|
|
||||||||
attenuates intimal hyperplasia after mouse
carotid artery injury
1 Department of Surgery, University of Colorado Health Sciences Center, Denver 80262; and 2 Source Precision Medicine, Boulder, Colorado 80301
| |
ABSTRACT |
|---|
|
|
|---|
This study sought to determine the
influence of tumor necrosis factor-
(TNF-
) on intimal hyperplasia
(IH) and characterize the mechanisms of transcriptional regulation
after vascular injury. A murine model of wire carotid artery injury was
employed to induce IH in wild-type (WT) and TNF-
-deficient
[TNF(
/
)] animals. Three days after injury, TNF-
and nuclear
factor-
B (NF-
B) protein expression was markedly increased in the
injured WT carotid artery compared to control. Injury increased TNF-
and NF-
B mRNA expression 100- and 7.5-fold, respectively. Compared
with WT specimens, injury in TNF(
/
) animals decreased both NF-
B
mRNA and protein nearly 7.5- and 4-fold, respectively. Expression of
the NF-
B-dependent cytokine monocyte chemotactic protein 1 was
markedly diminished in injured TNF(
/
) animals. Finally, TNF(
/
)
animals demonstrated a sevenfold reduction in IH compared with WT
animals. Cumulatively, these data mechanistically link TNF-
and
NF-
B in vivo and suggest an important influence of TNF-
on
postinjury IH.
cytokine; inflammation; atherogenesis; transcription; nuclear
factor-
B
| |
INTRODUCTION |
|---|
|
|
|---|
ACCUMULATING EVIDENCE LINKS inflammation and intimal hyperplasia (IH; Refs. 9, 19, 22). Luminal endothelial injury, both indirectly as with nicotine and directly as with angioplasty, initiates inflammatory cell infiltration and subsequent expression of cytokines, growth factors, and chemoattractants. Vascular smooth muscle cells (VSMCs) proliferate and migrate to the intima thus forming the nidus for IH. Within this paradigm, numerous investigators have attempted to define specific inflammatory mediators.
Tumor necrosis factor-
(TNF-
) is a multifunctional cytokine that
has been identified in human atherosclerotic plaque specimens (1). Although macrophages are classically identified as
the source of TNF-
after arterial injury, other cells, including the
endothelium and VSMCs, also produce and respond to TNF-
(4, 29). In vitro, TNF-
mediates proinflammatory events including VSMC proliferation, migration, and endothelial cell adhesion molecule expression (13, 21). TNF-
exerts these effects by
activating the transcriptional regulator nuclear factor-
B (NF-
B;
Ref. 23). In vivo, balloon injury of rabbit aortas results
in increased expression of TNF-
in actively proliferating VSMCs
(28). Balloon injury also results in increased NF-
B
activity and production of the NF-
B-dependent chemokine monocyte
chemotactic protein 1 (MCP-1; Ref. 10). To date, no study
of vascular injury has linked expression of TNF-
and NF-
B in vivo.
The pathogenic mechanisms that relate TNF-
and IH remain
controversial. Some suggest that TNF-
actually has antiproliferative effects by promoting VSMC apoptosis (7, 12).
Although there is a microanatomic correlation between cytokines and IH
formation, clinical data suggest a weaker association between TNF-
and symptomatic cardiovascular occlusive disease (24). To
date, one study has demonstrated attenuation of IH in a
TNF-
-deficient mouse (16). However, these investigators
utilized a model of low shear stress. Herein, we employ a model of
direct mechanical endoluminal injury. The purposes of the present study
are to 1) determine the influence of TNF-
on the in vivo
development of IH and 2) examine the effect of
TNF-
-mediated IH on NF-
B and MCP-1 expression after vascular injury.
| |
METHODS |
|---|
|
|
|---|
Murine model of carotid injury.
This study utilized 6- to 8-wk-old, 25- to 30-g, male, wild-type (WT)
mice of strain B6,129SF2/J and TNF-
-deficient [TNF(
/
)] mice of
strain B6,129S-Tnftm1Gkl (Jackson
Laboratory, Bar Harbor, ME) (15). Experimental groups for
morphometric analysis at 28 days were as follows: WT injured (n = 7), WT sham (n = 6), and
TNF(
/
) injured (n = 5). All experimental protocols
were approved by the University of Colorado Animal Review Committee.
General anesthesia was administered (80 mg/kg ketamine, Fort Dodge
Laboratories, Fort Dodge, IA and 20 mg/kg xylazine, Phoenix
Pharmaceutical, St. Joseph, MO) via intraperitoneal injection. Surgical
procedures were assisted with a StereoZoom 7 microscope (Bausch and
Lomb, Rochester, NY). The left carotid artery was exposed via a midline
neck incision. The common, external, and internal carotid arteries were
identified and controlled (using 7-0 Surgilene suture). A 30-gauge
needle was then employed to make an arteriotomy at the external
carotid. A 0.014-in flexible wire (ACS Hi-Torque Floppy II, Advanced
Cardiovascular Systems, Temecula, CA) was thrice passed into the common
carotid with a simultaneous twisting motion as previously described
(11). The external carotid was ligated and hemostasis was
achieved. The skin was then closed with 7-0 Surgilene suture. The
sham-operated animals did not undergo arteriotomy and wire injury.
Euthanasia was performed according to the guidelines set by the
American Veterinary Medical Association Panel on Euthanasia with
general anesthesia and pentobarbital sodium (100 mg/kg). For
morphometric analysis, animals were killed at 28 days and received
intracardiac injection of 500 µl of heparinized saline followed by
4% paraformaldehyde. For all other studies, animals were euthanized at
3 days. Animal care was provided by the University of Colorado animal facility.
Immunohistochemistry. Three days after injury, bilateral common carotid arteries were isolated and removed. The right common carotid arteries were examined as uninjured contralateral controls. All tissue was immediately preserved in Tissue Freezing Medium (Triangle Biomedical Sciences, Durham, NC). Slides were fixed in 70% acetone-30% methanol solution for 10 min. After air drying, slides were washed three times in PBS for 10 min.
Specimens were blocked with 10% donkey serum (TNF-
and MCP-1) or
10% goat serum (NF-
B) for 1 h at room temperature. Sections were then incubated at 4°C overnight with either goat anti-mouse TNF-
polyclonal IgG, goat anti-mouse MCP-1 polyclonal IgG, or rabbit
anti-mouse NF-
B p65 polyclonal IgG (Santa Cruz Biotechnology, Santa
Cruz, CA). After PBS wash in triplicate, sections were incubated for
1 h in the dark at room temperature in either indocarbocyanine (Cy3)-labeled donkey anti-goat IgG (TNF-
and MCP-1) at a 1:150 dilution or goat anti-rabbit IgG (NF-
B). Negative controls were run
parallel with all sections by substituting a goat anti-mouse nonspecific IgG for the primary antibody in the samples stained for
TNF-
and MCP-1. On sections stained for the NF-
B p65 subunit, a
nonspecific rabbit anti-mouse antibody was employed.
Cell-wall glycoproteins and nuclei were, respectively, stained green
with Alexa Fluor 488/wheat-germ agglutinin (WGA) (Molecular Probes,
Eugene, OR) and bis-benzimide (Sigma Chemical, St. Louis, MO).
Fluorescent images were evaluated and photographed with appropriate filter cubes using an automated Leica DMRXA confocal microscope with
full software control (Intelligent Image Innovations). Differences in
immunofluorescence are expressed semiquantitatively as mean integrated
Cy3 intensity per unit of vessel area (µm2).
RT quantitative PCR.
RNA was isolated from individual arterial specimens with an isolation
kit (Ambion, Austin, TX). One microgram of total RNA was reverse
transcribed using random hexamer primers (2.5 µM) in a final
concentration of 5.5 mM MgCl2, 50 mM KCl, 10 mM
Tris · HCl (pH 8.3), 0.5 mM of each dNTP, 20 U of RNase
inhibitor, and 50 U of MultiScribe RT (Perkin-Elmer, Foster City, CA).
The sample set at each amplification included a negative control
represented by the mixture minus the template. Probes were designed
across intronic sequences. After amplification, the product size was tested by electrophoresis in 1.8% agarose gel. The primers for TNF-
were obtained from Applied Biosystems. The primers for the NF-
B p65
subunit were provided by Source Precision Medicine (J. Emmick, Boulder,
CO). These sequences, which have not been previously published, were
forward primer: AGATCTTCTTGCTGTGCGACAA, and reverse primer: GTGCCTCCCAGCCTGGT.
and NF-
B were labeled at the 5' end with
the reporter dye molecule 6-carboxy fluorescein (FAM). A ribosomal RNA
18S target probe labeled at the 5' end with the reporter dye molecule
VIC (Applied Biosystems) was employed as the internal control. TaqMan
real-time quantitative PCR was performed by amplifying mixtures
containing 100 nM of selected probes, 200 nM of primers, and the target
cDNA template at 95°C for 20 s and 60°C for 1 min for 40 cycles using the ABI PRISM 7700 sequence detector (Applied Biosystems).
During each PCR cycle, the 5' to 3' exonuclease activity of DNA
polymerase cleaves the TaqMan probe, thereby releasing the fluorescence
of the reporter dye at the appropriate wavelength. The increase in
fluorescence is proportional to the concentration of template in the
PCR (2). The threshold was determined according to the
manufacturer's protocol for the TaqMan PCR kit. By using 18S as an
internal control, the relative number of amplified target DNA copies
was calculated. Data are expressed as a relative percent increase of
mRNA in the injured arteries versus the contralateral control.
NF-
B assay.
A transcription factor assay was employed to investigate the presence
of unbound NF-
B p65 subunit in individual arterial specimens
(17). This assay is based on the specific binding of the
active form of NF-
B from tissue extract to a NF-
B consensus oligonucleotide attached to an ELISA plate. The primary antibody used
to detect NF-
B recognizes an epitope on the p65 subunit, which is
accessible only when NF-
B is bound to its target DNA. A secondary
horseradish peroxidase-conjugated antibody provides a colorimetric
readout quantified by spectrophotometry. Positive controls for the
NF-
B p65 subunit were provided from cellular extracts previously
evaluated by both transcription factor assay and electrophoretic
mobility-shift assay (EMSA, Active Motif, Carlsbad, CA). To monitor the
specificity of the assay, both WT and mutated consensus
oligonucleotides were employed in each reaction.
/
) mice were skeletonized,
harvested bilaterally, and fixed at
70°C. The tissue was diced into
small pieces with a cooled razor blade and placed in lysis buffer. A
mechanical homogenizer was then applied for 30 s, which maintained
a temperature of 4°C. Samples were incubated on ice for 30 min and
centrifuged at 10,000 g for 10 min. Supernatants were
transferred to separate tubes and recentrifuged. Tissue protein content
was measured via the Coomassie protein assay (Pierce, Rockford, IL).
Total protein (20 µg) was loaded to each well and assayed according
to the manufacturer's directions (Active Motif). Quantification of the
NF-
B p65 subunit was expressed in mean absorbance (
) per arterial sample.
IH and morphometric analysis. The right and left common carotid arteries were harvested, embedded in paraffin, and sectioned for hematoxylin and eosin staining. Serial sections were taken along the length of the vessel at 150-µm intervals. Qualitative review of these specimens revealed the area of greatest luminal stenosis. At this point, 20-30 sections were taken at 4-µm intervals of which multiple six to eight samples underwent quantitative morphometric analysis. Plain images were taken on the confocal microscope and the following structures were identified: lumen, internal elastic lamina (IEL), external elastic lamina (EEL), and neointima. Intimal (specimen from lumen to IEL) and medial areas (specimen from IEL to EEL) were measured using Slidebook software (version 3.0.2.12). Intimal to medial ratios were also calculated.
Statistical analysis. Data are presented as means ± SE. ANOVA with Bonferroni-Dunn post hoc analysis was used to analyze differences between experimental groups. Statistical significance was accepted within 95% confidence limits.
| |
RESULTS |
|---|
|
|
|---|
Vascular injury and TNF-
expression.
Several methods were utilized to demonstrate the increased expression
of TNF-
in WT animals. Three days after injury, TNF-
mRNA
expression was increased 100-fold compared with the uninjured contralateral arteries (n = 3; P < 0.05; Fig. 1A).
Immunohistochemistry utilizing Cy3-labeled TNF-
demonstrated
increased TNF-
in injured specimens. Localized predominantly to the
tunica media of the injured arteries (Fig. 1B), the
uninjured control vessels demonstrated essentially no signal in any
portion of the specimen. Furthermore, no differences were noted between
the noninjured vessels and vessels from sham WT-operated animals
(n = 3). The reported immunofluorescence consistently
represents data from multiple arterial sections of three separate
animals. Together these results suggest a strong association between
injury and TNF-
expression.
|
Vascular injury, TNF-
, and IH.
Endoluminal injury promoting IH has been well documented in various
animal models ranging from sheep to rats (20, 26). Carotid
injury in mice has previously been described (11, 27). To
validate the effectiveness and reproducibility of our model, direct
wire injury was performed on seven consecutive WT mice. Twenty-eight
days after injury, arteries were harvested. Qualitatively, the intimal
size was consistently larger in the injured versus the noninjured
contralateral vessels (Fig. 2).
|
is upregulated after vascular
injury, it remains unclear whether TNF-
is an important factor in
the development of IH. We therefore studied the effects of vascular
injury in a TNF-
-deficient animal. Twenty-eight days after injury,
TNF(
/
) mice had less IH than WT mice. Intimal and medial areas were
calculated and compared from multiple sections with the highest degree
of stenosis from each animal (Fig. 3). The intimal area of the WT injured vessels was substantially greater than that of the noninjured vessels [(14.1 ± 2.5) × 103 vs. (0.7 ± 0.1) × 103
µm2; P < 0.05]. Compared with WT
animals (n = 7), injured TNF(
/
) mice
(n = 5) demonstrated a sevenfold decrease in intimal
area [(14.1 ± 2.5) × 103 vs. (2.0 ± 0.9) × 103 µm2; P < 0.05; Fig. 3]. Qualitatively, although vascular injury in TNF(
/
)
animals resulted in less IH than WT, these animals still exhibited some
intimal change. However, compared to the uninjured side, injury in the
TNF(
/
) animals did not have a significant increase in IH
[(2.0 ± 0.9) × 103 vs. (0.6 ± 0.1) × 103 µm2 contralateral; P = 0.57]. To verify that these differences were exclusively related to
intimal changes, we also measured medial areas and calculated
intimal-to-medial ratios. There were no differences in medial areas
between injured groups. Furthermore, intimal-to-medial ratios support
exclusive intimal proliferation. The WT injured specimens maintained a
sevenfold increase in the intimal-to-medial ratio compared with the
injured TNF(
/
) vessels (1.29 ± 0.16 vs. 0.18 ± 0.06;
P < 0.05). No differences in intimal area were noted
between the sham-operated group (n = 6) and the
uninjured controls.
|
Vascular injury, TNF-
, and NF-
B.
We utilized several methods to characterize the influence of TNF-
on
NF-
B activation in our in vivo model. Three days postinjury, NF-
B
mRNA (Fig. 4A) in the injured
WT was increased sixfold compared with contralateral control and
TNF(
/
) (P < 0.05). Immunohistochemically, NF-
B was
identified in the intima and media of both WT and TNF(
/
) animals
(Fig. 4B). Mean integrated Cy3 intensity/vessel area
(µm2) of the injured WT demonstrated a threefold increase
versus the injured TNF(
/
) sections. Intranuclear signal could be
identified at the site of injury. Results were consistent across
multiple sections in three separate animals.
|
B p65 subunit protein in individual
arteries (Fig. 4C). WT injured specimens maintained a
fivefold increase in unbound p65 absorbance versus contralateral
control (1.87 ± 0.4 vs. 0.33 ± 0.1; P < 0.05). Compared with injured WT mice, injury in TNF(
/
) mice
decreased NF-
B protein fourfold (1.87 ± 0.4 vs. 0.49 ± 0.08; P < 0.05). Interestingly, injured TNF(
/
)
mice still demonstrated an increase in unbound p65 compared to
uninjured TNF(
/
) control mice (0.49 ± 0.08 vs. 0.14 ± 0.06; P < 0.05). To monitor the specificity of the
assay, both a WT and mutated p65-specific consensus oligonucleotide
were used. When added to the reaction, the WT oligonucleotide
consistently prevented p65 binding to the plate and resulted in zero
absorbance at 450 nm. Mutated consensus oligonucleotide had no effect.
Vascular injury and MCP-1 expression.
To evaluate the downstream effect of TNF-
-mediated IH, we
investigated the expression of the NF-
B-dependent protein MCP-1 after vascular injury. MCP-1 was identified by immunofluorescence after
wire injury in both WT and TNF(
/
) animals (Fig.
5). Qualitatively, fluorescence intensity
and distribution were markedly diminished in the injured TNF(
/
)
mice compared with injured WT specimens. Quantitatively, the mean
integrated Cy3 intensity/vessel area (µm2) was
approximately fivefold higher in the injured WT samples versus the
control. TNF(
/
) samples revealed minimal MCP-1-labeled signal in
the intima and media. These data are consistent across multiple samples
from three different WT and TNF(
/
) animals.
|
| |
DISCUSSION |
|---|
|
|
|---|
The present study demonstrates that 1) TNF-
is
abundantly expressed locally after mouse carotid injury; 2)
these observations are associated with activation of NF-
B; and
3) TNF-
-deficient animals have significantly lower levels
of MCP-1, NF-
B, and IH. Despite data suggesting a fundamental role
for TNF-
in the inflammatory fibroproliferative response to vascular
injury, several groups conversely report that TNF-
may not be an
important component in the promotion of IH. Elhage and colleagues
(5) demonstrated a decrease in atherosclerotic area when
blocking the action of interleukin-1 in apolipoprotein E-deficient
mice, whereas blocking TNF-
had no effect. Clinical studies that
measured plasma levels of TNF-
in patients with unstable angina
showed no difference compared with healthy controls (25).
Furthermore, TNF-
promoted apoptosis in both human and rat
VSMCs in vitro (7). Whereas VSMC apoptosis in the
mature plaque may predispose patients to acute coronary syndromes,
apoptosis of postinjury VSMCs should theoretically decrease
plaque mass and quite possibly inhibit IH (9).
The well-known proinflammatory profile of TNF-
suggests its key role
in the vascular response to injury. However, few reports characterize
the relative role of TNF-
in IH. Over a decade ago, Barath and
colleagues (1) identified TNF-
in human atherosclerotic specimens. Numerous studies have characterized the proinflammatory effects of TNF-
in vitro. VSMCs produce and respond to TNF-
by
accelerating proliferation and growth factor production (13, 29). Several in vivo studies have identified and temporally characterized TNF-
expression after vascular injury (6,
28). Although these data suggest a change in VSMC phenotype in
vitro and temporal association of TNF-
expression in vivo, they do not demonstrate a causative role of TNF-
in IH.
First reported by Lindner and colleagues (11), the murine
model of wire carotid artery injury denudes the vascular endothelium. Although VSMC proliferation and migration to form a neointima are a
central component of postangioplasty restenosis, it would be
inappropriate to make direct associations between IH in mice and the
fibroproliferative response in humans. The majority of in vivo studies
are performed on normal native vessels. As such, we are unable to
extrapolate results from normal murine arteries to diseased
atherosclerotic vessels of patients with acute coronary syndromes. The
absence of an atherosclerotic lesion before injury may lead to
variations in the degree of resultant IH. Although hyperlipidemic mouse
models exist, they do not fully mimic the complexities of
atherosclerosis or postangioplasty restenosis. Furthermore, the stretch
and denudation injury of angioplasty in humans may differ from the
denudation of the vascular endothelium alone in mice (8).
Finally, in the present study, we did not characterize the specific
cellular subtypes involved in the hyperplastic response. As such, we
are unable to draw conclusions as to influence of TNF-
on monocytes,
lymphocytes, or endothelial cells and the relative contribution to the
development of IH.
A recent study by Rectenwald and colleagues (16) addressed
the role of TNF-
and IH in TNF-
-deficient mice. Using a
low-shear-stress carotid-ligation model, they observed a consistent
lack of IH in TNF-
-deficient animals. Furthermore, TNF-
mRNA was
present in ligated arteries but not in normal or sham-operated mice.
Interestingly, mice that were able to produce only membrane-bound
TNF-
demonstrated an increased hyperplastic response. Our data
corroborate and extend the Rectenwald study by demonstrating an
attenuation in hyperplasia in TNF-
-deficient animals after
mechanical injury. Similarly, we explored this relationship by
comparing intimal-to-medial ratios. Instead of pooling samples, we
chose to quantify TNF-
and NF-
B mRNA and unbound NF-
B p65
protein in individual arterial specimens. It must be noted that the
vascular response to injury in TNF(
/
) mice was not completely
eliminated; IH, albeit minimal, can be detected in these specimens.
This leads us to believe that other molecular mechanisms contribute, at
least in part, to this fibroproliferative response.
TNF-
is one of many NF-
B-dependent cytokines. Functioning as a
transcriptional activator, NF-
B mediates the overexpression of other
proinflammatory genes (18, 24) and has been identified in
human atherosclerotic lesions (3). Although we found an increase in unbound NF-
B p65 subunit protein after vascular injury concurrent with TNF-
expression and IH, these data must be
interpreted cautiously. The current study is limited to a temporal
association between TNF-
expression and unbound NF-
B. The current
dogma that transcription of NF-
B mRNA is regulated by NF-
B itself is contrary to our findings that transcription can actually be induced
by vascular injury alone. Furthermore, it is surprising that removal of
a single proinflammatory cytokine in the transgenic animal results in
such a dramatic decrease in transcribed message. We selectively
investigated a limited number of time points, with 72 h postinjury
revealing the most striking difference in mRNA and free NF-
B p65
protein. With regard to the TNF(
/
) animal, it is possible that
these animals are deficient in other proinflammatory mediators aside
from TNF-
. Finally, we acknowledge the use of EMSA as a well-known
standard for measuring NF-
B. Unfortunately, with the small amount of
tissue in our model, we were unable to reproducibly perform EMSA
analysis on individual specimens. As such, a transcription factor assay
was utilized to quantify unbound NF-
B p65 subunit in individual
arteries, which maintains a reported 10-fold higher sensitivity
compared to EMSA (17).
MCP-1 is a powerful chemotactic agent produced by several resident
vascular cells including monocytes, endothelium, and VSMCs. Expression
of MCP-1 is induced by TNF-
(14) and has been linked to
NF-
B activation after vascular injury in vivo (10). We
investigated the effect of vascular injury on expression of MCP-1 as a
downstream surrogate marker for NF-
B activation. Our results suggest
a decrease in MCP-1 expression in the TNF(
/
) animal. Cumulatively,
these observations suggest that the influence of TNF-
on IH is
twofold. Although TNF-
does appear to have direct mitogenic and
chemotactic effects on various vascular cells, the influence of TNF-
might be more global via its downstream effects on NF-
B-dependent mitogens.
| |
ACKNOWLEDGEMENTS |
|---|
This work is supported by National Institutes of Health Grants GM-49222 and GM-08315 (to A. H. Harken).
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: C. H. Selzman, Division of Cardiothoracic Surgery, Box C-310, Univ. of Colorado Health Sciences Center, 4200 East Ninth Ave., Denver, CO 80262 (E-mail: craig.selzman{at}UCHSC.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
March 29, 2002;10.1152/ajpregu.00033.2002
Received 22 January 2002; accepted in final form 25 March 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Barath, P,
Fishbein MC,
Cao J,
Berenson J,
Helfant RH,
and
Forrester JS.
Detection and localization of tumor necrosis factor in human atheroma.
Am J Cardiol
65:
297-302,
1990[Web of Science][Medline].
2.
Bieche, I,
Olivi M,
Champeme MH,
Vidaud D,
Lidereau R,
and
Vidaud D.
Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer.
Int J Cancer
78:
661-666,
1998[Web of Science][Medline].
3.
Brand, K,
Page S,
Rogler G,
Bartsch A,
Brandl R,
Knuechel R,
Page M,
Kaltschmidt C,
Baeuerle PA,
and
Neumeier D.
Activated transcription factor nuclear factor-kappa
is present in the atherosclerotic lesion.
J Clin Invest
97:
1715-1722,
1996[Web of Science][Medline].
4.
Chen, XL,
Tummala PE,
Olliff L,
and
Medford RM.
E-selectin gene expression in vascular smooth muscle cells. Evidence for a tissue-specific repressor protein.
Circ Res
80:
305-311,
1997
5.
Elhage, R,
Maret A,
Pieraggi MT,
Thiers JC,
Arnal JF,
and
Bayard F.
Differential effects of interleukin-1 receptor antagonist and tumor necrosis factor binding protein on fatty-streak formation in apolipoprotein E-deficient mice.
Circulation
97:
242-244,
1998
6.
Faries, PL,
Marin ML,
Veith FJ,
Ramirez JA,
Suggs WD,
Parsons RE,
Sanchez LA,
and
Lyon RT.
Immunolocalization and temporal distribution of cytokine expression during the development of vein graft intimal hyperplasia in an experimental model.
J Vasc Surg
24:
463-471,
1996[Web of Science][Medline].
7.
Geng, YJ,
Wu Q,
Muszynski M,
Hansson GK,
and
Libby P.
Apoptosis of vascular smooth muscle cells induced by in vitro stimulation with interferon-
, tumor necrosis factor-
, and interleukin-1
.
Arterioscler Thromb Vasc Biol
16:
19-27,
1996
8.
Lafont, A,
and
Faxon D.
Why do animal models of post-angioplasty restenosis sometimes poorly predict the outcome of clinical trials?
Cardiovasc Res
39:
50-59,
1998
9.
Libby, P.
Coronary artery injury and the biology of atherosclerosis: inflammation, thrombosis, and stabilization.
Am J Cardiol
86:
3J-8J,
2000[Web of Science][Medline].
10.
Lindner, V.
The NF-
B and I
B system in injured arteries.
Pathobiology
66:
311-320,
1998[Web of Science][Medline].
11.
Lindner, V,
Fingerle J,
and
Reidy MA.
Mouse model of arterial injury.
Circ Res
73:
792-796,
1993
12.
Meldrum, DR.
Tumor necrosis factor in the heart.
Am J Physiol Regulatory Integrative Comp Physiol
274:
R577-R595,
1998
13.
Morisaki, N,
Xu QP,
Koshikawa T,
Saito Y,
Yoshida S,
and
Ueda S.
Tumour necrosis factor-
can modulate the phenotype of aortic smooth muscle cells.
Scand J Clin Lab Invest
53:
347-352,
1993[Web of Science][Medline].
14.
Murao, K,
Ohyama T,
Imachi H,
Ishida T,
Cao WM,
Namihira H,
Sato M,
Wong NC,
and
Takahara J.
TNF-
stimulation of MCP-1 expression is mediated by the Akt/PKB signal transduction pathway in vascular endothelial cells.
Biochem Biophys Res Commun
276:
791-796,
2000[Web of Science][Medline].
15.
Pasparakis, M,
Alexopoulou L,
Episkopou V,
and
Kollias G.
Immune and inflammatory responses in TNF-
-deficient mice: a critical requirement for TNF-
in the formation of primary B-cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response.
J Exp Med
184:
1397-1411,
1996
16.
Rectenwald, JE,
Moldawer LL,
Huber TS,
Seeger JM,
and
Ozaki CK.
Direct evidence for cytokine involvement in neointimal hyperplasia.
Circulation
102:
1697-1702,
2000
17.
Renard, P,
Ernest I,
Houbion A,
Art M,
Le Calvez H,
Raes M,
and
Remacle J.
Development of a sensitive multi-well colorimetric assay for active NF-
B.
Nucleic Acids Res
29:
E21,
2001
18.
Reznikov, LL,
Shames BD,
Barton HA,
Selzman CH,
Fantuzzi G,
Kim S,
Johnson SM,
and
Dinarello CA.
Interleukin-1
deficiency results in reduced NF-
B levels in pregnant mice.
Am J Physiol Regulatory Integrative Comp Physiol
278:
R263-R270,
2000
19.
Ross, R.
Atherosclerosis
an inflammatory disease.
N Engl J Med
340:
115-126,
1999
20.
Selzman, CH,
Gaynor JS,
Turner AS,
Johnson SM,
Horwitz LD,
Whitehill TA,
and
Harken AH.
Ovarian ablation alone promotes aortic intimal hyperplasia and accumulation of fibroblast growth factor.
Circulation
98:
2049-2054,
1998
21.
Selzman, CH,
McIntyre RC, Jr,
Shames BD,
Whitehill TA,
Banerjee A,
and
Harken AH.
Interleukin-10 inhibits human vascular smooth muscle proliferation.
J Mol Cell Cardiol
30:
889-896,
1998[Web of Science][Medline].
22.
Selzman, CH,
Miller SA,
and
Harken AH.
Therapeutic implications of inflammation in atherosclerotic cardiovascular disease.
Ann Thorac Surg
71:
2066-2074,
2001
23.
Selzman, CH,
Shames BD,
Reznikov LL,
Miller SA,
Meng X,
Barton HA,
Werman A,
Harken AH,
Dinarello CA,
and
Banerjee A.
Liposomal delivery of purified inhibitory-
B
inhibits tumor necrosis factor-
-induced human vascular smooth muscle proliferation.
Circ Res
84:
867-875,
1999
24.
Siebenlist, U,
Franzoso G,
and
Brown K.
Structure, regulation and function of NF-
B.
Annu Rev Cell Biol
10:
405-455,
1994[Web of Science].
25.
Simon, AD,
Yazdani S,
Wang W,
Schwartz A,
and
Rabbani LE.
Circulating levels of IL-1
, a prothrombotic cytokine, are elevated in unstable angina versus stable angina.
J Thromb Thrombolysis
9:
217-222,
2000[Web of Science][Medline].
26.
Sterpetti, AV,
Cucina A,
Lepidi S,
Randone B,
Corvino V,
D'Angelo LS,
and
Cavallaro A.
Formation of myointimal hyperplasia and cytokine production in experimental vein grafts.
Surgery
123:
461-469,
1998[Web of Science][Medline].
27.
Sullivan, TR, Jr,
Karas RH,
Aronovitz M,
Faller GT,
Ziar JP,
Smith JJ,
O'Donnell TF, Jr,
and
Mendelsohn ME.
Estrogen inhibits the response to injury in a mouse carotid artery model.
J Clin Invest
96:
2482-2488,
1995[Web of Science][Medline].
28.
Tanaka, H,
Sukhova G,
Schwartz D,
and
Libby P.
Proliferating arterial smooth muscle cells after balloon injury express TNF-
but not interleukin-1 or basic fibroblast growth factor.
Arterioscler Thromb Vasc Biol
16:
12-18,
1996
29.
Warner, SJ,
and
Libby P.
Human vascular smooth muscle cells. Target for and source of tumor necrosis factor.
J Immunol
142:
100-109,
1989[Abstract].
This article has been cited by other articles:
![]() |
H. Murayama, M. Takahashi, M. Takamoto, Y. Shiba, H. Ise, J. Koyama, Y.-i. Tagawa, Y. Iwakura, and U. Ikeda Deficiency of tumour necrosis factor-{alpha} and interferon-{gamma} in bone marrow cells synergistically inhibits neointimal formation following vascular injury Cardiovasc Res, November 1, 2008; 80(2): 175 - 180. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Peppel, L. Zhang, E. S. Orman, P.-O. Hagen, A. Amalfitano, L. Brian, and N. J. Freedman Activation of vascular smooth muscle cells by TNF and PDGF: overlapping and complementary signal transduction mechanisms Cardiovasc Res, February 15, 2005; 65(3): 674 - 682. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, K. Peppel, L. Brian, L. Chien, and N. J. Freedman Vein Graft Neointimal Hyperplasia Is Exacerbated by Tumor Necrosis Factor Receptor-1 Signaling in Graft-Intrinsic Cells Arterioscler. Thromb. Vasc. Biol., December 1, 2004; 24(12): 2277 - 2283. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Zimmerman, L. L. Reznikov, A. C. Sorensen, and C. H. Selzman Relative contribution of the TNF-alpha receptors to murine intimal hyperplasia Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2003; 284(5): R1213 - R1218. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ehmke Mouse gene targeting in cardiovascular physiology Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2003; 284(1): R28 - R30. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |