AJP - Regu AJP: Endocrinology and Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 283: R257-R265, 2002. First published February 28, 2002; doi:10.1152/ajpregu.00453.2001
0363-6119/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/1/R257    most recent
00453.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (41)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sengenès, C.
Right arrow Articles by Galitzky, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sengenès, C.
Right arrow Articles by Galitzky, J.
Vol. 283, Issue 1, R257-R265, July 2002

Natriuretic peptide-dependent lipolysis in fat cells is a primate specificity

Coralie Sengenès, Alexia Zakaroff-Girard, Agnès Moulin, Michel Berlan, Anne Bouloumié, Max Lafontan, and Jean Galitzky

Laboratoire de Pharmacologie Médicale et Clinique, Faculté de Médecine, Institut National de la Santé et de la Recherche Médicale, Unité 317, 31073 Toulouse Cedex, France


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We have recently demonstrated that natriuretic peptides (NPs), which are known for regulation of blood pressure via membrane guanylyl cyclase (GC) receptors, are lipolytic in human adipose tissue. In this study, we compared the NP control of lipolysis in adipocytes from humans, nonhuman primates (macaques), rodents (rats, mice, hamsters), and nonrodent mammals (rabbits, dogs). Isolated adipocytes from these species were exposed to increasing concentrations of atrial NP (ANP) or isoproterenol (beta -adrenergic agonist). Although isoproterenol was lipolytic in all of the species, ANP only enhanced lipolysis in human and macaque adipocytes. In primate fat cells, NP-induced lipolysis involved a cGMP-dependent pathway. Binding studies and real-time quantitative PCR assays revealed that rat adipocytes expressed a higher density of NP receptors compared with humans but with a different subtype pattern of expression; type-A GC receptors predominate in human fat cells. This was also confirmed by the weak GC-activity stimulation and the reduced cGMP formation under ANP exposure in rat adipocytes compared with human fat cells. In conclusion, NP-induced lipolysis is a primate specificity, and adipocytes from ANP-nonresponsive species present a predominance of "clearance" receptors and very low expression of "biologically active" receptors.

guanylyl cyclase; receptor subtypes; adipose tissue; cGMP


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

WHITE ADIPOSE TISSUE is the major energy reserve in higher eukaryotes. Storing triacylglycerol (lipogenesis) in periods of energy excess and mobilizing it (lipolysis) during energy deprivation are the primary purposes of white adipose tissue. The lipolytic cascade has always been strictly connected to cAMP increment and cAMP-dependent protein kinase (PKA) activation. When activated, PKA reversibly phosphorylates three serine residues on hormone-sensitive lipase (HSL), which results in the activation and translocation of HSL to lipid droplets (27, 29) and the hydrolysis of triacylglycerol. Until now (and unlike in most species), in man, lipolysis was thought to be mainly regulated by catecholamines in white adipocytes (10, 31), whereas peptide hormones such as ACTH, melanotropins (alpha - and beta -MSH), beta -endorphin, growth hormone, glucagon, thyroid-stimulating hormone, cholecystokinin, and parathyroid hormone have lipolytic effects on adipocytes from various other mammalian species (41, 55). We recently demonstrated (49) that natriuretic peptides (NPs), which are peptide hormones, are lipolytic in human adipocytes to the same extent as beta -adrenergic receptor (AR) agonists. Moreover, the NP-induced lipolysis involved cGMP-dependent and cAMP-independent pathways.

NPs are a family of cyclic peptides found in various animal species from different phyla (1, 25, 47, 52) and consist of at least three distinct endogenous peptides: atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), and C-type natriuretic peptide (CNP). NPs possess various biological effects including actions on natriuresis, diuresis, vasodilation, and inhibition of the renin-angiotensin-aldosterone and the sympathetic nervous systems (50, 51). ANP and BNP are mainly secreted by atrial and ventricular cardiomyocytes in response to mechanical stretches (33, 53), whereas CNP is expressed in the central nervous system and in vascular endothelial cells (13, 26). NPs exert effects via membrane-bound receptors. Two classes of NP receptors (NPRs) have been defined by molecular cloning (35, 43, 48). The first class includes types A and B membrane guanylyl cyclase receptors, which are defined as GC-A and GC-B, respectively. Stimulation of these receptors induces intracellular cGMP production. The second class of ANP binding sites is a nonguanylyl cyclase-linked receptor termed clearance receptor or NPR-C. Although devoid of a cytoplasmic domain, studies have implicated NPR-C in mediating signal transduction through the inhibition of adenylyl cyclase or the activation of phospholipase C (2, 3, 42). NPRs have been found in various tissues including white and brown adipose tissues (16, 17, 20, 22, 45, 46, 54).

Many studies have pointed out species-specific variations in the adrenergic control of lipolysis (8, 12, 27, 28). To determine whether NP-induced lipolysis also occurs in other species, we compared the effects of NPs on fat cells from primates (humans, macaques) and from various other mammal species (rodents: rats, mice, guinea pigs, hamsters; and nonrodent mammals: dogs, rabbits). The observed species-specific differences were investigated to provide some mechanistic interpretations.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Subjects

Human subcutaneous adipose tissue (1-2 g) was obtained from 16 normal or moderately overweight women who were undergoing plastic surgery. Their mean age was 45.7 ± 3.5 yr and their mean body mass index was 24.4 ± 1.3 kg/m2. The investigation respected the guidelines of the Ethical Committee of Toulouse University Hospital.

Animals

White-fat depots were dissected from six male Wistar rats (260-300 g, 6-10 wk old; visceral and epididymal adipose tissue), six male C57BL/6 mice (20-25 g, 8-10 wk old; visceral and epididymal adipose tissue), five male Beagle-Harrier dogs (10-12 kg, 8-10 wk old; subcutaneous, visceral, and epididymal adipose tissue), six male Syrian hamsters (Mesocricetus auratus; 80-100 g, 7-9 wk old; visceral and epididymal adipose tissue), four female New Zealand rabbits (2.8-3.1 kg, 13-15 wk old; visceral and periovarian adipose tissue), and six young male adult macaques (Macaca fascicularis; 2-5 kg, subcutaneous visceral and epididymal adipose tissue). All the animals were fed ad libitum and had free access to water. Animal studies were in agreement with Institut National de la Santé et de la Recherche Médicale guidelines for animal care and fully conformed to the Guiding Principles for Research Involving Animals and Human Beings (20).

Adipocyte Isolation

Isolated adipocytes were obtained according to Rodbell's method (44) by collagenase digestion of adipose tissue fragments in Krebs-Ringer bicarbonate buffer containing 3.5% bovine serum albumin (KRBA) and 6 mmol/l glucose at pH 7.4 under gentle shaking at ~120 cycles/min at 37°C. Fat cells were filtered through a silk screen (250 µm) and washed with KRBA buffer to eliminate collagenase.

Lipolysis Measurements

Isolated adipocytes were brought to a suitable dilution (2,000-3,000 cells/assay) in KRBA buffer for lipolysis assays and were incubated with pharmacological agents at the indicated concentrations in a final volume of 100 µl for 90 min at 37°C. At the end of the incubation, 20- to 50-µl aliquots of the infranatant were taken for glycerol determination (9), which was used as the lipolytic index. Total lipid content was determined gravimetrically after solvent extraction. Rat ANP was used for rodent species, dog, and rabbit experiments, and human ANP was used for primate (human and nonhuman) species.

Determination of cGMP and cAMP Concentrations

Fat cells were incubated for 15 min at 37°C in the presence of 0.1 mmol/l isobutylmethylxanthine [IBMX, a nonspecific phosphodiesterase (PDE) inhibitor] and were then stimulated or not by 1 µmol/l ANP for 15 min. The reaction was stopped by addition of chloroform-methanol-1 N HCl (2 vol/1 vol/0.1 vol). After centrifugation (5,000 rpm for 5 min), the aqueous phase of each sample was freeze-dried and the cyclic nucleotide content was measured according to the kit manufacturer's instructions (Cayman Chemical, Ann Arbor, MI).

Real-Time Quantitative PCR Assay

Changes in mRNA levels of specific genes were quantified by real-time PCR. Total rat or human RNAs were extracted using the Qiagen RNeasy kit. Briefly, isolated mature adipocytes (2 or 5 ml of packed cells from rats or humans, respectively) were disrupted in the lysis buffer (vol/vol) furnished with the kit and stored at -80°C. After thawing, the aqueous phase was delipidated by chloroform (vol/vol) and the mRNAs were extracted according to the manufacturer's instructions. RNA concentrations were determined using a fluorimetric assay (Ribogreen). RNA (2 µg) was reverse-transcribed using the ThermoScript RT system (Life Technologies) according to the manufacturer's instructions (random hexamers and dNTPs were also supplied by Life Technologies). Reverse transcription was also performed without ThermoScript enzyme on RNA samples to provide a control for contamination of samples with genomic DNA. PCR primers were designed using Primer Express software according to the recommendations of Applied Biosystems. Optimum primer concentrations were determined by performing PCR reactions with a range of primer concentrations and comparing the rates of product accumulation for human GC-A (forward: TGGAACCGAAGCTTTCAAGGT and reverse: CCATATCCCAGAGGGAGAAGTCT), human NPR-C (forward: GGAAGACATCGTGCGCAATA and reverse: TGCTCCGGATGGTGTCACT), rat GC-A (forward: TCCTTCTCTGCCCTCAACTTAGC and reverse: AACTCTAACCTCTTTCTGTTTCCTTCA), and rat NPR-C (forward: GGAGGTCATTGGTGATTACTTTGGA and reverse: AGA- GCCCCAAGGATATTTGACA).

The amplification reaction was performed in duplicate on 20 ng of the cDNA sample (5 µl) in a final volume of 26 µl in 96-well optical reaction plates (Applied Biosystems) in a GeneAmp 5,700-sequence detection system. For GC-A and NPRC (human and rat), the PCR mixture contained 8 µl of 900 nmol/l forward and reverse primer mix and 13 µl of SYBR Green PCR Master Mix (Applied Biosystems), which contains the fluorescent dye SYBR Green. The dye exhibits fluorescence enhancement upon binding to double-stranded DNA, and the enhancement of fluorescence is proportional to the initial concentration of the cDNA. For the ribosomal RNA control (18S rRNA), the PCR mixture contained 8 µl of primers and fluorogenic probe mix (Applied Biosystems) and 13 µl of TaqMan Universal PCR Master Mix (Applied Biosystems). All reactions were performed under the same conditions: 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Results were analyzed with GeneAmp 5700 software and all values were normalized to levels of the 18S rRNA control.

Radioligand Binding Assay

Isolated adipocytes were broken in a hypotonic lysing medium (5 mmol/l Tris · HCl, pH 7.4, 5 mmol/l EDTA) that contained several protease inhibitors (100 µmol/l phenylmethylsulfonyl fluoride, 0.5 mg/ml bacitracin, 1 µmol/l aprotinin, 10 µmol/l thiorphan). Crude adipocyte membranes were obtained by centrifugation of the lysate (48,000 g for 20 min at 4°C). The pellet was washed twice with 10 ml of binding buffer (50 mmol/l Tris · HCl, pH 7.4, 5 mmol/l MgCl2, 0.1% bovine serum albumin, and 0.5 mg/ml bacitracin, 1 µmol/l aprotinin, 10 µmol/l thiorphan) and finally resuspended in the same buffer at a final concentration of 1-2 mg protein/ml and immediately used for binding experiments. Assays were performed in a final volume of 200 µl containing 50 µl of membrane suspension and 50 µl of 125I-ANP. Nonspecific binding was defined in the presence of 1 µmol/l of unlabeled ANP. Saturation studies were performed with increasing concentrations (from 50 to 600 nmol/l) of 125I-ANP. In competition studies, 250 pmol/l of 125I-ANP and the specified concentrations of competitive analogs were used. Saturation experiments and competition studies were carried out under constant shaking for 45 min at 25°C. The incubation was stopped by centrifugation (13,000 g for 10 min). The pellet was washed twice with 500 µl of binding buffer and the radioactivity was counted in a gamma counter.

Guanylyl Cyclase Assay

The guanylyl cyclase assay was performed according to the Domino method with some slight changes (18). Briefly, isolated adipocytes were broken up in a hypotonic lysing medium (5 mmol/l Tris · HCl, 5 mmol/l EDTA, 250 mmol/l sucrose, pH 7.4). Crude adipocyte membranes were obtained by centrifugation of the lysate (48,000 g for 20 min at 4°C). The pellet was resuspended with 2 ml of washing buffer (20 mmol/l Tris, 3 mmol/l MgCl2 containing an antiprotease cocktail) and pelleted by centrifugation (20,000 g for 20 min at 4°C). The pellet was resuspended with 1.5 ml of a buffer consisting of 20 mmol/l Tris · HCl, 5 mmol/l MgCl2, 100 mmol/l NaCl, 0.1% Triton X-100, 0.5% bovine serum albumin, 0.1 mmol/l Na3VO4, 18 mmol/l creatine phosphate, 0.25 mg/ml creatine kinase, 1 mmol/l ATP, and 1 mmol/l cGMP. Assays were performed in a final volume of 100 µl, and the reaction was started by addition of 1 mmol/l of [alpha -32P]GTP (100,000-500,000 cpm/assay). Guanylyl cyclase assays were performed at 37°C, and the homogenate membrane preparation was incubated in the presence of 1 µmol/l ANP or 10 µmol/l isoproterenol. At increasing times (0, 10, 15, 30 min), the reaction was stopped by addition of 500 µl of 120 mmol/l zinc acetate and 600 µl of 144 mmol/l sodium carbonate. Tubes were frozen for 30 min at -80°C and then thawed and centrifuged for 10 min at 2,000 g and 4°C. Samples were poured over neutral alumina columns and [32P]cGMP was eluted with 2 ml of 100 mmol/l Tris · HCl, pH 7.5. Radioactivity was counted in a gamma counter.

Data Analysis

Values are given as means ± SE of n separate experiments. Student's paired t-tests were used for comparisons between matched pairs. Differences were considered significant when P < 0.05. The concentration-response curves were fitted by nonlinear regression, the EC50 (half-maximal effective drug concentration), binding studies, and competition experiments were calculated and analyzed using GraphPad Prism software (San Diego, CA).

Drugs and Chemicals

The nonselective beta -AR agonist (-)isoproterenol hydrochloride, the specific A1-adenosine receptor agonist phenylisopropyladenosine (R-PIA), the alpha 2-AR agonist UK-14304, the nonselective PDE inhibitor IBMX, bovine serum albumin (fraction V), forskolin, bacitracin, aprotinin, thiorphan, and neutral alumina were from Sigma-Aldrich (Saint Quentin Fallavier, France). Crude collagenase, enzymes for glycerol assays, and Complete Mini tablets of protease inhibitors were from Boehringer Mannheim (Mannheim, Germany). Human alpha -ANP (1-28), rat alpha -ANP (1-28), and CNP were from Neosystem Laboratories (Strasbourg, France). Human BNP (1-32) came from Novabiochem (France Biochem, Meudon). Bromo-cGMP (Br-cGMP) was from Alexis Biochemicals (Coger, Paris, France). Human [3-125I]iodotyrosyl-28-alpha -ANP was from Amersham France (Les Ulis). [8-3H]guanosine-3',5'-cyclic phosphate ammonium salt came from Amersham (Orsay, France). [alpha -32P]-guanosine-5'-triphosphate and [gamma -32P] adenosine-5'-triphosphate were from NEN (Paris, France). LY-83,583 came from Alexis Biochemicals (Coger). Ribogreen was from Molecular Probes (Leiden, The Netherlands). SYBR Green chemistry or TaqMan PCR detection were from Applied Biosystems (Courtaboeuf, France).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Compared Lipolytic Activity of Isoproterenol and ANP in Human, Nonhuman Primate, Rodent, and Nonrodent Mammal Fat Cells

Fat cells from rats, mice, hamsters, rabbits, dogs, macaques, and humans were incubated with increasing concentrations of isoproterenol (from 10-10 to 10-5 mol/l) and ANP (from 10-11 to 10-6 mol/l). Spontaneous glycerol release (basal lipolysis) was similar from one species to another (0.31 ± 0.03 µmol glycerol · 100 mg lipid-1 · 90 min-1). As depicted in Fig. 1A, isoproterenol was a strong activator of lipolysis in all of the species studied. However, under our experimental conditions, the analysis of the maximum lipolytic effect and apparent affinity (pD2) values revealed species-specific differences that appeared to reflect species differences in the affinity of the beta -AR agonist (Table 1). The highest isoproterenol efficacy was found in mouse adipocytes (5.49 ± 0.5 µmol glycerol · 100 mg lipid-1 · 90 min-1) and the best potency was observed in human fat cells (pD2 = 7.70 ± 0.07). The effects of ANP on adipocyte lipolysis were compared with those of isoproterenol taken as a reference. As shown in Fig. 1B, ANP only induced a lipolytic effect in primate fat cells and was devoid of any lipolytic activity in rat, mouse, hamster, rabbit, or dog isolated adipocytes. Furthermore, female fat cells from macaques (n = 2) and rats (n = 2) were exposed to increasing concentrations of ANP. As for human adipocytes (19, 49), the responses of male and female macaque fat cells to ANP stimulation were comparable, and rat female fat cells were insensitive to increasing concentrations of ANP. Adipocytes from young rats 22-26 wk old (51-75 g) were stimulated with increasing concentrations of ANP, and no ANP-induced lipolysis was observed. Finally, NPs are well known to be degraded by neutral endopeptidase; however, addition of 10 µmol/l thiorphan, a neutral endopeptidase inhibitor, did not reveal a NP lipolytic activity in the nonprimate species.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1.   Comparison of lipolytic effects of isoproterenol (A) and atrial natriuretic peptide (ANP; B) on isolated adipocytes from human (), macaque (+), rat (open circle ), mouse (triangle ), dog (), hamster (black-triangle), and rabbit (×). Lipolysis is expressed in percent of maximum isoproterenol effect. Values are means of 16 experiments for humans; 6 experiments for macaques, rats, mice, hamsters, and dogs; and 4 experiments for rabbits. SE values (<5%) are not shown for clarity. [Isoproterenol], concentration of isoproterenol; [ANP], concentration of ANP.


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Maximal lipolytic effect of isoproterenol in isolated fat cells from human, macaque, dog, rat, mouse, hamster, and rabbit

Characterization of NP Lipolytic Response in Human Primate Fat Cells

To compare the NP-induced lipolysis between humans and primates, the lipolytic response initiated by NP and the rank order of potency were characterized in macaque fat cells. Isolated macaque adipocytes were exposed to increasing concentrations (10-11 to 10-6 mol/l) of ANP, BNP, and CNP. In isolated macaque adipocytes, maximal lipolytic values obtained with 1 µmol/l ANP and BNP (2.16 ± 0.73 and 2.16 ± 0.81 µmol glycerol · 100 mg lipid-1 · 90 min-1, respectively) were significantly higher than those obtained with 10 µmol/l isoproterenol (1.43 ± 0.40 µmol glycerol · 100 mg lipid-1 · 90 min-1); moreover, 1 µmol/l CNP (0.64 ± 0.18 µmol glycerol · 100 mg lipid-1 · 90 min-1) had a maximum lipolytic effect corresponding to 47.5% of the maximal lipolytic effect of isoproterenol. As for human adipocytes, the following relative rank order of lipolytic potency of NPs can be proposed for macaque fat cells: ANP > BNP CNP.

cGMP is classically considered to be the second messenger generated after NPR-A or NPR-B (GC-A or GC-B) activation. In macaque fat cells, Br-cGMP (a membrane-permeable cGMP analog) increased lipolysis. Lipolysis induced by 10 mmol/l Br-cGMP was similar between macaque and human fat cells (Table 2).

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Effect of Br-cGMP in human, macaque, and rat fat cells

The activity of type 3B phosphodiesterase (PDE-3B), the main enzyme involved in cAMP degradation in adipocytes, is known to be inhibited by cGMP in acellular systems (15); therefore, we studied the role of PDE-3B in NP-induced lipolysis in macaque fat cells as in our previous work on human adipocytes (49). Isolated macaque fat cells were preincubated with 1 µmol/l UK-14304 and 1 µmol/l PIA. In that context of low cAMP levels obtained by potent inhibition of adenylyl cyclase activity, PDE-3B activity was expected to be strongly decreased due to a poor substrate availability. In isolated macaque adipocytes, isoproterenol-stimulated lipolysis (0.1 µmol/l) was completely suppressed by the "inhibitory cocktail," which confirmed the low cAMP content, whereas ANP-induced lipolysis (10 nmol/l) was not modified (data not shown).

Comparative Analysis Between ANP-Responsive Human Adipocytes Versus ANP-Nonresponsive Rat Adipocytes

Effect of Br-cGMP. To determine whether cGMP was lipolytic in rat adipocytes, rat fat cells were exposed to 10 mmol/l Br-cGMP. As can be seen in Table 2, in rat adipocytes, 10 mmol/l Br-cGMP stimulated basal lipolysis by approximately twofold. Compared with human fat cells, Br-cGMP-induced lipolysis was significantly lower in rat than macaque or human adipocytes (P < 0.001).

Pharmacological characterization of NPRs. Radioligand binding studies using 125I-ANP as the ligand were performed to quantify NPRs in rat and human membrane adipocytes. Nonspecific binding, defined in the presence of 1 µmol/l cold ANP [rat ANP (r-ANP) or human ANP (h-ANP)], represented ~10% of the total bound radioactivity at the equilibrium. Specific binding of 125I-ANP was saturable and of high affinity in both species (Fig. 2A). Equilibrium dissociation constants (Kd), 147.7 ± 64 and 138.6 ± 38.4 pmol/l for human and rat membranes, respectively, were similar between the two species (Fig. 2B). The ligand used for binding assays did not allow delineation of NPR subtypes. The membrane receptor densities (Bmax values) were 274 ± 135 and 510 ± 123 fmol/mg protein for human and rat adipocyte membranes, respectively. The number of 125I-ANP binding sites was significantly lower in human than rat fat cell membranes (P = 0.02).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2.   Characterization of ANP receptors in human () and rat (open circle ) fat cell membranes. Saturation studies (A) and Scatchard plots (B) were performed in 5 separate experiments. Values are means ± SE: membrane receptor density (Bmax) = 274 ± 135 fmol/mg protein, Kd = 147.7 ± 64 pmol/l for human membranes, and Bmax = 510 ± 123 fmol/mg protein, Kd = 138.6 ± 38.4 pmol/l for rat membranes.

To determine more precisely the NPR subtypes expressed in both species, displacement of 125I-ANP binding was performed on human and rat fat cells using increasing concentrations of ANP, CNP (GC-B and NPR-C agonist), and c-ANP4-23 (a specific NPR-C agonist). For human adipocytes, 100% of bound 125I-ANP was displaced by the unlabeled ANP with an IC50 value of 0.46 ± 0.09 nmol/l (Fig. 3A). For c-ANP4-23 and CNP, there was an incomplete displacement of bound 125I-ANP (41.5 ± 7.7% and 25.4 ± 9.4% of bound 125I-ANP, respectively), which indicates the presence of a low NPR-C expression in human adipocytes. On the other hand, in rat fat cells, displacement-curve profiles were dramatically different: both c-ANP4-23 and CNP were as potent as unlabeled ANP to displace 100% of bound 125I-ANP (Fig. 3B). Taken together, these data suggest an opposite NPR pattern of expression between human and rat fat cells.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3.   Competitive inhibition of 125I-ANP binding to human (A) and rat (B) adipocyte membranes by ANP (), c-ANP4-23 (black-triangle), and C-type natriuretic peptide (CNP, black-down-triangle ). Values are expressed as percentage of maximal 125I-ANP-specific binding and are means of 5 separate experiments.

NPR gene expression. To quantify GC-A and NPR-C mRNA expression in human and rat fat cells, real-time quantitative PCR assay was used. The mRNA GC-A/NPR-C ratios were different from one species to another and were 0.017 ± 0.003 in rat fat cells and 1.21 ± 0.31 in human adipocytes, which confirms the opposite NPR subtype expression pattern in these two species revealed by binding assays. GC-A predominates in human fat cells.

Guanylyl cyclase activity. To assess the functionality of ANP receptors identified in rat and human fat cell membranes, guanylyl cyclase activities stimulated by ANP were studied. Guanylyl cyclase activity was measured after 5-, 10-, 15-, and 30-min stimulation with 1 µmol/l ANP or 10 µmol/l isoproterenol. ANP at 10-6 mol/l rapidly increased membrane guanylyl cyclase activity, and stimulation was maximized after 10 min (increase of 12.8 ± 3.7) in human fat cells and after 15 min (increase of 3.6 ± 0.8) in rat adipocytes (Fig. 4A). On the other hand, 10 µmol/l isoproterenol did not stimulate guanylyl cyclase activity in either species (data not shown). Moreover, 10 µmol/l LY-83,583, a guanylyl cyclase blocker, was used to inhibit ANP guanylyl cyclase activity stimulation. In human adipocytes, at 10 min the stimulation was shifted from an increase of 12.8 ± 3.7 to an increase of 4.4 ± 0.1 in the presence of 10 µmol/l LY-83,583. In rat fat cells, at 15 min the stimulation was increased 3.6 ± 0.8 versus 2.7 ± 0.6 in the absence or presence of 10 µmol/l LY-83,583, respectively (Fig. 4A).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4.   A: comparison of guanylyl cyclase activities in human and rat fat cell membranes. Membranes were prepared as described in MATERIALS AND METHODS and were incubated for 5, 10, 15, and 30 min at 37°C with 1 µmol/l ANP with or without 10 µmol/l LY-83,583. Results are expressed as percent increase of basal guanylyl cyclase activity and represent the maximum stimulation observed in the two species (after 10 min for human and 15 min for rat membranes) in the presence or absence of 10 µmol/l LY-83,583. Data are expressed as means ± SE of 6 separate experiments for human and 5 separate experiments for rat cells; *P < 0.01, human vs. rat guanylyl cyclase activity stimulation; $P < 0.01; $$P < 0.001, ANP vs. LY-83,583 plus ANP guanylyl cyclase activity stimulation. B: cGMP production in rat and human isolated fat cells after 15 min of incubation with 1 µmol/l human or rat ANP, respectively, in the presence of 0.1 mmol/l isobutylmethylxanthine. Data represent means ± SE of 6 separate experiments for human and 4 separate experiments for rat adipocytes. *P < 0.01; **P < 0.001, ANP stimulated significantly different from basal.

cGMP levels under ANP stimulation. Finally, we compared cGMP formation under ANP stimulation in human and rat fat cells in the presence of IBMX (0.1 mmol/l). Basal intracellular cGMP levels were 1.2 ± 0.1 pmol · 100 mg lipid-1 · 15 min-1 in human adipocytes and 9.75 ± 0.5 pmol · 100 mg lipid-1 · 15 min-1 in rat fat cells. Figure 4B shows cGMP production induced by 1 µmol/l of r-ANP for rat adipocytes and h-ANP for human adipocytes. h-ANP and r-ANP increased by 258- and 2.8-fold basal cGMP production in human and in rat fat cells, respectively. cAMP production was not modified under ANP stimulation either in human fat cells or in rat adipocytes (data not shown).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The adrenergic system, which is considered to be the main system that controls human fat cell lipolysis, has attracted much interest for the metabolic and pharmacological properties of the lipolytic processes. Studies performed on white adipose tissues from various species have shown large interspecies differences in the control of lipolysis by catecholamines (7, 11, 27, 30) and peptide hormones (41, 55). We have recently demonstrated that peptide hormones such as the NP family activate lipolysis in human fat cells to a similar extent as catecholamines (49). These observations led us to investigate and compare the NP control of lipolysis in fat cells from humans, nonhuman primates (macaques), rodents (rats, mice, hamsters), and nonrodent mammals (dogs, rabbits). In this study, we demonstrate that NP-induced lipolysis is a primate adipocyte specificity, because NPs were devoid of any lipolytic effect in other species even though NPRs were present.

The lipolytic responsiveness of subcutaneous (human, macaque, dog) and internal (rat, mouse, hamster, rabbit) fat cells was evaluated by measuring isoproterenol-induced lipolysis. The lipolytic efficacy and potency of isoproterenol on fat cells differed from one species to another. The highest efficacy of isoproterenol was found in mouse fat cells and the highest potency was found in human adipocytes. These observations are in agreement with previous studies (8, 12). Lipolytic responsiveness to NPs was then examined and compared. ANP did not modify lipolysis in adipocytes from rats, mice, hamsters, dogs, or rabbits, whereas it did activate lipolysis in adipocytes from humans and macaques. Gender (21, 32, 40), age (24, 34, 38), or fat-depot localization (abdominal vs. subcutaneous; 4, 5, 32, 39, 56) are known parameters that could influence fat cell responsiveness and metabolism. Thus the effect of gender on NP response was studied. As in human adipocytes (19, 49), the responses of male and female macaque fat cells to NP stimulation were comparable, whereas female rat fat cells were insensitive to increasing concentrations of ANP. The influence of age was tested on fat cells from young rats. Nevertheless, as in adults, no NP-induced lipolysis was observed. Moreover, our previous study performed on young healthy men (19) showed that the NP-induced lipolysis was not different from the data obtained in the present study with middle-aged women. Fat-depot localization has also been evaluated. Personal unpublished data from studies performed on omental and subcutaneous adipose tissue from the same subjects showed that ANP-induced lipolysis was not statistically different. Finally, rodent fat cell lipolysis performed on inguinal versus epididymal adipose tissue did not reveal any ANP-induced lipolysis in this species. Taken together, these data showed that gender, age, or fat cell depot localization are not important factors that could explain the difference observed between primate and rodent species in the NP control of lipolysis.

To define the NP response in primate fat cells, the effects of other NPs (BNP, CNP) were studied in macaque adipocytes. BNP exerted lipolytic effects, and its efficacy was similar to that of ANP. Compared with our previous work (49), ANP and BNP efficacy was found to be twofold higher in macaque than in human adipocytes. CNP also activated lipolysis in macaque adipocytes and represented 47.5% of the maximal isoproterenol lipolytic effect. Two major biochemically and functionally distinct classes of NPRs are known: guanylyl cyclase (GC-A and GC-B) and clearance (NPR-C) receptors. GC-A and GC-B structures are very close; the major difference is the extracellular binding domain where the identity of the amino acid sequence is only 40%. This could explain the specificity for ligand binding between these two receptor subtypes. GC-A binds ANP and BNP with high affinity, whereas GC-B only binds CNP with high affinity (35, 43, 48). In macaque fat cells, the rank order of potency showed that ANP had a higher potency than BNP, which reflects the involvement of a GC-A receptor. Because we have previously shown (49) that CNP had a very weak lipolytic effect in human fat cells compared with macaques, it can be proposed that the GC-B receptor could be expressed on macaque fat cells because of the higher CNP-induced lipolysis.

Lipolysis in adipocytes is thought to be regulated only by hormones that modulate adenylyl cyclase activity, cAMP contents, and PKA activity, which results in phosphorylation and activation of HSL. PDE-3B, the main enzyme involved in the degradation of cAMP in the adipocyte, is known to be inhibited by cGMP in acellular assays (14, 15, 36, 37). In a previous work (49), we showed that ANP-induced lipolysis in human fat cells was a cGMP-dependent pathway that does not involve PDE-3B inhibition. In this study, we compared isoproterenol- and ANP-induced lipolysis in the presence of a cocktail of agonists for alpha 2-AR and A1-adenosine receptors. Activation of these two potent antilipolytic pathways leads to inhibition of adenylyl cyclase activity and reduction of cAMP formation and consequently reduces PDE-3B substrate availability. In that context, ANP lipolytic activity was preserved in macaque adipocytes, whereas the isoproterenol-induced lipolysis was strongly blunted. Thus these data demonstrate that in primate (human and nonhuman) fat cells, the NP-induced lipolysis pathway is a cGMP-dependent pathway that does not induce PDE-3B inhibition.

To analyze the origin of the lack of lipolytic effect of NPs in rodent fat cells, we studied NPR expression and functionality. Because NPRs have already been described in rat adipocytes (20, 22), this species was chosen as a model. The binding of 125I-ANP to isolated adipocyte membranes from rats and humans demonstrated the presence of saturable, high-affinity binding sites. The Kd values for human and rat adipocytes were similar to values reported for other tissues (48). Saturation experiments cannot give any information concerning NPR subtypes, but global 125I-ANP binding sites reflected by Bmax values were twofold higher in rat than human adipocytes. Previous studies have demonstrated that neither rat nor human adipocytes expressed GC-B (45, 54). This was confirmed by our previous study where CNP (GC-B and NPR-C agonist) had a very weak lipolytic effect on human fat cells (49) and was devoid of any lipolytic activity on rat adipocytes (personal data). To further characterize the subtype expression of NPRs in human and rat fat cells, on one hand, competition studies were performed with increasing concentrations of ANP, c-ANP4-23, and CNP. Displacement-curve profiles were different from one species to another, which suggests a different pattern of NPR-subtype expression between human and rat adipocytes. In human fat cells, c-ANP4-23 and CNP poorly displaced radiolabeled ANP thus revealing low NPR-C expression. Moreover, the similarity between c-ANP4-23 and the CNP displacement-curve profile confirms the absence of the GC-B subtype in human adipocytes. On the contrary, in rat fat cells, c-ANP4-23 and CNP had equivalent potencies to displace radiolabeled ANP, which shows a predominance of NPR-C and a probably limited expression of GC-B receptors. On the other hand, the ratios of GC-A/NPR-C mRNA levels were compared between human and rat adipocytes using real-time quantitative PCR. Opposite patterns of NPR mRNA expression were found. Although levels of expression for "biologically active" and "clearance" receptors in human adipocytes were equivalent, rat fat cells exhibited prevalence for the clearance receptor, which confirms competitive binding assays. These results are in accordance with previous studies on renal tissues (23) where variability in NPRs and a species-related variation of the relative density of clearance and biological receptors were observed. Our data also supported results obtained by Northern blot analysis, which shows that NPR-C mRNA levels were lower than GC-A levels in human fat pads (46), whereas the opposite was found in rat adipocytes (45, 54). Membrane guanylyl cyclase activities were measured in rat and in human adipocytes. The kinetics of activation were different in the two species with guanylyl cyclase activity being faster and more strongly stimulated in human than rat (10 min for human vs. 15 min for rat) fat cells. Finally, this was confirmed by cGMP production measurement under ANP stimulation between human and rat adipocytes. cGMP formation was stimulated in the two species but not to the same extent. In human adipocytes, ANP increased basal cGMP production ~300-fold, whereas it was only stimulated by threefold in rat adipocytes. Moreover, it has to be noticed that in rat adipocytes, cGMP determination was only possible in the presence of the PDE inhibitor IBMX, whereas it was not necessary in human fat cells (personal data). This observation could suggest that a higher total PDE activity exists in rat than human adipocytes.

In summary, our results clearly demonstrate that NP-induced lipolysis is a species-specific effect that only concerns primate fat cells. In this species, NP-induced lipolysis is mediated via the activation of a type A guanylyl cyclase receptor that increases intracellular cGMP content and is independent of the cAMP pathway. The lack of ANP-induced lipolysis that is observed in other species is explained by the opposite pattern of NPR distribution that favors clearance receptor expression. Knowledge of the signaling components of the NP system opens new insights into interesting and original mechanisms for the control of primate fat cell lipolysis. Nevertheless, the physiological or pathophysiological relevance of this pathway should now be delineated.


    ACKNOWLEDGEMENTS

The authors thank Drs. Le Fur and Verschuere (Sanofi Laboratory Research, Montpellier, France) for providing the primate adipose tissues. The authors also thank Dr. M. T. Canal for excellent technical assistance.


    FOOTNOTES

Address for reprint requests and other correspondence: C. Sengenès, INSERM U317, Laboratoire de Pharmacologie Médicale et Clinique, Faculté de Médecine, 37 Allées Jules Guesde, 31073 Toulouse Cedex, France (E-mail: corasengenes{at}yahoo.com).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published February 28, 2002;10.1152/ajpregu.00453.2001

Received 30 July 2001; accepted in final form 27 February 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Aitken, GD, Raizis AM, Yandle TG, George PM, Espiner EA, and Cameron VA. The characterization of ovine genes for atrial, brain and c-type natriuretic peptides. Domest Anim Endocrinol 16: 115-121, 1999[Web of Science][Medline].

2.   Anand-Srivastava, MB. Atrial natriuretic peptide-C receptor and membrane signaling in hypertension. J Hypertens 15: 815-826, 1997[Web of Science][Medline].

3.   Anand-Srivastava, MB, Sairam MR, and Cantin M. Ring-deleted analogs of atrial natriuretic factor inhibit adenylate cyclase/cAMP system. J Biol Chem 265: 8566-8572, 1990[Abstract/Free Full Text].

4.   Arner, P. Differences in lipolysis between human subcutaneous and omental adipose tissues. Ann Med 27: 435-438, 1995[Web of Science][Medline].

5.   Bolinder, J, Kager L, Ostman J, and Arner P. Differences at the receptor and postreceptor levels between human omental and subcutaneous adipose tissue in the action of insulin on lipolysis. Diabetes 32: 117-123, 1983[Abstract].

7.   Bousquet-Melou, A, Galitzky J, Carpene C, Lafontan M, and Berlan M. beta -Adrenergic control of lipolysis in primate white fat cells: a comparative study with nonprimate mammals. Am J Physiol Regulatory Integrative Comp Physiol 267: R115-R123, 1994[Abstract/Free Full Text].

8.   Bousquet-Melou, A, Galitzky J, Lafontan M, and Berlan M. Control of lipolysis in intra-abdominal fat cells of nonhuman primates: comparison with humans. J Lipid Res 36: 451-461, 1995[Abstract].

9.   Bradley, DC, and Kaslow HR. Radiometric assays for glycerol, glucose, and glycogen. Anal Biochem 180: 11-16, 1989[Web of Science][Medline].

10.   Carey, GB. Mechanisms regulating adipocyte lipolysis. Adv Exp Med Biol 441: 157-170, 1998[Web of Science][Medline].

11.   Carpene, C, Bousquet-Melou A, Galitzky J, Berlan M, and Lafontan M. Lipolytic effects of beta 1-, beta 2-, and beta 3-adrenergic agonists in white adipose tissue of mammals. Ann NY Acad Sci 839: 186-189, 1998[Web of Science][Medline].

12.   Carpene, C, Galitzky J, Fontana E, Atgie C, Lafontan M, and Berlan M. Selective activation of beta 3-adrenoceptors by octopamine: comparative studies in mammalian fat cells. Naunyn Schmiedebergs Arch Pharmacol 359: 310-321, 1999[Web of Science][Medline].

13.   Chen, HH, and Burnett JC, Jr. C-type natriuretic peptide: the endothelial component of the natriuretic peptide system. J Cardiovasc Pharmacol 32: S22-S28, 1998.

14.   Degerman, E, Belfrage P, and Manganiello V. cGMP-inhibited phosphodiesterases (PDE III gene family). Biochem Soc Trans 24: 1010-1013, 1996[Web of Science][Medline].

15.   Degerman, E, Belfrage P, and Manganiello V. Structure, localization, and regulation of cGMP-inhibited phosphodiesterase (PDE3). J Biol Chem 272: 6823-6826, 1997[Free Full Text].

16.   De Leon, H, Bonhomme MC, Thibault G, and Garcia R. Localisation of atrial natriuretic factor receptors in the mesenteric arterial bed. Circ Res 77: 64-71, 1995[Abstract/Free Full Text].

17.   Dessi-Fulgheri, P, Sarzani R, Tamburrini P, Moraca A, Espinosa E, Cola G, Giantomassi L, and Rappelli A. Plasma atrial natriuretic peptide and natriuretic peptide receptor gene expression in adipose tissue of normotensive and hypertensive obese patients. J Hypertens 15: 1695-1699, 1997[Web of Science][Medline].

18.   Domino, SE, Tubb DJ, and Garbers DL. Assay of guanylyl cyclase catalytic activity. Methods Enzymol 195: 345-355, 1991[Web of Science][Medline].

19.   Galitzky, J, Sengenes C, Thalamas C, Marques MA, Senard JM, Lafontan M, and Berlan M. The lipid-mobilizing effect of atrial natriuretic peptide is unrelated to sympathetic nervous system activation or obesity in young men. J Lipid Res 42: 536-544, 2001[Abstract/Free Full Text].

20.   Göke, R, Göke B, Noll B, Richter G, Christoph-Fehmann H, and Arnold R. Receptors for atrial natriuretic peptide on isolated rat adipocytes. Biomed Res (Tokyo) 10: 463-467, 1989.

21.   Hellstrom, L, Reynisdottir S, Langin D, Rossner S, and Arner P. Regulation of lipolysis in fat cells of obese women during long-term hypocaloric diet. Int J Obes Relat Metab Disord 20: 745-752, 1996[Web of Science][Medline].

22.   Jeandel, L, Okamura H, Belles-Isles M, Chabot JG, Dihl F, Morel G, Kelly PA, and Heisler S. Immunocytochemical localization, binding, and effects of atrial natriuretic peptide in rat adipocytes. Mol Cell Endocrinol 62: 69-78, 1988[Web of Science].

23.   Kahana, L, Yechiely H, Mecz Y, and Lurie A. Identification and quantification of human kidney atrial natriuretic peptide receptors. Eur J Endocrinol 132: 465-471, 1995[Abstract/Free Full Text].

24.   Karagiannides, I, Tchkonia T, Dobson DE, Steppan CM, Cummins P, Chan G, Salvatori K, Hadzopoulou-Cladaras M, and Kirkland JL. Altered expression of C/EBP family members results in decreased adipogenesis with aging. Am J Physiol Regulatory Integrative Comp Physiol 280: R1772-R1780, 2001[Abstract/Free Full Text].

25.   Kashiwagi, M, Miyamoto K, Takei Y, and Hirose S. Cloning properties and tissue distribution of natriuretic peptide receptor-A of euryhaline eel, Anguilla japonica. Eur J Biochem 259: 204-211, 1999[Web of Science][Medline].

26.   Kullo, IJ, and Burnett JC, Jr. C-type natriuretic peptide. In: Comtemporary Endocrinology: Endocrinology of the Vasculature, edited by Sowers JR.. Totowa, NJ: Humana, 1996, p. 79-93.

27.   Lafontan, M, and Berlan M. Fat cell adrenergic receptors and the control of white and brown fat cell function. J Lipid Res 34: 1057-1091, 1993[Abstract].

28.   Lafontan, M, and Berlan M. Fat cell alpha -2 adrenoceptors: the regulation of fat cell function and lipolysis. Endrocr Rev 16: 716-738, 1995[Abstract/Free Full Text].

29.   Lafontan, M, Sengenes C, Galitzky J, Berlan M, De Glisezinski I, Crampes F, Stich V, Langin D, Barbe P, and Riviere D. Recent developments on lipolysis regulation in humans and discovery of a new lipolytic pathway. Int J Obes Relat Metab Disord 24, Suppl4: 47-52, 2000.

30.   Langin, D, Portillo MP, Saulnier-Blache JS, and Lafontan M. Coexistence of three beta -adrenoceptor subtypes in white fat cells of various mammalian species. Eur J Pharmacol 199: 291-301, 1991[Web of Science][Medline].

31.   Large, V, and Arner P. Regulation of lipolysis in humans. Pathophysiological modulation in obesity, diabetes, and hyperlipidaemia. Diabetes Metab 24: 409-418, 1998[Web of Science][Medline].

32.   Leibel, RL, Edens NK, and Fried SK. Physiologic basis for the control of body fat distribution in humans. Annu Rev Nutr 9: 417-443, 1989[Web of Science][Medline].

33.   Lewicki, JA, and Protter AA. Physiological studies of the natriuretic peptide family. In: Hypertension: Pathophysiology, Diagnosis and Management, edited by Laragh JH, and Brenner BM.. New York: Raven, 1995, p. 1029-1052.

34.   Lonnqvist, F, Nyberg B, Wahrenberg H, and Arner P. Catecholamine-induced lipolysis in adipose tissue of the elderly. J Clin Invest 85: 1614-1621, 1990[Web of Science][Medline].

35.   Maack, T. Receptors of natriuretic peptides: structure, function, and regulation. In: Hypertension: Pathophysiology, Diagnosis, and Management (2nd ed.), edited by Laragh JH, and Brenner BM.. New York: Raven, 1995, p. 1001-1018.

36.   Manganiello, VC, Degerman E, Smith CJ, Vasta V, Tornqvist H, and Belfrage P. Mechanisms for activation of the rat adipocyte particulate cyclic GMP inhibited cyclic AMP phosphodiesterase and its importance in the antilipolytic action of insulin. In: Advances in Second Messenger and Phosphoprotein Research, edited by Strada SJ, and Hidaka H.. New York: Raven, 1992, p. 147-164.

37.   Manganiello, VC, Degerman E, Taira M, Kono T, and Belfrage P. Type III cyclic nucleotide phosphodiesterase and insulin action. In: Current Topics in Cellular Regulation. New York: Academic, 1996, p. 63-100.

38.   Marcus, C, Karpe B, Bolme P, Sonnenfeld T, and Arner P. Changes in catecholamine-induced lipolysis in isolated human fat cells during the first year of life. J Clin Invest 79: 1812-1818, 1987[Web of Science][Medline].

39.   Millet, L, Barbe P, Lafontan M, Berlan M, and Galitzky J. Catecholamine effects on lipolysis and blood flow in human abdominal and femoral adipose tissue. J Appl Physiol 85: 181-188, 1998[Abstract/Free Full Text].

40.   Mittendorfer, B, Horowitz JF, and Klein S. Gender differences in lipid and glucose kinetics during short-term fasting. Am J Physiol Endocrinol Metab 281: E1333-E1339, 2001[Abstract/Free Full Text].

41.   Ng, TB. Studies on hormonal regulation of lipolysis and lipogenesis in fat cells of various mammalian species. Comp Biochem Physiol B Biochem Mol Biol 97: 441-446, 1990.

42.   Pagano, M, and Anand-Srivastava MB. Cytoplasmic domain of natriuretic peptide receptor-C (NPR-C ) constitutes Gi-activator sequences that inhibit adenylyl cyclase activity. J Biol Chem 12: 12, 2001.

43.   Potter, LR, and Hunter T. Guanylyl cyclase-linked natriuretic peptide receptors: structure and regulation. J Biol Chem 276: 6057-6060, 2001[Free Full Text].

44.   Rodbell, M. Metabolism of isolated fat cells. I. Effects of hormones on glucose metabolism and lipolysis. J Biol Chem 29: 375-380, 1964.

45.   Sarzani, R, Dessi-Fulgheri P, Paci VM, Espinosa E, and Rappelli A. Expression of natriuretic peptide receptors in human adipose and other tissues. J Endocrinol Invest 19: 581-585, 1996[Web of Science][Medline].

46.   Sarzani, R, Paci VM, Zingaretti CM, Pierleoni C, Cinti S, Cola G, Rappelli A, and Dessi-Fulgheri P. Fasting inhibits natriuretic peptide clearance receptor expression in rat adipose tissue. J Hypertens 13: 1241-1246, 1995[Web of Science][Medline].

47.   Schofield, JP, Jones DSC, and Forrest JN, Jr. Identification of C-type natriuretic peptide in heart of spiny dogfish shark. Am J Physiol Renal Fluid Electrolyte Physiol 261: F734-F739, 1991[Abstract/Free Full Text].

48.   Schulz, S, and Waldman SA. The guanylyl cyclase family of natriuretic peptide receptors. Vitam Horm 57: 123-151, 1999[Web of Science][Medline].

49.   Sengenès, C, Berlan M, De Glisezinski I, Lafontan M, and Galitzky J. Natriuretic peptides: a new lipolytic pathway in human adipocytes. FASEB J 14: 1345-1351, 2000[Abstract/Free Full Text].

50.   Silberbach, M, and Roberts CT. Natriuretic peptide signaling: molecular and cellular pathways to growth regulation. Cell Signal 13: 221-231, 2001[Web of Science][Medline].

51.   Stein, B, and Levin RL. Natriuretic peptides: physiology, therapeutic potential, and risk stratification in ischemic heart disease. Am Heart J 135: 914-923, 1998[Web of Science][Medline].

52.   Takei, Y, Inoue K, Ando K, Ihara T, Katafuchi T, Kashiwagi M, and Hirose S. Enhanced expression and release of C-type natriuretic peptide in freshwater eels. Am J Physiol Regulatory Integrative Comp Physiol 280: R1727-R1735, 2001[Abstract/Free Full Text].

53.   Thibault, G, Amiri F, and Garcia R. Regulation of natriuretic peptide secretion by the heart. Annu Rev Physiol 61: 193-217, 1999[Web of Science][Medline].

54.   Thibault, G, Lacasse A, and Garcia R. Specific potentiation by cyclic AMP of natriuretic peptide-mediated cyclic GMP production in adipose tissue. Life Sci 58: 2345-2353, 1996[Web of Science][Medline].

55.   Van de Venter, M, Pletschke B, Litthauer D, Roux S, and Oelofsen W. Comparison of the in vitro lipolytic response of human and hamster adipocytes. S Afr J Sci 90: 288-292, 1994[Web of Science].

56.   Zhang, Y, Guo KY, Diaz PA, Heo M, and Leibel RL. Determinants of leptin gene expression in fat depots of lean mice. Am J Physiol Regulatory Integrative Comp Physiol 282: R226-R234, 2002[Abstract/Free Full Text].


Am J Physiol Regul Integr Comp Physiol 283(1):R257-R265
0363-6119/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
A. A. Alli and W. R. Gower Jr.
The C type natriuretic peptide receptor tethers AHNAK1 at the plasma membrane to potentiate arachidonic acid-induced calcium mobilization
Am J Physiol Cell Physiol, November 1, 2009; 297(5): C1157 - C1167.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
O. Tsukamoto, M. Fujita, M. Kato, S. Yamazaki, Y. Asano, A. Ogai, H. Okazaki, M. Asai, Y. Nagamachi, N. Maeda, et al.
Natriuretic peptides enhance the production of adiponectin in human adipocytes and in patients with chronic heart failure.
J. Am. Coll. Cardiol., June 2, 2009; 53(22): 2070 - 2077.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
L. C. Costello-Boerrigter and J. C. Burnett Jr
A new role for the natriuretic peptides metabolic regulators of the adipocyte.
J. Am. Coll. Cardiol., June 2, 2009; 53(22): 2078 - 2079.
[Full Text] [PDF]


Home page
DiabetesHome page
A. L. Birkenfeld, P. Budziarek, M. Boschmann, C. Moro, F. Adams, G. Franke, M. Berlan, M. A. Marques, F. C.G.J. Sweep, F. C. Luft, et al.
Atrial Natriuretic Peptide Induces Postprandial Lipid Oxidation in Humans
Diabetes, December 1, 2008; 57(12): 3199 - 3204.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
C. Moro, F. Pillard, I. de Glisezinski, E. Klimcakova, F. Crampes, C. Thalamas, I. Harant, M.-A. Marques, M. Lafontan, and M. Berlan
Exercise-induced lipid mobilization in subcutaneous adipose tissue is mainly related to natriuretic peptides in overweight men
Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E505 - E513.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
T. J. Bartness and C. K. Song
Thematic review series: Adipocyte Biology. Sympathetic and sensory innervation of white adipose tissue
J. Lipid Res., August 1, 2007; 48(8): 1655 - 1672.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. Moro, F. Pillard, I. de Glisezinski, F. Crampes, C. Thalamas, I. Harant, M.-A. Marques, M. Lafontan, and M. Berlan
Atrial natriuretic peptide contribution to lipid mobilization and utilization during head-down bed rest in humans
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2007; 293(2): R612 - R617.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
T. Tsutamoto, T. Tanaka, H. Sakai, C. Ishikawa, M. Fujii, T. Yamamoto, and M. Horie
Total and high molecular weight adiponectin, haemodynamics, and mortality in patients with chronic heart failure
Eur. Heart J., July 2, 2007; 28(14): 1723 - 1730.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. Gutkowska, A. Paquette, D. Wang, J.-M. Lavoie, and M. Jankowski
Effect of exercise training on cardiac oxytocin and natriuretic peptide systems in ovariectomized rats
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2007; 293(1): R267 - R275.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
C. Moro, J. Polak, J. Hejnova, E. Klimcakova, F. Crampes, V. Stich, M. Lafontan, and M. Berlan
Atrial natriuretic peptide stimulates lipid mobilization during repeated bouts of endurance exercise
Am J Physiol Endocrinol Metab, May 1, 2006; 290(5): E864 - E869.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
C. Kistorp, J. Faber, S. Galatius, F. Gustafsson, J. Frystyk, A. Flyvbjerg, and P. Hildebrandt
Plasma Adiponectin, Body Mass Index, and Mortality in Patients With Chronic Heart Failure
Circulation, September 20, 2005; 112(12): 1756 - 1762.
[Abstract] [Full Text] [PDF]


Home page
Arch Intern MedHome page
J. McCord, B. J. Mundy, M. P. Hudson, A. S. Maisel, J. E. Hollander, W. T. Abraham, P. G. Steg, T. Omland, C. W. Knudsen, K. R. Sandberg, et al.
Relationship Between Obesity and B-Type Natriuretic Peptide Levels
Arch Intern Med, November 8, 2004; 164(20): 2247 - 2252.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. Moro, J. Galitzky, C. Sengenes, F. Crampes, M. Lafontan, and M. Berlan
Functional and Pharmacological Characterization of the Natriuretic Peptide-Dependent Lipolytic Pathway in Human Fat Cells
J. Pharmacol. Exp. Ther., March 1, 2004; 308(3): 984 - 992.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/1/R257    most recent
00453.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (41)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sengenès, C.
Right arrow Articles by Galitzky, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sengenès, C.
Right arrow Articles by Galitzky, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online