AJP - Regu Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 283: R638-R646, 2002; doi:10.1152/ajpregu.00150.2002
0363-6119/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (24)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheng, H.-F.
Right arrow Articles by Harris, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, H.-F.
Right arrow Articles by Harris, R. C.
Vol. 283, Issue 3, R638-R646, September 2002

Prostaglandins that increase renin production in response to ACE inhibition are not derived from cyclooxygenase-1

Hui-Fang Cheng1, Sue-Wan Wang1, Ming-Zhi Zhang2, James A. McKanna2, Richard Breyer1, and Raymond C. Harris1

George M. O'Brien Kidney Disease Center, Division of Nephrology, Departments of 1 Medicine and 2 Cell Biology, Vanderbilt University School of Medicine, Nashville, Tennessee 37232


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

It is well known that nonselective, nonsteroidal anti-inflammatory drugs inhibit renal renin production. Our previous studies indicated that angiotensin-converting enzyme inhibitor (ACEI)-mediated renin increases were absent in rats treated with a cyclooxygenase (COX)-2-selective inhibitor and in COX-2 -/- mice. The current study examined further whether COX-1 is also involved in mediating ACEI-induced renin production. Because renin increases are mediated by cAMP, we also examined whether increased renin is mediated by the prostaglandin E2 receptor EP2 subtype, which is coupled to Gs and increases cAMP. Therefore, we investigated if genetic deletion of COX-1 or EP2 prevents increased ACEI-induced renin expression. Age- and gender-matched wild-type (+/+) and homozygous null mice (-/-) were administered captopril for 7 days, and plasma and renal renin levels and renal renin mRNA expression were measured. There were no significant differences in the basal level of renal renin activity from plasma or renal tissue in COX-1 +/+ and -/- mice. Captopril administration increased renin equally [plasma renin activity (PRA): +/+ 9.3 ± 2.2 vs. 50.1 ± 10.9; -/- 13.7 ± 1.5 vs. 43.9 ± 6.6 ng ANG I · ml-1 · h-1; renal renin concentration: +/+ 11.8 ± 1.7 vs. 35.3 ± 3.9; -/- 13.0 ± 3.0 vs. 27.8 ± 2.7 ng ANG I · mg protein-1 · h-1; n = 6; P < 0.05 with or without captopril]. ACEI also increased renin mRNA expression (+/+ 2.4 ± 0.2; -/- 2.1 ± 0.2 fold control; n = 6-10; P < 0.05). Captopril led to similar increases in EP2 -/- compared with +/+. The COX-2 inhibitor SC-58236 blocked ACEI-induced elevation in renal renin concentration in EP2 null mice (+/+ 24.7 ± 1.7 vs. 9.8 ± 0.4; -/- 21.1 ± 3.2 vs. 9.3 ± 0.4 ng ANG I · mg protein-1 · h-1; n = 5) as well as in COX-1 -/- mice (SC-58236-treated PRA: +/+ 7.3 ± 0.6; -/- 8.0 ± 0.9 ng ANG I · ml-1 · h-1; renal renin: +/+ 9.1 ± 0.9; -/- 9.6 ± 0.5 ng ANG I · mg protein-1 · h-1; n = 6-7; P < 0.05 compared with no treatment). Immunohistochemical analysis of renin expression confirmed the above results. This study provides definitive evidence that metabolites of COX-2 rather than COX-1 mediate ACEI-induced renin increases. The persistent response in EP2 nulls suggests involvement of prostaglandin E2 receptor subtype 4 and/or prostacyclin receptor (IP).

angiotensin-converting enzyme inhibitor; cyclooxygenase-2 -/-; prostaglandin E2 receptor subtype 2


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

IN THE KIDNEY, prostaglandins (PGs) are important mediators of vascular tone and salt and water homeostasis and are involved in the mediation and/or modulation of hormonal action (37). PGs arise from enzymatic metabolism of free arachidonic acid by cyclooxygenase (COX), the enzyme responsible for the initial rate-limiting metabolism of arachidonic acid to PGG2 and subsequently to PGH2, followed by further metabolism by specific synthetases. Two isoforms of COX have been identified, COX-1 and COX-2. COX-1 is expressed constitutively in the kidney and is localized predominantly in mesangial cells, arteriolar endothelial cells, parietal epithelial cells of Bowman's capsule, and cortical and medullary collecting ducts (21, 44). It has been determined that COX-1 is not primarily responsible for the increased prostanoid production in inflammatory states nor is it glucocorticoid sensitive (35). In the kidney, COX-2, the "inducible" COX, is localized in macula densa cells and surrounding cortical thick ascending limb (cTAL) cells and in a subset of medullary interstitial cells near the papillary tip in normal adult kidney (21, 44). Macula densa/cTAL expression increases in high renin states, such as dietary salt depletion (21, 25), angiotensin-converting enzyme (ACE) inhibitor treatment (11, 50), diuretic administration (34), or experimental renovascular hypertension (22, 48).

Prostanoids act locally via specific transmembrane G protein-coupled receptors. In the kidney cortex, PGE2 is the major PG produced (7). Four EP receptor subtypes have been cloned (3, 31). EP1 and EP3 receptor mRNA expression are detected in the collecting duct and thick limb, respectively (17, 45), whereas the EP4 receptor is widely expressed compared with other EP receptors, with the highest concentrations in the glomerulus (6, 8). The human EP2 receptor subtype protein was detectable only in the media of arteries and arterioles. Although the EP2 receptor exhibits a low level expression in the kidney, recent studies demonstrated that the EP2 receptor may be a mediator of arterial dilatation and salt-sensitive hypertension (30).

In previous studies, we determined that administration of a selective COX-2 inhibitor prevented increases in ACE inhibitor (ACEI)-mediated renin release (12). We also found that ACEI failed to increase renin in mice with genetic deletion of COX-2. Others also determined that COX-2 inhibition blunted renin expression in response to dietary sodium deprivation (19, 20, 28, 51). However, this issue remains controversial because other groups do not report changes in renin expression in response to COX-2 inhibitors (23, 29, 34, 40). To further investigate the role of COX metabolites in regulation of renin expression and release, the current studies used mice with genetic deletion of the COX-1 gene to investigate whether COX-1 is involved in mediation of ACEI-induced renin release. We also studied the potential role of the EP2 receptor in mediation of renin release.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Animals and genotyping. Mice with genetic deletion of the COX-1 gene (COX-1 -/-) and maintained on a mixed B6/129 background were a generous gift from Robert Langenbach (33). Mice were genotyped by PCR. The employed primer pairs were IMR013 (CTTGGGTGGAGAGGCTATTC) and IMR014 (AGGTGAGATGACAGGAGATC), and the specific mouse COX-1 primers were (GAGAAGGAGATGGCTGCTGAGTTG) and (AGGTGAGATGACAGGAGATC). PCR was performed for 35 cycles at 95°C for 30 s, 62°C for 45 s, and 72°C for 90 s, followed by a 10-min extension at 72°C. Because the neocassette replaced a portion of the 5' exon 11 and surrounding introns, the neoprimers 0IMR13 and 0IMR14 amplified a 280-bp product in homozygous or heterozygous mice, whereas the specific COX-1 primers generated a 1,016-bp product from the wild-type and heterozygous mice (Fig. 1A). The EP2 receptor-deleted mice were maintained on a BALB/c background as previously described (30). Mice were genotyped by Southern hybridization with a specific 3' probe. For Southern analysis, DNA samples were digested with XbaI, electrophoresed in agarose gels, and transferred to nylon transfer membranes. The blots were hybridized as described (12). Wild-type (+/+), heterozygous (+/-), and homozygous (-/-) knockout offspring are indicated in Fig. 1B.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 1.   Genotyping of cyclooxygenase (COX)-1 and EP2 receptor -/- mice. A: PCR screen for COX-1 -/- mice. Genomic DNA was amplified as described in MATERIALS AND METHODS. PCR was performed for 35 cycles at 95°C for 30 s, 62°C for 45 s, and 72°C for 90 s, followed by a 10-min extension at 72°C. Because the neocassette replaced some of the 5' exon 11 and surrounding introns, the neo primers 0IMR13 and 0IMR14 amplified a 280-bp product in homozygous or heterozygous mice, whereas the specific COX-1 primers generated a 1,016-bp product from the wild-type and heterozygous mice. B: Southern blotting for EP2 receptor -/- mice. DNA samples were digested with XbaI and then hybridized with 3' probe. A 7.3-kb band was recognized in wild-type (+/+) mice, whereas a 4.5-kb band was recognized in -/- mice.

Age-matched male adult (6-8 wk) COX-1 +/+, +/-, and -/- and EP2 +/+ and -/- mice were divided into three groups: 1) control with vehicle only, 2) administration of 400 mg/l captopril in drinking water, and 3) captopril combined with the COX-2-selective inhibitor SC-58236 (10 mg/l) in drinking water for 7 days (11), calculated to provide a dosage of 3-5 mg · kg-1 · day-1. SC-58236 was dissolved in vehicle [final concentration: 0.01% Tween 20 and 0.2% PGE-200 (29)], and all animals received equal amounts of vehicle in their drinking water.

RNA extraction and Northern blotting. Kidney RNA was extracted by the acid guanidium thiocyanate-phenol chloroform method (11). RNA samples were electrophoresed in denatured agarose gel, transferred to nitrocellulose membranes, and hybridized with a 1.4-kb 32P-labeled cDNA fragment of rat renin (48). The membranes were then stripped and rehybridized with glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Immunohistochemistry. Under deep anesthesia with Nembutal (70 mg/kg ip), mice were perfused in situ with saline containing 0.02% sodium nitrite and heparin (10 U/ml) and fixed by perfusion for renin immunohistochemistry with 3.7% formaldehyde, 1.4% lysine, 0.01 M sodium metaperiodate, 0.04 M sodium phosphate, and 1% acetic acid. The kidneys were then dehydrated with a graded series of ethanols and embedded in paraffin. Sections (4-µm thick) were mounted on glass slides and immunostained with polyclonal rabbit anti-renin antiserum (1:6,000 dilution), a generous gift from Prof. T. Inagami, Vanderbilt University. Vectastain ABC-Elite (Vector, Burlingame, CA) was used to localize the primary antibody with a chromogen of oxidized diaminobenzidine, followed by a light counterstain with toluidine blue.

Renin activity. Animals were killed by inhalation anesthesia with isoflurane (Baxter Pharmaceutical Products, Deerfield, IL). Blood was collected in EDTA (1 mg/ml blood) on ice at the time of death. The plasma was separated and frozen at -20°C until assay. For measurement of renal tissue renin concentration, the kidneys were homogenized in 0.1 M Tris · HCl, pH 7.4, containing (in mM) 3.4 8-hydroxyquinolone sulfate, 0.25 EDTA, 0.1 phenylmethysulfonyl fluoride, 1.6 dimercaprol, 5 sodium tetrathionate, and 0.1% Triton X-100. The concentration of protein was determined with a bicinchoninic acid protein assay kit (Pierce, Rockford, IL). After centrifugation of the homogenates, the supernatant was incubated for 1 h with excess exogenous renin substrate (plasma obtained from mice nephrectomized 48 h before collection). Renin was analyzed by radioimmunoassay with an 125I-ANG I kit (New England Nuclear).

Statistical analysis. All values are presented as means ± SE. ANOVA and Bonferroni t-tests were used for statistical analysis, and differences were considered significant when P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Plasma renin activity (PRA) was measured at the time of death (±7 days of captopril treatment). Captopril significantly increased PRA in COX-1 +/+ (9.3 ± 2.2 vs. 50.1 ± 10.9 ng ANG I · ml-1 · h-1), +/- (6.6 ± 1.4 to 37.2 ± 2.1 ng ANG I · ml-1 · h-1), and -/- (13.7 ± 1.5 vs. 43.9 ± 6.6 ng ANG I · ml-1 · h-1) mice (n = 6; P < 0.05 for all groups comparing with and without captopril administration; Fig. 2A). The COX-2-specific inhibitor SC-58236 did not alter basal cortical COX-2 mRNA expression in control wild-type mice (Fig. 2B). However, addition of SC-58236 to the ACEI-treated animals led to comparable inhibition of the increases in PRA in all three groups (+/+: 7.3 ± 0.6, +/-: 7.2 ± 1.2, -/-: 8.0 ± 0.9 ng ANG I · ml-1 · h-1; Fig. 2A).


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2.   COX-1 knockout mice. A: plasma renin activity (PRA) in response to captopril treatment. Animals were administered captopril (400 mg/l) in drinking water for 7 days (n = 6; ** P < 0.01). B: similar expression of COX-2 mRNA in renal cortex of wild-type B/6/129 mice with or without 7-day treatment with the COX-2 inhibitor SC-58236. Lanes 1 and 3: control; lanes 2 and 4: SC-58236. C: effect of the captopril on renal renin mRNA expression. Animals were treated as described in A. Renin mRNA was detected by Northern blotting and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression. Inset: representative experiment. Lanes 1, 4, and 7: without captopril treatment; lanes 2, 5, and 8: with captopril treatment; lanes 3, 6, and 9: with combined captopril and SC-58236 treatment. +/+: Lanes 1-3; +/-: lanes 4-6; -/-: lanes 7-9 (n = 6; ** P < 0.01). D: renal renin concentration (RRC) in response to captopril treatment. Animals were treated as described in A. Renal renin activity was determined as described in MATERIALS AND METHODS (n = 6; ** P < 0.01).

Renal renin mRNA was normalized with GAPDH and expressed as fold of control (+/+ mice without treatment). In studies investigating COX-1 knockouts, there were no significant differences in the basal level of renin mRNA among the three genotypes (1.00 ± 0.03 fold of control in +/- and 1.00 ± 0.06 fold of control in -/- mice, respectively; n = 6; not significant). Captopril treatment increased renin mRNA significantly in all of the three genotypes (2.4 ± 0.2 fold of control in +/+, 2.4 ± 0.2 fold of control in +/-, and 2.1 ± 0.2 fold of control in -/-; n = 9; P < 0.01), and no significant differences were found among the groups (Fig. 2C). SC-58236 prevented increases in renal renin mRNA expression in all three groups (1.2 ± 0.1 fold of control in +/+, 1.2 ± 0.2 fold of control in +/-, and 1.2 ± 0.2 fold of control in -/-; n = 5; P < 0.01; Fig. 2C).

Renal renin concentration (RRC) was also significantly elevated by the administration of captopril (+/+: 11.8 ± 1.7 to 35.3 ± 3.9, +/-: 7.6 ± 0.9 to 27.6 ± 3.2, and -/- 13.0 ± 3.1 vs. 27.8 ± 2.7 ng ANG I · mg protein-1 · h-1; n = 6; P < 0.05 with or without captopril). There were no significant differences in either PRA or RRC among the three phenotypes (Fig. 2C). SC-58236 prevented increases in RRC (+/+: 9.1 ± 0.9, +/-: 8.7 ± 0.6, and -/-: 9.6 ± 0.5 ng ANG I · mg protein-1 · h-1; Fig. 2C).

Immunoreactive (ir) renin was localized to the juxtaglomerular (JG) cells in all three groups of mice (Fig. 3). In agreement with the above results, captopril administration increased ir-renin expression (Fig. 3, B, E, and H) and SC-58236 equally blunted ACEI-induced increases in renin expression in wild-type heterozygotes and COX-1 knockout mice (Fig. 3, C, F, and I).


View larger version (178K):
[in this window]
[in a new window]
 
Fig. 3.   Immunoreactive renin expression in the kidney of COX-1 -/- mice. A, B, C: +/+ without (A), with (B) captopril, or with both captopril and SC-58236 treatment (C). D, E, F: +/- without (D), with (E) captopril, or with the combined captopril and SC-58236 treatment (F). G, H, I: -/- without (G), with (H) captopril, or with both (I). Arrows in B, E, and H indicate afferent arteriole proximal to juxtaglomerular region, with evidence of renin upregulation in all 3 genotypes. SC-58236 reversed the elevated renin expression (image width = 700 µm).

Determination of renin expression was also performed in EP2 +/+ and -/- mice. Captopril led to similar increases of PRA in EP2 +/+ and EP2 -/- (14.8 ± 1.4 to 39.0 ± 6.7 ng ANG I · ml-1 · h-1; n = 5; P < 0.05 vs. 13.9 ± 2.9 to 38.3 ± 7.5 ng ANG I · ml-1 · h-1; n = 5; P < 0.05). The COX-2 inhibitor SC-58236 blocked ACEI-induced elevations in PRA in EP2 -/- mice (+/+: 13.1 ± 2.9 ng ANG I · ml-1 · h-1; -/-: 13.5 ± 2.5 ng ANG I · ml-1 · h-1; n = 5; P < 0.05; Fig. 4A). Renal renin mRNA levels were also upregulated to the same extent in both groups by the administration of captopril (+/+: 2.6 ± 0.3 fold control; -/-: 2.7 ± 0.6 fold control; n = 4; P < 0.05 with or without captopril), and this increase was prevented by the addition of SC-58236 (+/+: 1.1 ± 0.1 fold control; -/-: 1.3 ± 0.3 fold control; n = 4; P < 0.05; Fig. 4B). Figure 4C indicates the results of RRC (basal level/captopril/additional SC-58236 in +/+: 11.0 ± 0.8/24.7 ± 1.7/9.8 ± 0.4 ng ANG I · mg protein-1 · h-1; -/-: 9.8 ± 0.7/21.1 ± 3.2/9.3 ± 0.4 ng ANG I · mg protein-1 · h-1; n = 5; P < 0.05, captopril group compared with control or additional SC-58236-treated group). Correspondingly, immunohistochemistry indicated that captopril administration led to comparable increases in renin expression in JG cells of wild-type and EP-2 knockout mice (Fig. 5, B and E), and SC-58236 blunted this increase in both groups (Fig. 5, C and F).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4.   EP2 receptor -/- mice. A: PRA in response to captopril treatment. Animals were treated as described in Fig. 2 (n = 5; ** P < 0.01). B: effect of the captopril on renal renin mRNA expression. Renin mRNA was detected by Northern blotting and normalized to GAPDH mRNA expression (n = 4; * P < 0.05). Inset: representative experiment. Lane 1: +/+ without captopril treatment; lane 2: +/+ with captopril treatment; lane 3: +/+ with combined captopril and SC-58236 treatment; lane 4: -/- without captopril; lane 5: -/- with combined captopril and SC-58236 treatment; and lane 6: -/- with captopril. C: RRC in response to captopril treatment. Animals were treated as described in Fig. 2A. Renal renin activity was determined as described in MATERIALS AND METHODS (n = 5; ** P < 0.01).



View larger version (174K):
[in this window]
[in a new window]
 
Fig. 5.   Immunoreactive renin expression in the kidney of EP2 receptor -/- mice. A, B, C: +/+ without (A), with (B) captopril, or with both captopril and SC-58236 treatment (C). D, E, F: -/- without (D), with (E) captopril, or with both (F). Arrows in B and E indicate afferent arteriole proximal to juxtaglomerular region, with evidence of renin upregulation in both wild-type and null mice (image width = 700 µm).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In the adult mammalian kidney, renin is synthesized by the JG cells, a group of myoepithelioid cells located in the afferent arteriole at the entrance to the glomerulus. The macula densa, a specialized segment of thick ascending loop of Henle located between the afferent and efferent arterioles, participates in regulation of JG renin secretion as well as tubuloglomerular feedback. Previous studies using nonselective COX inhibitors demonstrated a role for macula densa/cTAL-derived prostanoids in regulation of renin secretion and expression (16, 26, 41, 42, 47).

Administration of either ACEIs or AT1-receptor antagonists results in increases in both renin mRNA and ir protein in the kidney in the absence of any detectable alteration in intravascular volume or renal hemodynamics (9, 15, 18). In previous studies, we determined that administration of an ACEI or an AT1-receptor blocker led to significant increases in macula densa/cTAL COX-2 expression (11, 12). Furthermore, in rats treated with ACEIs, elevations in plasma and kidney renin were significantly inhibited by simultaneous treatment with a selective COX-2 inhibitor (11). In additional studies, we found that increases in renal renin expression in response to ACEI were significantly blunted in COX-2 knockout mice.

Studies in mice on sodium-deficient diets also indicated that the COX-2-selective inhibitor NS-398 would prevent renal renin expression (20); similar findings were observed in COX-2 -/- mice (51). Similarly, in humans on a sodium-deficient diet, PRA was significantly blunted by addition of the COX-2 inhibitor rofecoxib (28).

However, in contrast to the above studies, other investigators reported that treatment with COX-2-selective inhibitors did not affect renal renin expression and/or secretion. Harding et al. (19) reported that in rats, NS-398 decreased low salt-induced PRA but did not affect renal renin content. Kammerl et al. (29) also reported that rofecoxib decreased PRA induced by low salt but not low salt plus an ACEI, and COX-2 inhibition did not alter renal renin content in any condition. This same group of Kurtz and co-workers (23) also reported that celecoxib did not affect increased renal renin mRNA levels induced by the AT1-receptor antagonist candesartan. Furthermore, in isolated perfused kidneys, they reported that NS-398 blocked increased renin secretion induced by bumetanide but not low-salt or ACE inhibition (10).

These divergent findings with COX-2 inhibitors coupled with previous reports by Kurtz and co-workers demonstrating that the nonselective, nonsteroidal anti-inflammatory drug indomethacin blunted increases in renal renin expression by either bumetanide or ACEIs (41, 43) raised the question of whether COX-1-derived prostanoids might be involved in regulation of renin. SC-58236 is a highly selective COX-2 inhibitor (39), but we could not absolutely rule out the possibility that there was also some inhibition of renal COX-1 in our previous studies. Furthermore, because COX-2 knockout mice have known renal developmental abnormalities (13, 32, 36), we could not completely rule out the possibility that the observed failure to increase renin production in response to ACEI was due to structural or functional abnormalities not directly related to the absence of COX-2 expression in macula densa/cTAL. To test definitively a potential role for COX-1 in ACEI-mediated increases in renin, we used mice with genetic deletion of the COX-1 gene. The fact that captopril increased plasma renin and renal renin mRNA and activity levels to the same extent in the COX-1 knockout and wild-type mice and the increased renin expression was effectively blocked by the selective COX-2 inhibitor demonstrates unequivocally that ACEI-mediated increases in renin expression are mediated by prostanoids derived from COX-2 rather than COX-1.

In agreement with the current results, Traynor et al. (46) found that in the isolated perfused glomerular preparation, the presence of the COX-2-selective inhibitor NS-398 but not the COX-1-selective inhibitor valerylsalicylate inhibited macula densa-mediated stimulation of renin secretion in response to a reduction in tubular perfusate NaCl concentrations. Furthermore, Athirakul et al. (1) also recently reported that renin expression was increased in COX-1 -/- mice in response to a sodium-deficient diet.

Although we previously noted that SC-58236 decreased cortical COX-2 expression in models of renovascular hypertension (48) and renal ablation (49), administration of this long-acting COX-2 inhibitor for 7 days to normal mice did not measurably affect basal renal cortical COX-2 mRNA expression. This suggests that the observed effects on COX-2 expression in the pathophysiological conditions may have been indirect, i.e., secondary to alteration of systemic or intrarenal stimuli for increased cortical COX-2 expression. However, further studies will be required to assess this hypothesis.

PGE2 and PGI2 are well-described mediators of renal renin expression and secretion (14, 24, 27). PG-mediated stimulation of JG renin expression and secretion has been shown to be due to activation of adenylate cyclase and an increase in intracellular cAMP (2, 27). PGE2 and PGI2 are both able to stimulate renin release (27). Of the four EP receptor subtypes, both EP2 and EP4 have been shown to be coupled to Gs and to stimulate adenylate cyclase activity (3, 31). Because the EP2 receptor regulates vascular reactivity, we tested whether this receptor subtype might be involved in ACEI-mediated increases in renin release. However, our studies indicate that regulation of renin production and release was not altered in the EP2 knockout mice, indicating that this EP subtype is not involved in this process. EP4 mRNA is expressed in the glomerulus and collecting duct and may regulate glomerular tone (4, 5, 8). The current studies suggest that EP4 may also be involved in regulation of renal renin release. In this regard, EP4 transcripts in glomeruli were increased twofold by salt deprivation (26). In situ hybridization detected IP receptor mRNA in the interlobular arteries and glomerular arterioles but not in the JG cells, which suggests that the action of prostacyclin on renin release may be indirect (38). Confirmation of the effect of EP4 receptor and IP receptor on regulation of JG cell renin production and release await further studies.

In conclusion, the current study provides definitive evidence that metabolites of COX-2 rather than COX-1 can mediate or modulate ACEI-induced renin production and release. The fact that EP2 null mice also demonstrated no alterations in ACEI-induced renin production and release suggests involvement of EP4 and/or IP.


    ACKNOWLEDGEMENTS

This work was supported by the Vanderbilt George O'Brien Kidney Diseases Center [National Institutes of Health (NIH) Grant DK-39261], NIH Grants DK-46205 and GM-15431, and by funds from the Department of Veterans Affairs.


    FOOTNOTES

Address for reprint requests and other correspondence: R. C. Harris, Division of Nephrology, S 3223 MCN, Vanderbilt Univ. School of Medicine, Nashville, TN 37232 (E-mail: ray.harris{at}vanderbilt.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajpregu.00150.2002

Received 6 March 2002; accepted in final form 17 May 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Athirakul, K, Kim HS, Audoly LP, Smithies O, and Coffman TM. Deficiency of COX-1 causes natriuresis and enhanced sensitivity to ACE inhibition. Kidney Int 60: 2324-2329, 2001[ISI][Medline].

2.   Bader, M, and Ganten D. Regulation of renin: new evidence from cultured cells and genetically modified mice. J Mol Med 78: 130-139, 2000[ISI][Medline].

3.   Boie, Y, Stocco R, Sawyer N, Slipetz DM, Ungrin MD, Neuschafer-Rube F, Puschel GP, Metters KM, and Abramovitz M. Molecular cloning and characterization of the four rat prostaglandin E2 prostanoid receptor subtypes. Eur J Pharmacol 340: 227-241, 1997[ISI][Medline].

4.   Breyer, MD, and Breyer RM. Prostaglandin E receptors and the kidney. Am J Physiol Renal Physiol 279: F12-F23, 2000[Abstract/Free Full Text].

5.   Breyer, MD, and Breyer RM. Prostaglandin receptors: their role in regulating renal function. Curr Opin Nephrol Hypertens 9: 23-29, 2000[ISI][Medline].

6.   Breyer, MD, Davis L, Jacobson HR, and Breyer RM. Differential localization of prostaglandin E receptor subtypes in human kidney. Am J Physiol Renal Fluid Electrolyte Physiol 270: F912-F918, 1996[Abstract/Free Full Text].

7.   Breyer, MD, Jacobson HR, and Breyer RM. Functional and molecular aspects of renal prostaglandin receptors. J Am Soc Nephrol 7: 8-17, 1996[Abstract].

8.   Breyer, RM, Davis LS, Nian C, Redha R, Stillman B, Jacobson HR, and Breyer MD. Cloning and expression of the rabbit prostaglandin EP4 receptor. Am J Physiol Renal Fluid Electrolyte Physiol 270: F485-F493, 1996[Abstract/Free Full Text].

9.   Campbell, DJ, Lawrence AC, Towrie A, Kladis A, and Valentijn AJ. Differential regulation of angiotensin peptide levels in plasma and kidney of the rat. Hypertension 18: 763-773, 1991[Abstract/Free Full Text].

10.   Castrop, H, Schweda F, Schumacher K, Wolf K, and Kurtz A. Role of renocortical cyclooxygenase-2 for renal vascular resistance and macula densa control of renin secretion. J Am Soc Nephrol 12: 867-874, 2001[Abstract/Free Full Text].

11.   Cheng, HF, Wang JL, Zhang MZ, Miyazaki Y, Ichikawa I, McKanna JA, and Harris RC. Angiotensin II attenuates renal cortical cyclooxygenase-2 expression. J Clin Invest 103: 953-961, 1999[ISI][Medline].

12.   Cheng, HF, Wang JL, Zhang MZ, Wang SW, McKanna JA, and Harris RC. Genetic deletion of COX-2 prevents increased renin expression in response to ACE inhibition. Am J Physiol Renal Physiol 280: F449-F456, 2001[Abstract/Free Full Text].

13.   Dinchuk, JE, Car BD, Focht RJ, Johnston JJ, Jaffee BD, Covington MB, Contel NR, Eng VM, Collins RJ, Czerniak PM, Gorry SA, and Trzaskos JM. Renal abnormalities and an altered inflammatory response in mice lacking cyclooxygenase II. Nature 378: 406-409, 1995[Medline].

14.   Francisco, LJ, Osborn JL, and DiBona GF. Prostaglandin in renin release during sodium deprivation. Am J Physiol Renal Fluid Electrolyte Physiol 243: F537-F542, 1982[Abstract/Free Full Text].

15.   Gomez, RA, Chevalier RL, Everett AD, Elwood JP, Peach MJ, Lynch KR, and Carey RM. Recruitment of renin gene-expressing cells in adult rat kidneys. Am J Physiol Renal Fluid Electrolyte Physiol 259: F660-F665, 1990[Abstract/Free Full Text].

16.   Greenberg, SG, Lorenz JN, He XR, Schnermann JB, and Briggs JP. Effect of prostaglandin synthesis inhibition on macula densa-stimulated renin secretion. Am J Physiol Renal Fluid Electrolyte Physiol 265: F578-F583, 1993[Abstract/Free Full Text].

17.   Guan, Y, Zhang Y, Breyer RM, Fowler B, Davis L, Hebert RL, and Breyer MD. Prostaglandin E2 inhibits renal collecting duct Na+ absorption by activating the EP1 receptor. J Clin Invest 102: 194-201, 1998[ISI][Medline].

18.   Hackenthal, E, Paul M, Ganten D, and Taugner R. Morphology, physiology, and molecular biology of renin secretion. Physiol Rev 70: 1067-1116, 1990[Free Full Text].

19.   Harding, P, Carretero OA, and Beierwaltes WH. Chronic cyclooxygenase-2 inhibition blunts low sodium-stimulated renin without changing renal haemodynamics. J Hypertens 18: 1107-1113, 2000[ISI][Medline].

20.   Harding, P, Sigmon DH, Alfie ME, Huang PL, Fishman MC, Beierwaltes WH, and Carretero OA. Cyclooxygenase-2 mediates increased renal renin content induced by low-sodium diet. Hypertension 29: 297-302, 1997[Abstract/Free Full Text].

21.   Harris, RC, McKanna JA, Akai Y, Jacobson HR, Dubois RN, and Breyer MD. Cyclooxygenase-2 is associated with the macula densa of rat kidney and increases with salt restriction. J Clin Invest 94: 2504-2510, 1994[ISI][Medline].

22.   Hartner, A, Goppelt-Struebe M, and Hilgers KF. Coordinate expression of cyclooxygenase-2 and renin in the rat kidney in renovascular hypertension. Hypertension 31: 201-205, 1998[Abstract/Free Full Text].

23.   Hocherl, K, Wolf K, Castrop H, Ittner KP, Bucher M, Kees F, Grobecker HF, and Kurtz A. Renocortical expression of renin and of cyclooxygenase-2 in response to angiotensin II AT1 receptor blockade is closely coordinated but not causally linked. Pflügers Arch 442: 821-827, 2001[ISI][Medline].

24.   Ito, S, Carretero OA, Abe K, Beierwaltes WH, and Yoshinaga K. Effect of prostanoids on renin release from rabbit afferent arterioles with and without macula densa. Kidney Int 35: 1138-1144, 1989[ISI][Medline].

25.   Jensen, BL, and Kurtz A. Differential regulation of renal cyclooxygenase mRNA by dietary salt intake. Kidney Int 52: 1242-1249, 1997[ISI][Medline].

26.   Jensen, BL, Mann B, Skott O, and Kurtz A. Differential regulation of renal prostaglandin receptor mRNAs by dietary salt intake in the rat. Kidney Int 56: 528-537, 1999[ISI][Medline].

27.   Jensen, BL, Schmid C, and Kurtz A. Prostaglandins stimulate renin secretion and renin mRNA in mouse renal juxtaglomerular cells. Am J Physiol Renal Fluid Electrolyte Physiol 271: F659-F669, 1996[Abstract/Free Full Text].

28.   Kammerl, MC, Nusing RM, Schweda F, Endemann D, Stubanus M, Kees F, Lackner KJ, Fischereder M, and Kramer BK. Low sodium and furosemide-induced stimulation of the renin system in man is mediated by cyclooxygenase 2. Clin Pharmacol Ther 70: 468-474, 2001[ISI][Medline].

29.   Kammerl, MC, Nusing RM, Seyberth HW, Riegger GA, Kurtz A, and Kramer BK. Inhibition of cyclooxygenase-2 attenuates urinary prostanoid excretion without affecting renal renin expression. Pflügers Arch 442: 842-847, 2001[ISI][Medline].

30.   Kennedy, CR, Zhang Y, Brandon S, Guan Y, Coffee K, Funk CD, Magnuson MA, Oates JA, Breyer MD, and Breyer RM. Salt-sensitive hypertension and reduced fertility in mice lacking the prostaglandin EP2 receptor. Nat Med 5: 217-220, 1999[ISI][Medline].

31.   Kiriyama, M, Ushikubi F, Kobayashi T, Hirata M, Sugimoto Y, and Narumiya S. Ligand binding specificities of the eight types and subtypes of the mouse prostanoid receptors expressed in Chinese hamster ovary cells. Br J Pharmacol 122: 217-224, 1997[ISI][Medline].

32.   Komhoff, M, Wang JL, Cheng HF, Langenbach R, McKanna JA, Harris RC, and Breyer MD. Cyclooxygenase-2-selective inhibitors impair glomerulogenesis and renal cortical development. Kidney Int 57: 414-422, 2000[ISI][Medline].

33.   Langenbach, R, Morham SG, Tiano HF, Loftin CD, Ghanayem BI, Chulada PC, Mahler JF, Lee CA, Goulding EH, Kluckman KD, Kim HS, and Smithies O. Prostaglandin synthase 1 gene disruption in mice reduces arachidonic acid-induced inflammation and indomethacin-induced gastric ulceration. Cell 83: 483-492, 1995[ISI][Medline].

34.   Mann, B, Hartner A, Jensen BL, Kammerl M, Kramer BK, and Kurtz A. Furosemide stimulates macula densa cyclooxygenase-2 expression in rats. Kidney Int 59: 62-68, 2001[ISI][Medline].

35.   Masferrer, JL, Zweifel BS, Seibert K, and Needleman P. Selective regulation of cellular cyclooxygenase by dexamethasone and endotoxin in mice. J Clin Invest 86: 1375-1379, 1990[ISI][Medline].

36.   Morham, SG, Langenbach R, Loftin CD, Tiano HF, Vouloumanos N, Jennette JC, Mahler JF, Kluckman KD, Ledford A, Lee CA, and Smithies O. Prostaglandin synthase 2 gene disruption causes severe renal pathology in the mouse. Cell 83: 473-482, 1995[ISI][Medline].

37.   Oates, JA, FitzGerald GA, Branch RA, Jackson EK, Knapp HR, and Roberts LJ II. Clinical implications of prostaglandin and thromboxane A2 formation (1). N Engl J Med 319: 689-698, 1988[ISI][Medline].

38.   Oida, H, Namba T, Sugimoto Y, Ushikubi F, Ohishi H, Ichikawa A, and Narumiya S. In situ hybridization studies of prostacyclin receptor mRNA expression in various mouse organs. Br J Pharmacol 116: 2828-2837, 1995[ISI][Medline].

39.   Penning, TD, Talley JJ, Bertenshaw SR, Carter JS, Collins PW, Docter S, Graneto MJ, Lee LF, Malecha JW, Miyashiro JM, Rogers RS, Rogier DJ, Yu SS, Anderson GD, Burton EG, Cogburn JN, Gregory SA, Koboldt CM, Perkins WE, Seibert K, Veenhuizen AW, Zhang YY, and Isakson PC. Synthesis and biological evaluation of the 1,5-diarylpyrazole class of cyclooxygenase-2 inhibitors: identification of 4-[5-(4-methylphenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl]benze nesulfonamide (SC-58635, celecoxib). J Med Chem 40: 1347-1365, 1997[ISI][Medline].

40.   Rodriguez, F, Llinas MT, Gonzalez JD, Rivera J, and Salazar FJ. Renal changes induced by a cyclooxygenase-2 inhibitor during normal and low sodium intake. Hypertension 36: 276-281, 2000[Abstract/Free Full Text].

41.   Schricker, K, Hamann M, and Kurtz A. Nitric oxide and prostaglandins are involved in the macula densa control of the renin system. Am J Physiol Renal Fluid Electrolyte Physiol 269: F825-F830, 1995[Abstract/Free Full Text].

42.   Schricker, K, Hamann M, and Kurtz A. Prostaglandins are involved in the stimulation of renin gene expression in 2 kidney-1 clip rats. Pflügers Arch 430: 188-194, 1994.

43.   Schricker, K, Hegyi I, Hamann M, Kaissling B, and Kurtz A. Tonic stimulation of renin gene expression by nitric oxide is counteracted by tonic inhibition through angiotensin II. Proc Natl Acad Sci USA 92: 8006-8010, 1995[Abstract/Free Full Text].

44.   Smith, WL, and Bell TG. Immunohistochemical localization of the prostaglandin-forming cyclooxygenase in renal cortex. Am J Physiol Renal Fluid Electrolyte Physiol 235: F451-F457, 1978[Abstract/Free Full Text].

45.   Sugimoto, Y, Namba T, Shigemoto R, Negishi M, Ichikawa A, and Narumiya S. Distinct cellular localization of mRNAs for three subtypes of prostaglandin E receptor in kidney. Am J Physiol Renal Fluid Electrolyte Physiol 266: F823-F828, 1994[Abstract/Free Full Text].

46.   Traynor, TR, Smart A, Briggs JP, and Schnermann J. Inhibition of macula densa-stimulated renin secretion by pharmacological blockade of cyclooxygenase-2. Am J Physiol Renal Physiol 277: F706-F710, 1999[Abstract/Free Full Text].

47.   Wagner, C, and Kurtz A. Regulation of renal renin release. Curr Opin Nephrol Hypertens 7: 437-441, 1998[ISI][Medline].

48.   Wang, JL, Cheng HF, and Harris RC. Cyclooxygenase-2 inhibition decreases renin content and lowers blood pressure in a model of renovascular hypertension. Hypertension 34: 96-101, 1999[Abstract/Free Full Text].

49.   Wang, JL, Cheng HF, Shepell S, and Harris RC. The cyclooxygenase-2 inhibitor, SC58326, decreases proteinuria and retards progression of glomerulosclerosis in the rat remnant. Kidney Int 57: 2334-2342, 2000[ISI][Medline].

50.   Wolf, K, Castrop H, Hartner A, Goppelt-Strube M, Hilgers KF, and Kurtz A. Inhibition of the renin-angiotensin system upregulates cyclooxygenase-2 expression in the macula densa. Hypertension 34: 503-507, 1999[Abstract/Free Full Text].

51.   Yang, T, Endo Y, Huang YG, Smart A, Briggs JP, and Schnermann J. Renin expression in COX-2-knockout mice on normal or low-salt diets. Am J Physiol Renal Physiol 279: F819-F825, 2000[Abstract/Free Full Text].


Am J Physiol Regul Integr Comp Physiol 283(3):R638-R646
0363-6119/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
W. J. Welch, K. Patel, P. Modlinger, M. Mendonca, N. Kawada, K. Dennehy, S. Aslam, and C. S. Wilcox
Roles of vasoconstrictor prostaglandins, COX-1 and -2, and AT1, AT2, and TP receptors in a rat model of early 2K,1C hypertension
Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H2644 - H2649.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
H. Cheng, S. Wang, Y.-I. Jo, C.-M. Hao, M. Zhang, X. Fan, C. Kennedy, M. D. Breyer, G. W. Moeckel, and R. C. Harris
Overexpression of Cyclooxygenase-2 Predisposes to Podocyte Injury
J. Am. Soc. Nephrol., February 1, 2007; 18(2): 551 - 559.
[Abstract] [Full Text] [PDF]


Home page
CJASNHome page
R. C. Harris and M. D. Breyer
Update on Cyclooxygenase-2 Inhibitors
Clin. J. Am. Soc. Nephrol., March 1, 2006; 1(2): 236 - 245.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
U. G. Friis, J. Stubbe, T. R. Uhrenholt, P. Svenningsen, R. M. Nusing, O. Skott, and B. L. Jensen
Prostaglandin E2 EP2 and EP4 receptor activation mediates cAMP-dependent hyperpolarization and exocytosis of renin in juxtaglomerular cells
Am J Physiol Renal Physiol, November 1, 2005; 289(5): F989 - F997.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. Kohlstedt, R. Busse, and I. Fleming
Signaling via the Angiotensin-Converting Enzyme Enhances the Expression of Cyclooxygenase-2 in Endothelial Cells
Hypertension, January 1, 2005; 45(1): 126 - 132.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
F. Schweda, J. Klar, S. Narumiya, R. M. Nusing, and A. Kurtz
Stimulation of renin release by prostaglandin E2 is mediated by EP2 and EP4 receptors in mouse kidneys
Am J Physiol Renal Physiol, September 1, 2004; 287(3): F427 - F433.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
H.-F. Cheng and R. C. Harris
Cyclooxygenases, the Kidney, and Hypertension
Hypertension, March 1, 2004; 43(3): 525 - 530.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
H. Scholz
Prostaglandins
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2003; 285(3): R512 - R514.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
P. B. Persson, A. Skalweit, R. Mrowka, and B.-J. Thiele
Control of renin synthesis
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2003; 285(3): R491 - R497.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
P. B. Persson
The kidney and hypertension
Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2003; 284(5): R1176 - R1178.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
H. M. Stauss
Interaction of prostaglandins with the renin-angiotensin system
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2003; 284(4): R1010 - R1011.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
R. Mrowka, K. Steinhage, A. Patzak, and P. B. Persson
An evolutionary approach for identifying potential transcription factor binding sites: the renin gene as an example
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2003; 284(4): R1147 - R1150.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal