR in which target genes were coamplified with internal control sequences [18S rRNA or hypoxanthine phosphoribosyl transferase (HPRT)] (49). Analysis of mRNA expression was carried out during the exponential phase of the amplification, which was assessed in preliminary experiments for each set of primers. Amplified product reproducibility was confirmed by two PCR rounds. The ratios of intensity of target to internal control bands were used to indicate the relative abundance of message in the samples. This allows quantitative data to be obtained because 18S rRNA and HPRT abundance are not affected by depot origin or differentiation of preadipocytes. 18S rRNA amplification was titrated to match that of PPAR-gamma 1 and -gamma 2 by adding competitive primers (Ambion, Austin, TX) that modulate extension of the 18S cDNA. HPRT mRNA abundance was close to that of C/EBP-alpha . The quantitative nature of this approach was confirmed by measuring the transcription factor mRNAs in serially diluted samples. RNA preparations were checked for DNA contamination by amplifying control aliquots that had not been reverse transcribed. The following primers were used: for PPAR-gamma 1, sense CTCGAGGACACCGGAGAGG and antisense GCATTATGAGACATCCCCAC (based on sequence accession no. NM002957); for PPAR-gamma 2, sense GCGATTCCTTCACTGATAC and antisense GCATTATGAGACATCCCCAC (3); for C/EBP-alpha , sense GACACGCTGCGGGGCATCT and antisense CTGCTCCCCTTCCTTCTCTCA (65); and for HPRT, sense CTTGCTCGAGATGTCATGAAG and antisense GTTTGCATTGTTTTACCAGTG (based on sequence accession no. J00423).

Statistical analysis. Results are means ± SE, and significance determination was by paired t-tests or ANOVA with post hoc comparisons by Duncan's multiple range test (24, 28). P < 0.05 was considered significant. In transfection experiments, comparisons of numbers of transfected cells were made by logistic regression analysis, with P values determined from log likelihood ratios (38).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Preadipocyte differentiation depends on fat depot origin. Extent of lipid accumulation was determined in abdominal subcutaneous, omental, and mesenteric preadipocytes that had been isolated from the same subjects. After the preadipocytes had been treated with differentiation-inducing medium for 10 days following confluence, morphologically apparent lipid accumulation was greatest in differentiating abdominal subcutaneous preadipocytes, less extensive in mesenteric cells, and least extensive in omental cells (Fig. 1). G3PD activity exhibited a similar pattern. After 10 days of treatment with differentiation medium, primary abdominal subcutaneous preadipocyte G3PD activity was 720 ± 184, mesenteric was 99 ± 47, and omental was 14 ± 4 nmol · s-1 · 106 cells-1 (effect of depot origin: P < 0.001; n = 6; ANOVA; subcutaneous > mesenteric or omental, P < 0.05; Duncan's multiple range test).


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 1.   Lipid accumulation is greatest in differentiating abdominal subcutaneous (S) preadipocytes, less extensive in mesenteric (M) cells, and lowest in omental (O) cells. Preadipocytes were isolated from each depot from the same subject, passaged once, and treated with differentiation-inducing medium for 10 days after confluence. Bar, 40 µm.

aP2 expression increases earlier and to a greater extent in subcutaneous than visceral differentiating preadipocytes. Interdepot variation in aP2 protein abundance exhibited a pattern similar to that of lipid accumulation and G3PD activity (Fig. 2). Fourth passage abdominal subcutaneous, mesenteric, and omental preadipocytes were treated for 10 days either with differentiation-inducing medium or a control, basal medium that does not promote differentiation. Abundance of aP2 was higher in abdominal subcutaneous than mesenteric cells (P < 0.01; Duncan's multiple range test; n = 6) and lower in omental than mesenteric preadipocytes (P < 0.01). Undifferentiated cells expressed little aP2 (1.7 ± 1.0, 2.4 ± 1.0, and 2.3 ± 1.3% in abdominal subcutaneous, mesenteric, and omental preadipocytes, respectively; effect of differentiation, P < 0.00001; effect of fat depot origin, P = nonsignificant; ANOVA).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2.   Fat depot origin affects differentiating human preadipocyte adipocyte fatty acid binding protein (aP2) protein abundance. aP2 protein abundance was measured in 4th passage abdominal subcutaneous (left), mesenteric (middle), and omental (right) preadipocytes treated for 10 days with differentiation-inducing medium (Diff) or a control, basal medium (Undiff) that does not promote differentiation. Top: Western immunoblot representative of 6 separate experiments. Bottom: means ± SE, with values expressed as percentages of optical density (OD) within each experiment normalized for cellular protein content.

To determine if this interdepot variation in aP2 expression results from a delayed response to inducers of differentiation in omental compared with subcutaneous cells or variation in peak levels achieved, we examined the time course of the differentiation-dependent increase in aP2 protein levels (Fig. 3). We found that aP2 abundance increased earlier during differentiation and to a greater extent in abdominal subcutaneous than omental preadipocytes.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 3.   aP2 protein levels increase earlier during differentiation and to a greater extent in abdominal subcutaneous (top) than in omental (bottom) preadipocytes. Control preconfluent preadipocytes (PC) were cultured in plating medium, and confluent cultures were exposed to differentiation medium for 4 h to 14 days before harvesting for Western immunoblot analysis. Five micrograms of protein were loaded in each lane. The blots shown are representative of 2 experiments.

Adipogenic transcription factor expression is higher in differentiating subcutaneous than visceral preadipocytes. Because adipogenesis in general, and aP2 and G3PD expression in particular, depend on PPAR-gamma expression, we measured the time course of PPAR-gamma protein expression in abdominal subcutaneous and omental preadipocytes (Fig. 4). Abdominal subcutaneous preadipocytes expressed more PPAR-gamma protein, particularly the more adipose-specific PPAR-gamma 2 isoform, than omental preadipocytes throughout the course of differentiation.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4.   Abdominal subcutaneous preadipocytes (top) express more peroxisome proliferator activated receptor-gamma (PPAR-gamma ) protein than do omental preadipocytes (bottom) during differentiation. Control preconfluent preadipocytes (PC) were cultured in plating medium, and confluent cultures were exposed to differentiation medium for 4 h to 14 days before harvesting for Western immunoblot analysis. Twenty micrograms of protein were loaded in each lane. The blots shown are representative of 2 experiments. gamma 1, PPAR-gamma 1; gamma 2, PPAR-gamma 2.

To determine whether variation among depots in preadipocyte PPAR-gamma 2 expression is pretranslational, PPAR-gamma 1 and -gamma 2 mRNA levels were assayed in abdominal subcutaneous, mesenteric, and omental third passage preadipocytes that had been treated with differentiation-inducing medium for 7 days (Fig. 5). Both PPAR-gamma 1 and -gamma 2 mRNA levels were higher in abdominal subcutaneous than in visceral preadipocytes cultured from the same subjects (abdominal subcutaneous > mesenteric or omental, P < 0.01; n = 5; Duncan's multiple range test). Thus variations in PPAR-gamma and aP2 expression, G3PD activity, and lipid accumulation among depots are similar.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5.   PPAR-gamma mRNA levels are higher in differentiating abdominal subcutaneous than in visceral preadipocytes. Third passage cultures were treated with differentiation-inducing medium for 7 days. PPAR-gamma 1 (open bars) and -gamma 2 (filled bars) mRNAs were assayed by RT-PCR with 18S rRNA as an internal control. PPAR-gamma 1 and -gamma 2 mRNA levels were higher in abdominal subcutaneous than in visceral (mesenteric and omental) preadipocytes cultured from the same subjects. Top: gels representative of those from 5 subjects. Bottom: means ± SE of densitometric analyses of PPAR-gamma mRNA abundance in these experiments, expressed as percentages of 18S rRNA and normalized within experiments.

Adipogenesis, G3PD activity, and aP2 and PPAR-gamma expression are enhanced in rodent preadipocyte cell lines by C/EBP-alpha (22, 52, 63). Interdepot variation in preadipocyte C/EBP-alpha mRNA abundance in differentiating human preadipocytes mirrored that of PPAR-gamma 2. C/EBP-alpha expression was higher in abdominal subcutaneous than mesenteric preadipocytes treated with differentiation-inducing medium for 7 days (Fig. 6; P < 0.01; n = 5; Duncan's multiple range test). C/EBP-alpha was more abundant in mesenteric than omental preadipocytes (P < 0.01; n = 5; Duncan's multiple range test). Furthermore, C/EBP-alpha overexpression enhanced lipid accumulation in omental preadipocytes (Fig. 7). C/EBP-alpha and beta -gal expression vectors were cotransfected at a 5:1 molar ratio so that only cells transfected with C/EBP-alpha would be detected by beta -gal staining (26). Control cells were transfected with a GAPDH expression vector, also with the beta -gal expression vector at a 5:1 molar ratio. After 7 days of treatment with differentiation-inducing medium, the proportions of beta -gal-expressing cells that contained doubly refractile lipid inclusions visible by low-power phase-contrast microscopy were determined in C/EBP-alpha - and control-transfected cultures by observers who were unaware of the treatments performed on the cultures. Over threefold more omental preadipocytes transfected with the C/EBP-alpha expression vector accumulated lipid than did control cells (odds ratio 3:1; 95% confidence interval 2.1-4.5; P < 0.0001; n = 3 subjects, 100 C/EBP-alpha - and 100 mock-transfected cells/subject). Thus adipogenesis in omental preadipocytes is augmented by C/EBP-alpha overexpression, and genes responsible for lipid accumulation are capable of responding to overexpressed levels of C/EBP-alpha in omental cells.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 6.   CCAAT/enhancer binding protein-alpha (C/EBP-alpha ) mRNA abundance varies among differentiating preadipocytes cultured from different fat depots. Third passage preadipocytes cultured from the same subjects were treated with differentiation-inducing medium for 7 days. C/EBP-alpha levels were highest in abdominal subcutaneous (left), intermediate in mesenteric (middle), and lowest in omental (right) cells. Top: gel representative of those from 5 subjects. Bottom: means ± SE of densitometric analyses of C/EBP-alpha mRNA abundance in these experiments, expressed as percentages of hypoxanthine phosphoribosyl transferase (HPRT) mRNA and normalized within experiments.



View larger version (78K):
[in this window]
[in a new window]
 
Fig. 7.   C/EBP-alpha transfection of human omental preadipocytes enhances differentiation. Omental preadipocytes were transfected with a construct that expresses C/EBP-alpha and another that expresses beta -gal (C/EBP-alpha ) or a construct that expresses glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and the beta -gal construct (Control). The C/EBP-alpha transfectants accumulated more lipid than the controls. Bar, 40 µm.

Cloned preadipocytes exhibit regional differences in adipogenesis. Stromal vascular digests can contain mesothelial cells, macrophages, and other cell types in addition to preadipocytes. These nonadipose cell types could contribute to apparent regional variation in adipogenesis in primary cultures. To test this possibility, colonies arising from single abdominal subcutaneous, mesenteric, and omental cells cloned by plate dilution from three different patients were exposed to differentiation-inducing medium for 60 days (n = 20-376 clones per fat depot per patient). Regional differences in adipogenesis were evident in these clones (Fig. 8). The percentage of colonies that contained at least one differentiated cell (doubly refractile inclusions visible by low-power phase-contrast microscopy) was determined after 15, 30, 45, and 60 days. After 60 days, differentiated cells were found in every colony, confirming the purity of the preadipocyte cultures isolated by using our methods (Fig. 9). No such differentiated cells with doubly refractile inclusions were found in human lung fibroblasts cultured under identical conditions. Thus admixture with other cell types does not explain regional differences in adipogenesis.


View larger version (164K):
[in this window]
[in a new window]
 
Fig. 8.   Regional differences in adipogenesis are evident in colonies derived from single preadipocytes. Colonies arising from abdominal subcutaneous (left), mesenteric (middle), and omental (right) preadipocytes that had been cloned by plate dilution 3 wk previously were exposed to differentiation-inducing medium for 10, 20, or 40 days when phase-contrast photomicrographs were taken. Bar, 100 µm. All photomicrographs are at the same magnification.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 9.   Differentiation occurs more rapidly in abdominal subcutaneous than in visceral preadipocyte clones. Colonies arising from single abdominal subcutaneous (), mesenteric (open circle ), and omental (black-triangle) preadipocytes from 3 different patients were exposed to differentiation-inducing medium on day 0 (n = 20-376 clones per fat depot per patient). The mean percentages (±1 SE) of colonies that contained at least 1 differentiated cell (doubly refractile inclusions visible by low-power phase-contrast microscopy) after 15, 30, 45, and 60 days are shown.

As in the time course studies of aP2 expression in differentiating mass cultures (Fig. 3), the cloning experiments confirmed that differentiation progresses faster in abdominal subcutaneous than in visceral preadipocytes (Fig. 9). Differentiated cells appeared most rapidly in subcutaneous preadipocyte clones, mesenteric clones were intermediate, and appearance of differentiated cells in omental clones took the longest. Even though colonies were derived from single cells, variation in extent of differentiation was evident among the cells within these colonies for over 60 days after cloning (Figs. 8 and 10), much as occurs in mass cultures. The proportion of differentiated cells was highest in abdominal subcutaneous, intermediate in mesenteric, and lowest in omental colonies that had been exposed to differentiation-inducing medium for 30 days (Fig. 10; subcutaneous > mesenteric, and mesenteric > omental, each P < 0.0005; Duncan's multiple range test). Unlike in rodent preadipocyte cell lines, we found that primary human preadipocytes did not need to be confluent to undergo adipogenesis, as previously reported by others (13). Thus interdepot variation in adipogenesis is evident in colonies derived from single preadipocytes, raising the possibility that regional differences in the intrinsic properties of preadipocytes could contribute to the distinct characteristics of fat tissue in different depots.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 10.   A higher proportion of cells differentiate in colonies arising from single subcutaneous than from visceral preadipocytes. Abdominal subcutaneous, mesenteric, and omental preadipocyte colonies arising from single cells cloned from 3 patients (1, 2, and 3) 3 wk previously were exposed to differentiation-inducing medium for 30 days. The percentage of differentiated cells within each colony that contained at least 1 differentiated cell was determined (n = 10-80 colonies per fat depot per subject). Means of these percentages (±1 SE) are shown.

Differentiated preadipocytes expressed higher levels of C/EBP-alpha than less differentiated cells, irrespective of fat depot origin (Fig. 11). Sixty abdominal subcutaneous, 61 mesenteric, and 37 omental clones from three subjects were treated with C/EBP-alpha antibody and examined by confocal microscopy. Abdominal subcutaneous clones, which exhibited the most extensive differentiation, were studied after 15 days so that fields containing cells with little lipid accumulation, as well as fields with extensive lipid accumulation, could be examined. By 55 days after induction of differentiation, it was difficult to find subcutaneous clones with fields of cells that did not contain lipid. Visceral preadipocyte clones, in which differentiation occurred later than in subcutaneous clones, were examined after 55 days so fields containing cells with extensive, as well as limited, lipid accumulation could also be examined. We found that those cells with the highest nuclear C/EBP-alpha expression also exhibited the most differentiated morphology, suggesting that the mechanism responsible for regional differences in adipogenesis operates upstream of C/EBP-alpha .


View larger version (71K):
[in this window]
[in a new window]
 
Fig. 11.   Preadipocyte differentiation is associated with increasing C/EBP-alpha abundance at the single cell level, irrespective of fat depot origin. Cloned abdominal subcutaneous (left), mesenteric (middle), and omental (right) preadipocytes from the same subject were treated with differentiation-inducing medium for 15, 55, and 55 days, respectively, stained with anti-C/EBP-alpha antibody and fluorescently labeled secondary antibody, and examined by confocal microscopy. Fluorescent images are superimposed on phase-contrast photomicrographs of cells in the top rows of each panel. Darkfield images are shown in the bottom rows. Arrows, nuclei. In A, fields containing the more extensively differentiated cells in clones from each fat depot are shown. In B, fields containing the least differentiated cells from each depot are shown. Bar, 50 µm. All photomicrographs are at the same magnification. The results shown are representative of those using cells from 3 different subjects.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Fat depot origin affects the capacity of human preadipocytes to differentiate, potentially contributing to regional differences in adipose tissue growth and function. Abdominal subcutaneous cells had the highest adipogenic capacity, as indicated by lipid accumulation, G3PD activity, and aP2, PPAR-gamma , and C/EBP-alpha expression. Mesenteric cells, which have rarely been studied in the past, had an intermediate capacity for adipogenesis, and omental cells had the lowest. Adipogenesis took longer in omental than in subcutaneous cells. In another study, lipid accumulation and G3PD activity were higher in differentiating human abdominal than in femoral subcutaneous preadipocytes (19). Thiazolidinediones (PPAR-gamma activating ligands) caused more extensive differentiation of human subcutaneous than omental cells (1). Together, these findings support the hypothesis that fat depot origin affects capacity of preadipocytes to differentiate in humans.

Other differences in the characteristics of human preadipocytes from various depots have been described. Greater susceptibility of human omental than abdominal subcutaneous preadipocytes to apoptosis induced by serum deprivation and tumor necrosis factor-alpha has been found (50). We found more extensive transfer of fatty acids into differentiated human omental than abdominal subcutaneous preadipocytes from the same subjects, even after matching cells for lipid content, consistent with the greater fatty acid flux in visceral than in subcutaneous fat (6). In these other studies, regional differences in preadipocyte characteristics were evident in cells cultured under identical conditions for up to four subcultures, and in the current study, in colonies arising from single cells for over 60 days. Thus preadipocytes from different regions appear to be inherently distinct.

Rat studies also support the contention that fat cells from different regions are inherently distinct. Preadipocytes cultured from perirenal depots were shown to be capable of more extensive replication and differentiation in vitro and in vivo than preadipocytes from epididymal depots (9, 10, 32, 33, 46, 61). Despite exposure to similar hormonal manipulations in vivo such as estrogen administration, hypophysectomy, or castration, preadipocytes cultured from various depots of rats retained distinct cell dynamic and biochemical responses (31, 42). These depot-dependent differences in the innate characteristics of adipose cells could contribute to anatomic variation in function. Indeed, interdepot variation in cultured rat preadipocyte differentiation-dependent gene expression was reflected in differences among depots in expression of the same genes in fat cells (33). Thus rat preadipocyte studies are in accord with the hypothesis that interdepot variation in fat cell function reflects differences in the innate characteristics of adipose cells themselves, in addition to any effects of variation in nutrient supply, innervation, and other extrinsic factors.

We studied effects of fat depot origin on differentiation of preadipocytes from obese subjects. Because preadipocyte capacities for replication and mitogenic protein release are increased in some massively obese subjects compared with lean controls (54, 59), patterns of regional differences in adipogenesis could also be influenced by obesity. Another question arising from this work is whether the pattern of regional variation in adipogenesis of preadipocytes from subjects with peripheral obesity is distinct from that in subjects with visceral obesity. Thus it will be interesting to determine how fat depot origin affects preadipocyte differentiation in lean compared with obese subjects and in subjects with central compared with peripheral obesity.

Lipid accumulation, aP2 expression, and G3PD activity were highest in abdominal subcutaneous preadipocytes, intermediate in mesenteric cells, and lowest in omental cells. Because this pattern was also observed with respect to PPAR-gamma and C/EBP-alpha expression, these associations may be causal because PPAR-gamma and C/EBP-alpha are key adipogenic transcription factors. When either of these factors is absent in transgenic animal models, adipogenesis is blocked. In rodent cell lines, expression of PPAR-gamma is linked to that of C/EBP-alpha , and effects of C/EBP-alpha and PPAR-gamma on adipogenesis are complementary (12). The aP2 and G3PD promoters respond to PPAR-gamma and C/EBP-alpha (4, 22, 52, 55). The magnitudes of the regional differences in C/EBP-alpha and PPAR-gamma expression we found are consistent with the regional differences in aP2 and G3PD abundance. Furthermore, ectopic expression of C/EBP-alpha in omental preadipocytes enhanced their capacity to accumulate lipid, suggesting that genes downstream of C/EBP-alpha in omental preadipocytes are capable of responding to overexpressed levels of this adipogenic regulator. These findings suggest that there are mechanisms contributing to regional differences in adipogenesis that operate upstream of the induction of C/EBP-alpha expression during differentiation.

Others have reported that, even though thiazolidinediones caused more extensive differentiation of subcutaneous than omental cells, PPAR-gamma expression was the same in human subcutaneous and omental preadipocytes (1). However, the methods used in these studies were not intended to result in extensive morphologically evident differentiation, unlike the methods we employed, perhaps obscuring potential interdepot differences. Possibly, therefore, the low responsiveness of omental preadipocytes to thiazolidinediones is partly a result of reduced PPAR-gamma expression. Regional differences in PPAR-gamma abundance and thiazolidinedione responsiveness could be a mechanism contributing to the antidiabetic effects of thiazolidinediones. Excess visceral relative to subcutaneous fat has been associated with glucose intolerance (58). Thiazolidinediones have been reported to promote greater enlargement of subcutaneous than visceral fat (27, 48). This increase in the ratio of subcutaneous to visceral fat may be related to more extensive differentiation of subcutaneous than visceral preadipocytes, potentially improving glucose tolerance.

To exclude possible effects of admixture of other cell types in primary preadipocyte cultures from different regions and to test effects of fat depot origin on adipogenesis definitively, we cloned preadipocytes from different regions. Differences in adipogenesis were evident in colonies derived from single preadipocytes from different fat depots. Differentiated cells appeared later in visceral than subcutaneous clones. Together with our finding that differentiation-dependent increases in aP2 expression are delayed in omental compared with subcutaneous preadipocytes in mass cultures, this indicates that fat depot origin affects the duration of exposure to differentiation-inducing conditions required for adipogenesis to occur. Although adipogenesis is delayed in omental compared with abdominal subcutaneous preadipocytes, it does eventually proceed. This is consistent with the finding that PPAR-gamma mRNA abundance is similar in abdominal subcutaneous and omental whole fat tissue samples (1).

Perspectives

The proportion of differentiated cells was lowest in omental, intermediate in mesenteric, and highest in subcutaneous colonies, even though they had originated from single cells. Not every cell within clones differentiated at the same time. Therefore, a stochastic differentiation switch appears to exist. The propensities of preadipocytes from different fat depots in primary cultures to switch on the differentiation program were reflected in colonies derived from single cells. The cloning studies indicate that the likelihood of this switching mechanism to trigger differentiation is a trait transferred to daughter cells, as has been suggested in studies in aneuploid rodent preadipocyte cell lines (17). The switch may operate upstream of the induction of C/EBP-alpha expression that occurs during adipogenesis, because C/EBP-alpha overexpression enhanced adipogenesis in visceral preadipocytes, and increased C/EBP-alpha expression was only observed in individual preadipocytes that also exhibited increased lipid accumulation. If the event responsible for regional differences in adipogenesis only operated downstream of C/EBP-alpha induction, a high proportion of cells expressing C/EBP-alpha , but not accumulating lipid, should have been found in omental or mesenteric compared with subcutaneous clones. This stochastic switch could require different thresholds or durations of exposure to differentiation inducers before triggering differentiation. Alternatively, the differentiation process, once triggered, could proceed at different rates depending on fat depot origin. Regional variation in this mechanism appears to be a cause of delayed and less extensive differentiation and responsiveness to thiazolidinediones in visceral compared with subcutaneous preadipocytes.


    ACKNOWLEDGEMENTS

We are grateful to G. Chan and K. Salvatori for technical assistance, A. O'Brien for administrative support, and J. Armstrong for helpful discussions. Dr. D. A. Bernlohr kindly provided aP2 antibody.


    FOOTNOTES

This work was supported by National Institutes of Health Grants DK-56891 and AG/DK-13925 (to J. L. Kirkland), DK-46200 (Adipocyte Core; to J. L. Kirkland), DK-59261 (to W. Guo), DK-54588 (to G. Waloga), and DK-45343 (to M. D. Jensen).

Address for reprint requests and other correspondence: J. L. Kirkland, Room F435, Boston University Medical Center, 88 East Newton St., Boston, MA 02118.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajpregu.00653.2001

Received 5 November 2001; accepted in final form 27 December 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Adams, M, Montague CT, Prins JB, Holder JC, Smith SA, Sanders L, Digby JE, Sewter CP, Lazar MA, Chatterjee VK, and O'Rahilly S. Activators of peroxisome proliferator-activated receptor gamma have depot-specific effects on human preadipocyte differentiation. J Clin Invest 100: 3149-3153, 1997[Web of Science][Medline].

2.   Arner, P. Regional adiposity in man. J Endocrinol 155: 191-192, 1997[Free Full Text].

3.   Auboeuf, D, Bieusset J, Fajas L, Vallier P, Frering V, Riou JP, Staels B, Auwerx J, Laville M, and Vidal H. Tissue distribution and quantification of the expression of mRNAs of peroxisome proliferator-activated receptors and liver X receptor-alpha in humans. Diabetes 46: 1319-1327, 1997[Abstract].

4.   Barak, Y, Nelson MC, Ong ES, Jones YZ, Ruiz-Lozano P, Chien KR, Koder A, and Evans RM. PPARgamma is required for placental, cardiac, and adipose tissue development. Mol Cell 4: 585-595, 1999[Web of Science][Medline].

5.   Bouchard, C, Després JP, and Mauriège P. Genetic and nongenetic determinants of regional fat distribution. Endocr Rev 14: 72-93, 1993[Abstract/Free Full Text].

6.   Caserta, F, Tchkonia T, Civelek V, Prentki M, Brown NF, McGarry JD, Forse RA, Corkey BE, Hamilton JA, and Kirkland JL. Fat depot origin affects fatty acid handling in cultured rat and human preadipocytes. Am J Physiol Endocrinol Metab 280: E238-E247, 2001[Abstract/Free Full Text].

7.   Chomczynski, P, and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987[Web of Science][Medline].

8.   Després, JP. The insulin resistance-dyslipidemic syndrome of visceral obesity: effect on patients' risk. Obesity Res 6, Suppl1: 8S-17S, 1998[Medline].

9.   Djian, P, Roncari DAK, and Hollenberg CH. Adipocyte precursor clones vary in capacity for differentiation. Metabolism 34: 880-883, 1985[Web of Science][Medline].

10.   Djian, P, Roncari DAK, and Hollenberg CH. Influence of anatomic site and age on the replication and differentiation of rat adipocyte precursors in culture. J Clin Invest 72: 1200-1208, 1983.

11.   Edens, NK, Fried SK, Kral JG, Hirsch J, and Leibel RL. In vitro lipid synthesis in human adipose tissue from three abdominal sites. Am J Physiol Endocrinol Metab 265: E374-E379, 1993[Abstract/Free Full Text].

12.   El Jack, AK, Hamm JK, Pilch PF, and Farmer SR. Reconstitution of insulin-sensitive glucose transport in fibroblasts requires expression of both PPARgamma and C/EBPalpha . J Biol Chem 274: 7946-7951, 1999[Abstract/Free Full Text].

13.   Entenmann, G, and Hauner H. Relationship between replication and differentiation in cultured human adipocyte precursor cells. Am J Physiol Cell Physiol 270: C1011-C1016, 1996[Abstract/Free Full Text].

14.   Fried, SK, Russell CD, Grauso NL, and Brolin RE. Lipoprotein lipase regulation by insulin and glucocorticoid in subcutaneous and omental adipose tissues of obese women and men. J Clin Invest 92: 2191-2198, 1993.

15.   Fujioka, S, Matsuzawa Y, Tokunaga K, Kawamoto T, Kobatake T, Keno Y, Kotani K, Yoshida S, and Tarui S. Improvement of glucose and lipid metabolism associated with selective reduction of intra-abdominal visceral fat in premenopausal women with visceral fat obesity. Int J Obes 15: 853-859, 1990.

16.   Gillum, RF. The association of body fat distribution with hypertension, hypertensive heart disease, coronary heart disease, diabetes and cardiovascular risk factors in men and women aged 18-79 years. J Chron Dis 40: 421-428, 1987[Web of Science][Medline].

17.   Green, H, and Kehinde O. Spontaneous heritable changes leading to increased adipose conversion in 3T3 cells. Cell 7: 105-113, 1976[Web of Science][Medline].

18.   Hartman, AD. Adipocyte fatty acid mobilization in vivo: effects of age and anatomical location. Lipids 20: 255-261, 1985[Web of Science][Medline].

19.   Hauner, H, and Entenmann G. Regional variation of adipose differentiation in cultured stromal-vascular cells from the abdominal and femoral adipose tissue of obese women. Int J Obes 15: 121-126, 1991[Web of Science][Medline].

20.   Hauner, H, Entenmann G, Wabitsch M, Gaillard D, and Ailhaud G. Promoting effect of glucocorticoids on the differentiation of human adipocyte precursor cells cultured in a chemically defined medium. J Clin Invest 84: 1663-1670, 1989.

21.   Hauner, H, Petruschke T, Russ M, Rohrig K, and Eckel J. Effects of tumor necrosis factor-alpha (TNF-alpha ) on glucose transport and lipid metabolism of newly-differentiated human fat cells in cell culture. Diabetologia 38: 764-771, 1995[Web of Science][Medline].

22.   Hollenberg, AN, Susulic VS, Madura JP, Zhang B, Moller DE, Tontonoz P, Sarraf P, Spiegelman BM, and Lowell BB. Functional antagonism between CCAAT/enhancer binding protein-alpha and peroxisome proliferator-activated receptor-gamma on the leptin promoter. J Biol Chem 272: 5283-5290, 1997[Abstract/Free Full Text].

23.   Hube, F, Lietz U, Igel M, Jensen PB, Tornqvist H, Joost HG, and Hauner H. Difference in leptin mRNA levels between omental and subcutaneous abdominal adipose tissue from obese humans. Horm Metab Res 28: 690-693, 1996[Web of Science][Medline].

24.   Kachigan, SK. Statistical Analysis. New York: Radius, 1986.

25.   Kannel, WB, Cupples LA, Ramaswami R, Stokes J, Kreger BE, and Higgins M. Regional obesity and risk of cardiovascular disease: the Framingham study. J Clin Epidemiol 44: 183-190, 1991[Web of Science][Medline].

26.   Karagiannides, I, Tchkonia T, Dobson DE, Steppan CM, Cummins P, Chan G, Salvatori K, Hadzopoulou-Cladaras M, and Kirkland JL. Altered expression of C/EBP family members results in decreased adipogenesis with aging. Am J Physiol Regulatory Integrative Comp Physiol 280: R1772-R1780, 2001[Abstract/Free Full Text].

27.   Kelly, I, Han T, Walsh K, and Lean M. Effects of a thiazolidinedione compound on body fat and fat distribution of patients with type 2 diabetes. Diabetes Care 22: 288-293, 1999[Abstract/Free Full Text].

28.   Keppel, G. Design and Analysis: A Researcher's Handbook. Englewood Cliffs, NJ: Prentice-Hall, 1973.

29.   Kirkland, JL, Cummins P, Steppan C, Dobson DE, and Cladaras MH. Decreasing preadipocyte differentiation capacity with aging is associated with blunted expression of the transcription factor, CCAAT enhancer binding protein alpha . Obesity Res 5, Suppl1: 22S, 1997.

30.   Kirkland, JL, and Dax EM. Adipose hormone responsiveness and aging in the rat. J Am Geriatr Soc 32: 219-228, 1984[Web of Science][Medline].

31.   Kirkland, JL, Hollenberg CH, Gillon W, and Kindler S. Effect of hypophysectomy on rat preadipocyte replication and differentiation. Endocrinology 131: 2769-2773, 1992[Abstract/Free Full Text].

32.   Kirkland, JL, Hollenberg CH, and Gillon WS. Age, anatomic site, and the replication and differentiation of adipocyte precursors. Am J Physiol Cell Physiol 258: C206-C210, 1990[Abstract/Free Full Text].

33.   Kirkland, JL, Hollenberg CH, and Gillon WS. Effects of fat depot site on differentiation-dependent gene expression in rat preadipocytes. Int J Obes 20: S102-S107, 1996[Web of Science].

34.   Kirkland, JL, Piñeyro MA, Lu Z, and Gregerman RI. Hormone sensitive adenylyl cyclase in preadipocytes cultured from adipose tissue: comparison with 3T3-L1 cells and adipocytes. J Cell Physiol 133: 449-460, 1987[Web of Science][Medline].

35.   Kissebah, A, Vydelingum N, Murray R, Evans DJ, Hartz AJ, Kalkhoff RK, and Adams PW. Relation of body fat distribution to metabolic complications of obesity. J Clin Endocrinol Metab 54: 254-260, 1982[Abstract/Free Full Text].

36.   Kissebah, AH, and Hennes MMI Central obesity and free fatty acid metabolism. Prostaglandins Leukot Essent Fatty Acids 52: 209-211, 1995[Web of Science][Medline].

37.   Kissebah, AH, and Krakower GR. Regional adiposity and morbidity. Physiol Rev 74: 761-811, 1994[Free Full Text].

38.   Kleinbaum, D, Kupper L, and Muller K. Applied Regression Analysis and Other Multivariate Methods. Belmont, CA: Duxbury, 1998.

39.   Kozak, LP, and Jensen JT. Genetic and developmental control of multiple forms of l-glycerol 3-phosphate dehydrogenase. J Biol Chem 249: 7775-7781, 1974[Abstract/Free Full Text].

40.   Krotkiewski, M, Björntorp P, Sjöström L, and Smith U. Impact of obesity on men and women: importance of regional adipose tissue distribution. J Clin Invest 72: 1150-1162, 1983.

41.   Kypreos, K, Teusink B, Van Dijk K, Havekes L, and Zannis V. Analysis of the structure and function relationship of the human apolipoprotein E in vivo, using adenovirus-mediated gene transfer. FASEB J 15: 1598-1600, 2001[Free Full Text].

42.   Lacasa, D, Garcia E, Agli B, and Giudicelli Y. Control of rat preadipocyte adipose conversion by ovarian status: regional specificity and possible involvement of the mitogen-activated protein kinase-dependent and c-fos signaling pathways. Endocrinology 138: 2729-2734, 1997[Abstract/Free Full Text].

43.   Laemmli, UK. Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature 227: 680-685, 1970[Medline].

44.   Lapidus, L, Bengtsson C, Larsson B, Pennert K, Rybo E, and Sjostrom L. Distribution of adipose tissue and risk of cardiovascular disease and death: a 12 year follow up of participants in the population study of women in Gothenberg, Sweden. Br Med J 289: 1257-1261, 1984.

45.   Majumdar, S. Protein kinase C isotypes and signaling in neutrophils. J Biol Chem 266: 9285-9294, 1991[Abstract/Free Full Text].

46.   Miller, WH, Faust IM, and Hirsch J. Demonstration of de novo production of adipocytes in adult rats by biochemical and radioautographic techniques. J Lipid Res 25: 336-347, 1984[Abstract].

47.   Montague, CT, Prins JB, Sanders L, Digby JE, and O'Rahilly S. Depot- and sex-specific differences in human leptin mRNA expression: implications for the control of regional fat distribution. Diabetes 46: 342-347, 1997[Abstract].

48.   Mori, Y, Murakawa Y, Okada K, Horikoshi H, Yokoyama J, Tajima N, and Ikeda Y. Effect of troglitazone on body fat distribution in type 2 diabetic patients. Diabetes Care 22: 288-293, 1999.

49.   Morin, CL, Pagliassotti MJ, Windmiller D, and Eckel RH. Adipose tissue-derived tumor necrosis factor-alpha activity is elevated in older rats. J Gerontol 52A: B190-B195, 1997[Web of Science].

50.   Niessler, CU, Siddle K, and Prins JB. Human preadipocytes display a depot-specific susceptibility to apoptosis. Diabetes 47: 1365-1368, 1998[Abstract].

51.   Peiris, AN, Hennes MI, Evans DJ, Wilson CR, Lee MB, and Kissebah AH. Relationship of anthropometric measurements of body fat distribution to metabolic profile in premenopausal women. Acta Med Scand 723, Suppl: 179-188, 1988.

52.   Perrin, S. Transcriptional control of the mouse glycerol-3-phosphate dehydrogenase gene. In: Biochemistry. Boston, MA: Boston Univ. Press, 1995.

53.   Prins, JB, and O'Rahilly S. Regulation of adipose cell number in man. Clin Sci 92: 3-11, 1997[Medline].

54.   Roncari, DAK, Lau DCW, and Kindler S. Exaggerated replication in culture of adipocyte precursors from massively obese persons. Metabolism 30: 425-427, 1981[Web of Science][Medline].

55.   Rosen, ED, Sarraf P, Troy AE, Bradwin G, Moore K, Milstone DS, Spiegelman BM, and Mortensen RM. PPARgamma is required for the differentiation of adipose tissue in vivo and in vitro. Mol Cell 4: 611-617, 1999[Web of Science][Medline].

56.   Salter, AM, Fong BS, Jimenez J, Rotstein L, and Angel A. Regional variation in high-density lipoprotein binding to human adipocyte plasma membranes of massively obese subjects. Eur J Clin Invest 17: 16-22, 1987[Web of Science][Medline].

57.   Sanes, JR, Rubenstein JLR, and Nicolas JF. Use of a recombinant retrovirus to study post-implantation cell lineage in mouse embryos. EMBO J 5: 3133-3142, 1986[Web of Science][Medline].

58.   Tchkonia, T, Karagiannides I, Forse RA, and Kirkland JL. Different fat depots are distinct mini-organs. Curr Opin Endocrinol Diabetes 8: 227-234, 2001.

59.   Teichert-Kuliszewska, k, Hamilton BS, Deitel M, and Roncari DAK Augmented production of heparin-binding mitogenic proteins by preadipocytes from massively obese persons. J Clin Invest 90: 1226-1231, 1992.

60.   Van de Ventner, M, Litthauer D, and Oelofsen W. Catecholamine stimulated lipolysis in differentiated human preadipocytes in a serum-free, defined medium. J Cell Biochem 54: 1-10, 1994[Web of Science][Medline].

61.   Wang, H, Kirkland JL, and Hollenberg CH. Varying capacities for replication of rat adipocyte precursor clones and adipose tissue growth. J Clin Invest 83: 1741-1746, 1989.

62.   Wigler, M, Pellicer A, Silverstein S, and Axel R. Biochemical transfer of single-copy eucaryotic genes using total cellular DNA as donor. Cell 14: 725-731, 1978[Web of Science][Medline].

63.   Wu, Z, Rosen ED, Brun R, Hauser S, Adelmant G, Troy AE, McKeon C, Darlington GJ, and Spiegelman BM. Cross-regulation of C/EBPalpha and PPARgamma controls the transcriptional pathway of adipogenesis and insulin sensitivity. Mol Cell 3: 151-158, 1999[Web of Science][Medline].

64.   Zapata, JM, Takahashi R, Salvesen GS, and Reed JC. Granzyme release and caspase activation in activated human T-lymphocytes. J Biol Chem 273: 6916-6920, 1998[Abstract/Free Full Text].

65.   Zilberfarb, V, Siquier K, Strosberg AD, and Issad T. Effect of dexamethasone on adipocyte differentiation markers and tumour necrosis factor-alpha expression in human PAZ6 cells. Diabetologia 44: 377-386, 2001[Web of Science][Medline].


Am J Physiol Regul Integr Comp Physiol 282(5):R1286-R1296
0363-6119/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
J. Lipid Res.Home page
K. M. Wojtanik, K. Edgemon, S. Viswanadha, B. Lindsey, M. Haluzik, W. Chen, G. Poy, M. Reitman, and C. Londos
The role of LMNA in adipose: a novel mouse model of lipodystrophy based on the Dunnigan-type familial partial lipodystrophy mutation
J. Lipid Res., June 1, 2009; 50(6): 1068 - 1079.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. S. Y. Chan, L. J. Schedlich, S. M. Twigg, and R. C. Baxter
Inhibition of adipocyte differentiation by insulin-like growth factor-binding protein-3
Am J Physiol Endocrinol Metab, April 1, 2009; 296(4): E654 - E663.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
G. J. Hausman, M. V. Dodson, K. Ajuwon, M. Azain, K. M. Barnes, L. L. Guan, Z. Jiang, S. P. Poulos, R. D. Sainz, S. Smith, et al.
BOARD-INVITED REVIEW: The biology and regulation of preadipocytes and adipocytes in meat animals
J Anim Sci, April 1, 2009; 87(4): 1218 - 1246.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. K. Chatterjee, L. L. Stoll, G. M. Denning, A. Harrelson, A. L. Blomkalns, G. Idelman, F. G. Rothenberg, B. Neltner, S. A. Romig-Martin, E. W. Dickson, et al.
Proinflammatory Phenotype of Perivascular Adipocytes: Influence of High-Fat Feeding
Circ. Res., February 27, 2009; 104(4): 541 - 549.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. Blouin, M. Nadeau, J. Mailloux, M. Daris, S. Lebel, V. Luu-The, and A. Tchernof
Pathways of adipose tissue androgen metabolism in women: depot differences and modulation by adipogenesis
Am J Physiol Endocrinol Metab, February 1, 2009; 296(2): E244 - E255.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
S. Suzuki, S. Sembon, M. Iwamoto, D. Fuchimoto, and A. Onishi
Identification of genes downregulated during differentiation of porcine mesenteric adipocytes
J Anim Sci, December 1, 2008; 86(12): 3367 - 3376.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. T. M. Tan, S. V. McLennan, W. W. Song, L. W.-Y. Lo, J. G. Bonner, P. F. Williams, and S. M. Twigg
Connective tissue growth factor inhibits adipocyte differentiation
Am J Physiol Cell Physiol, September 1, 2008; 295(3): C740 - C751.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Guo, J. Flanagan, R. Jasuja, J. Kirkland, L. Jiang, and S. Bhasin
The Effects of Myostatin on Adipogenic Differentiation of Human Bone Marrow-derived Mesenchymal Stem Cells Are Mediated through Cross-communication between Smad3 and Wnt/{beta}-Catenin Signaling Pathways
J. Biol. Chem., April 4, 2008; 283(14): 9136 - 9145.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
T. Tchkonia, T. Pirtskhalava, T. Thomou, M. J. Cartwright, B. Wise, I. Karagiannides, A. Shpilman, T. L. Lash, J. D. Becherer, and J. L. Kirkland
Increased TNF{alpha} and CCAAT/enhancer-binding protein homologous protein with aging predispose preadipocytes to resist adipogenesis
Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1810 - E1819.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J. Y. Kim, Y. Wu, and C. M. Smas
Characterization of ScAP-23, a new cell line from murine subcutaneous adipose tissue, identifies genes for the molecular definition of preadipocytes
Physiol Genomics, October 19, 2007; 31(2): 328 - 342.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. Y. Kim, K. Tillison, S. Zhou, Y. Wu, and C. M. Smas
The major facilitator superfamily member Slc37a2 is a novel macrophage- specific gene selectively expressed in obese white adipose tissue
Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E110 - E120.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
T. Tchkonia, M. Lenburg, T. Thomou, N. Giorgadze, G. Frampton, T. Pirtskhalava, A. Cartwright, M. Cartwright, J. Flanagan, I. Karagiannides, et al.
Identification of depot-specific human fat cell progenitors through distinct expression profiles and developmental gene patterns
Am J Physiol Endocrinol Metab, January 1, 2007; 292(1): E298 - E307.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Aouadi, K. Laurent, M. Prot, Y. Le Marchand-Brustel, B. Binetruy, and F. Bost
Inhibition of p38MAPK Increases Adipogenesis From Embryonic to Adult Stages
Diabetes, February 1, 2006; 55(2): 281 - 289.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
T. Tchkonia, Y. D. Tchoukalova, N. Giorgadze, T. Pirtskhalava, I. Karagiannides, R. A. Forse, A. Koo, M. Stevenson, D. Chinnappan, A. Cartwright, et al.
Abundance of two human preadipocyte subtypes with distinct capacities for replication, adipogenesis, and apoptosis varies among fat depots
Am J Physiol Endocrinol Metab, January 1, 2005; 288(1): E267 - E277.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
L. Hutley, W. Shurety, F. Newell, R. McGeary, N. Pelton, J. Grant, A. Herington, D. Cameron, J. Whitehead, and J. Prins
Fibroblast Growth Factor 1: A Key Regulator of Human Adipogenesis
Diabetes, December 1, 2004; 53(12): 3097 - 3106.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
Y. D. Tchoukalova, M. G. Sarr, and M. D. Jensen
Measuring committed preadipocytes in human adipose tissue from severely obese patients by using adipocyte fatty acid binding protein
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2004; 287(5): R1132 - R1140.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
P. Kok, M. M. Buijs, S. W. Kok, I. H. A. P. van Ierssel, M. Frolich, F. Roelfsema, P. J. Voshol, A. E. Meinders, and H. Pijl
Acipimox enhances spontaneous growth hormone secretion in obese women
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2004; 286(4): R693 - R698.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (55)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tchkonia, T.
Right arrow Articles by Kirkland, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tchkonia, T.
Right arrow Articles by Kirkland, J. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online