AJP - Regu AJP: Lung Cellular and Molecular Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 284: R131-R139, 2003. First published October 3, 2002; doi:10.1152/ajpregu.00361.2002
0363-6119/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/1/R131    most recent
00361.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (37)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Obal, F.
Right arrow Articles by Krueger, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Obal, F., Jr.
Right arrow Articles by Krueger, J. M.
Vol. 284, Issue 1, R131-R139, January 2003

Sleep in mice with nonfunctional growth hormone-releasing hormone receptors

Ferenc Obal Jr.1,2, Jeremiah Alt2, Ping Taishi2, Janos Gardi3, and James M. Krueger2

1 Department of Physiology and 3 Endocrine Unit, University of Szeged, A. Szent-Györgyi Medical Center, 6720 Szeged, Hungary; and 2 Department of Veterinary and Comparative Anatomy, Pharmacology and Physiology, Washington State University, Pullman, Washington 99164-6520


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The role of the somatotropic axis in sleep regulation was studied by using the lit/lit mouse with nonfunctional growth hormone (GH)-releasing hormone (GHRH) receptors (GHRH-Rs) and control heterozygous C57BL/6J mice, which have a normal phenotype. During the light period, the lit/lit mice displayed significantly less spontaneous rapid eye movement sleep (REMS) and non-REMS (NREMS) than the controls. Intraperitoneal injection of GHRH (50 µg/kg) failed to promote sleep in the lit/lit mice, whereas it enhanced NREMS in the heterozygous mice. Subcutaneous infusion of GH replacement stimulated weight gain, increased the concentration of plasma insulin-like growth factor-1 (IGF-1), and normalized REMS, but failed to restore normal NREMS in the lit/lit mice. The NREMS response to a 4-h sleep deprivation was attenuated in the lit/lit mice. In control mice, intraperitoneal injection of ghrelin (400 µg/kg) elicited GH secretion and promoted NREMS, and intraperitoneal administration of the somatostatin analog octretotide (Oct, 200 µg/kg) inhibited sleep. In contrast, these responses were missing in the lit/lit mice. The results suggest that GH promotes REMS whereas GHRH stimulates NREMS via central GHRH-Rs and that GHRH is involved in the mediation of the sleep effects of ghrelin and somatostatin.

electroencephalogram; somatotropic axis


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

REGULATION OF SLEEP and the somatotropic axis are intimately related. Deep non-rapid eye movement sleep (NREMS) is associated with growth hormone (GH) secretion (reviewed in Ref. 53). The somatotropic axis hormones GH-releasing hormone (GHRH), GH, insulin-like growth factor-1 (IGF-1), and somatostatin are capable of modulating sleep. The sleep-promoting activity of GHRH is documented in rats and rabbits (11, 36) and humans (21, 28, 45). Independently from GHRH, GH may increase the intensity of NREMS (2) and the duration of rapid eye movement sleep (REMS) (10, 30, 46). IGF-1 may promote NREMS (39), and somatostatin may stimulate REMS (7). In addition, acute rises in somatostatin, GH, and IGF-1 can suppress sleep via negative feedback inhibition of GHRH (reviewed in Ref. 40). GHRH and the GHRH receptor (GHRH-R) genes are contained within the genomic regions implicated in homeostatic sleep regulation (12) and the sleep responses to viral influenza infection (52) in mice. Chronic hypoactivity of the somatotropic axis is associated with sleep alterations. Thus REMS and the time spent in deep NREMS may decrease although total sleep time may increase in humans with decreased GH production (reviewed in Ref. 2). Transgenic mice with GHRH deficiency (TH-hGH mice) have decreased NREMS (57). Spontaneous NREMS and REMS are lowered in the mutant dw/dw rat (37), which has a defect in GHRH-R signaling. In animals with decreased GHRH synthesis or a defect in GHRH-R signaling, however, the physiological stimulus of pituitary GH synthesis and release is absent, and concentrations of both GH and IGF-1 are low in the plasma, resulting in a dwarf phenotype. Therefore, the significance of the individual hormones in the sleep deficit is difficult to clearly determine.

The aim of the current experiments was to use the lit/lit mouse to study the role of GHRH in sleep regulation. The lit/lit mouse bears a point mutation in the GHRH-R gene, resulting in a loss of receptor function (15, 25), a model of genetic GHRH-R defects in humans (54). By using the lit/lit mouse, we report that chronic GH infusion normalizes REMS whereas the NREMS deficiency persists in the chronic hypofunction of the somatotropic axis, suggesting that these sleep alterations are linked to GH/IGF-1 and GHRH deficiencies, respectively. The lit/lit mice fail to exhibit sleep responses if given GHRH, the somatostatin analog octreotide (Oct), or ghrelin, a hormone acting on the GH-secretagogue (GHS) receptor (22), showing that these sleep responses are mediated via GHRH actions on GHRH-Rs.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animals. Heterozygous male C57BL/6 (C57BL/6J-Ghrhr-lit-/+) and homozygous male lit/lit mice (n = 56 each) were purchased from Jackson Laboratory, Bar Harbor, ME. The mice were between 3 and 4 mo of age at the time of the experiments. The heterozygous controls weighed 24.1 ± 0.69 g, and the lit/lit mice weighed 11.4 ± 0.31 g (47.2% of the body wt of the controls). The difference in body weight was significant between the two groups (Student's t-test, P < 0.0001). The animals were housed individually in Plexiglas cages placed in environmental chambers on a 12:12-h light-dark cycle, at 30°C ambient temperature. Food and water were continuously available.

Surgery. The mice were anesthetized with ketamine-xylazine (87 and 13 mg/kg, respectively). Stainless steel electrodes were placed on the top of the dura mater over the frontal and parietal lobes and the cerebellum. These electrodes were used to record the EEG. Two stainless steel wires were implanted into the dorsal neck muscles to record the electromyogram (EMG). The EEG and EMG electrodes were connected to a pedestal (0.4 g) implanted on the top of the skull. The surgeries were performed 7 days before recordings began.

Recording of sleep-wake activity. The mice were connected to light-weight recording cables and habituated to the experimental conditions during recovery. The cables were attached to commutators that were connected to amplifiers. The signals were digitized (128-Hz sampling rate) and collected by a computer and stored on compact discs. Power density spectra (0.25-40.0 Hz in 0.5-Hz bands) were calculated online for consecutive 10-s EEG epochs and stored with the EEG and EMG signals. For scoring, the EEG and EMG signals and the power density spectra were restored on the computer screen. The states of vigilance were determined for 10-s epochs by the usual criteria as NREMS (high-amplitude EEG slow waves and low-tone muscle activity), REMS (highly regular theta EEG activity and loss of muscle tone with occasional twitches), and wakefulness (EEG activities similar to, but often less regular and with lower amplitude than, those in REMS and high EMG activity). The percentage of the time spent in each state of vigilance for 1-h periods was determined. The power values for the 0.5- to 4.0-Hz (delta) frequency range were integrated. The mean of these integrated values were calculated for uninterrupted periods of artifact-free NREMS and used as an index of EEG slow-wave activity (SWA) during NREMS to characterize sleep intensity (depth of sleep) in each recording hour. When studying the peptide effects, sleep latency was also determined. Sleep latency was defined as the time before the first occurrence of 30-s continuous NREMS episode measured from the onset of the light period (after Oct administration) or dark period (after GHRH and ghrelin administration).

Experimental schedule. Starting at light onset, the mice (n = 26 heterozygous and n = 25 lit/lit mice) were recorded for 2 consecutive days to obtain baseline values of spontaneous sleep-wake activity. On the third experimental day in 13 of the control and 13 of the lit/lit mice, sleep deprivation (SD) started at light onset and lasted for 4 h. The EEG and EMG were recorded throughout SD and during the remaining 8 h of the light period and for 11 h during the subsequent dark cycle (collected data were backed up sometime during the last hour of the dark period and the records in this hour were discarded). SD was performed by gentle handling while the mice stayed in their home cage; whenever behavioral or EEG signs of sleep were observed, the mice were aroused by knocking on the cage or lightly touching them. It is assumed that stress is not a major factor determining the sleep response to SD, at least when SD is performed by gentle handling (18), although sleep loss itself may represent a stressor and may alter hypothalamo-pituitary-adrenal functions (29).

The mice that were used in the GH replacement experiment were subcutaneously implanted with osmotic minipumps (ALZET 1002, 0.25 µl/h for 14 days; Durect, Cupertino, CA) in the back (weight after loading: 0.5 g). The minipumps were filled with mouse GH (mGH) in physiological saline delivering 11 µg mGH/day in 4 lit/lit mice. Because animal GH preparations are highly purified extracts obtained from the pituitary gland, for infusing a larger GH dose, rat GH (rGH) was used because it was available in larger quantities. rGH exerts actions closely resembling, if not identical to, those of endogenous mGH in mice (3). Minipumps delivering 24 µg rGH/day were implanted in 8 lit/lit mice. This dose of GH was previously reported as biologically active when infused from minipumps in lit/lit mice (33). A group of heterozygous mice (n = 12) received osmotic pumps delivering physiological saline at the same rate as the GH delivery in the lit/lit mice. Spontaneous sleep-wake activity of the mice implanted with the minipumps was recorded on day 8 and/or day 9 of the infusion. The mGH and rGH preparations were for in vivo use, and they were gifts from Dr. A. F. Parlow of The National Hormone and Pituitary Program, National Institute of Diabetes and Digestive and Kidney Diseases (NHPP-NIDDK, Bethesda, MD).

GHRH and ghrelin were anticipated to promote sleep, and therefore the sleep response was studied during the active (dark) phase of the day when mice exhibit little spontaneous sleep. In contrast, Oct suppresses sleep (16), and thus Oct was injected before the rest cycle, i.e., the light period. GHRH and ghrelin (Bachem/Peninsula Laboratories, San Carlos, CA) were dissolved in physiological saline. The peptides (5 µg/kg GHRH, n = 14 heterozygous mice and n = 13 lit/lit mice; 400 µg/kg ghrelin, n = 11 heterozygous mice and n = 11 lit/lit mice) were intraperitoneally injected in a volume of 0.1 ml/10 g body wt. The injections were timed to 10 min before dark onset. Physiological saline was administered on the baseline day. The Oct (Sandostatin injection, Novartis Pharma, Basel, Switzerland) dose was 200 µg/kg in a volume of 0.1 ml/10 g body wt (n = 11 heterozygous mice and n = 12 lit/lit mice). Oct was intraperitoneally injected 10 min before the onset of the light period, and the mice stayed in light during this 10 min. For baseline injections, the vehicle of Oct containing lactate and mannitol was used; Novartis Pharma donated this solution. In the experiments with ghrelin and Oct, the mice were scored for bouts of eating and drinking, respectively, during the first 10 min postinjection. The eating or drinking response was considered positive if a mouse produced at least one bout of this behavior. After injections, sleep-wake activity was recorded for 12 h during the dark period (GHRH, ghrelin) or light period (Oct). The sleep responses, however, occurred within 1-3 h postinjection. Therefore, only data from the first 4 h of the 12-h records are reported herein. In each group, the order of the baseline (vehicle) and experimental (peptide) day varied, and approximately half of the groups was injected with the vehicle and the other half of the groups with the peptide on the first day. Some of the mice tested with GHRH were previously used in the SD experiments. In this case, 1 wk elapsed between these experiments. Some mice were tested with both ghrelin and Oct; there was at least 1 day off between these tests.

Ghrelin-induced GH secretion. The effects of an intraperitoneal injection of 400 µg/kg ghrelin on plasma GH concentration were studied in seven lit/lit and eight heterozygous mice. To obtain control values, physiological saline was injected into 10 lit/lit and 10 heterozygous mice. The mice were decapitated 15 min after injections, and the trunk blood was collected. The blood was centrifuged, and the plasma was stored at -20°C until the radioimmunoassay. The immunoreagents for determining plasma GH were provided by NHPP-NIDDK. GH was measured in duplicate, and the intra-assay coefficient of variation was <7%.

Effects of GH infusion on plasma IGF-1 concentration. Because IGF-1 is a GH-dependent hormone in the plasma, IGF-1 concentration indicates the efficacy of the GH delivery by the osmotic pumps. In separate experiments, another seven lit/lit mice were implanted with minipumps delivering 24 µg rGH/day, and eight heterozygous mice were provided with minipumps infusing physiological saline. These mice were killed on day 7 of the infusion to determine IGF-1 concentrations in the plasma of the trunk blood. The plasma of two lit/lit mice that did not receive GH was used to estimate baseline IGF-1 concentration. The blood samples were centrifuged and the plasma was stored at -20°C. IGF-1 was measured in duplicates by means of rat IGF-1 enzyme immunoassay kit (EIA kit, Diagnostic Systems Laboratories, Webster, TX). The antiserum cross-reacts with mouse IGF-1 and does not bind to IGF-2 (rat, human).

Determination of the point mutation in intracerebral GHRH-R. The hypothalamus plus preoptic region (landmarks: frontal edge of the optic chiasma, lateral sulci, mammillary bodies, and a depth of 1 mm) and the pituitary gland were harvested from two lit/lit mice and two heterozygous mice. Total RNA was isolated from hypothalamus and pituitary using TRIzol reagent (GIBCO BRL). The RNA was then subsequently DNase treated with RNase-free DNase from Ambion (Austin, TX). Using a high-fidelity enzyme in the TITAN one-tube RT-PCR system from Boehringer Mannheim (Germany), GHRH-R mRNA was amplified from 1 µg RNA; the primers used were sense 5' (cggcagaggggaccaacaacac) and antisense 5' (cacagggcaagccacagggtatg).

The RT-PCR product was electrophoresed on a 1% agarose ethidium bromide gel and purified by MinElute Gel Extraction kit from Qiagen (Valencia, CA). Gel-isolated DNA was then subsequently amplified for nucleotide sequencing by the Department of Biochemistry from Washington State University.

Statistics. The results are provided as means ± SE. Sleep parameters on the 2 baseline days or the 2 days after GH infusion were averaged for each mouse. Two-way ANOVA was used to compare hourly values of NREMS, REMS, and SWA among the various groups and between baseline and experimental day in one group. Group effects (independent samples; e.g., heterozygous vs. lit/lit mice) or treatment effects (repeated measures; e.g., sleep before and after GH infusion, sleep on the baseline day and after GHRH, ghrelin, or Oct), and time effects (repeated measures) were the two factors of the ANOVA. The time blocks corresponded to the 12-h light and dark periods for spontaneous sleep, the 8-h postdeprivation light period and 11 h at night after SD, and 4-h postinjection periods after administration of GHRH, ghrelin, and Oct. Because variations in sleep parameters with time are well known, only the group or treatment effects are reported herein. Because mice exhibit periods of wakefulness longer than 1 h at night, hourly values of SWA during NREMS could not be analyzed by ANOVA. Instead, SWA values during NREMS were averaged for the 12-h dark period, and these values were used for comparison. Sleep parameters in hour 1 postinjection after GHRH, ghrelin, and Oct were compared with baseline values after vehicles by means of the paired t-test. Also, the changes in body weight in response to GH were evaluated by means of paired t-test. Mean duration of NREMS and REMS bouts was calculated for 12-h periods and compared by means of Student's t-test between heterozygous and lit/lit mice. Student's t-test was used for comparisons of hormone concentrations, body weights, and SWA at night between groups. When conditions for parametric tests were not fulfilled, the appropriate nonparametric tests were used (Mann-Whitney test or Wilcoxon test); together with the level of significance, the statistical tests are indicated throughout text. An alpha -level of P < 0.05 was considered to be significant in all tests.

These experiments are consistent with the "Guiding Principles for Research Involving Animals and Human Beings" issued by the American Physiological Society (1).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Mutation of hypothalamic GHRH-R. The nucleotide sequence of the hypothalamic GHRH-R obtained from the lit/lit mice differed by one base (a guanine was substituted for an adenine), thereby leading to an altered codon 60 changing from aspartic acid to glycine in the lit/lit mice. These results confirm those previously reported for the pituitary GHRH-R in the lit/lit mice (15).

Spontaneous sleep. The control heterozygous mice and the lit/lit mice exhibited a normal diurnal rhythm of sleep with more NREMS and REMS during the light period than at night (Fig. 1). The lit/lit mice spent significantly less time in NREMS than the heterozygous mice during the light period [F(1,49) = 60.22, P < 0.0001]. The NREMS deficit was 13.2% of the recording time, yielding 95 min less NREMS in the lit/lit mice than in the controls during the 12-h light period. This reduction in duration of daytime NREMS resulted from a large and significant reduction in the mean duration of the NREMS episodes (1.30 ± 0.03 min in the lit/lit mice vs. 2.02 ± 0.06 min in the controls, Mann-Whitney test, P < 0.0001). The number of the NREMS episodes was slightly but significantly higher in the lit/lit mice than in the heterozygous mice (206 ± 7.3 vs. 185 ± 5.3, P < 0.05, Student's t-test). NREMS tended to decrease at night, but this difference did not reach the level of statistical significance. The lit/lit mice had significantly less REMS than the controls during the light period [-2.25% recording time, corresponding to 16.2 min in 12-h light period; F(1,49) = 27.09, P < 0.0001]. The REMS deficit resulted from a significantly decreased REMS episode frequency (controls: 44.2 ± 1.12; lit/lit mice: 32.7 ± 1.92, Mann-Whitney test, P < 0.001) whereas the duration of the REMS episodes was normal in lit/lit mice (1.5 ± 0.02 and 1.5 ± 0.04 min in the heterozygous and lit/lit mice, respectively). REMS was not altered at night.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1.   Lit/lit mice sleep less than heterozygotic controls. Mean ± SE hourly values of non-rapid eye movement sleep (NREMS), rapid eye movement sleep (REMS), and the power of EEG slow-wave activity (0.5-4 Hz) during NREMS (SWA) in heterozygous mice (triangle , n = 26), lit/lit mice (open circle , n = 25), and lit/lit mice after 8-9 days of subcutaneous infusion of growth hormone [; n = 4 (11 µg/day) or n = 8 (24 µg/day)]. Horizontal bar at top marks dark period of day.

The EEG SWA during NREMS in both mouse strains was relatively high after light onset, declined during the day, and rose during the dark period. The interindividual variability in EEG SWA was high, and significant differences between the heterozygous and lit/lit mice could not be detected. The nocturnal rise in EEG SWA tended to be smaller in the lit/lit mice than in the controls because the mean NREMS-associated power in the delta frequency range was significantly higher at night than during the day in the heterozygous mice (Wilcoxon test, P = 0.001) whereas mean power values did not differ between day and night in the lit/lit mice. To reduce individual variability, deviation from a 24-h mean EEG SWA was calculated for each hour and each mouse. Comparisons of these values failed to reveal significant variations among the groups. The ratio of delta power to total power during NREMS was determined in the light (heterozygous: 0.49 ± 0.01, lit/lit 0.48 ± 0.01) and dark periods (heterozygous: 0.52 ± 0.01, lit/lit 0.48 ± 0.01), and the values did not differ between groups although the delta ratio tended to be higher in the controls than in the lit/lit mice at night. Finally, powers in the other frequency ranges also did not differ between the two groups (controls and lit/lit mice: 4.5-8.0 Hz, 932 ± 101 and 904 ± 68 µV2; 8.5-12.0 Hz, 394 ± 42 and 413 ± 31 µV2; 12.5-16.0 Hz, 159 ± 17 and 150 ± 13 µV2; 16.5-20 Hz, 59 ± 7 and 51 ± 4 µV2).

Effects of GH replacement. After 1 wk of GH infusion, the weight gain of the lit/lit mice (+1.9 ± 0.22 g) was significantly higher than the weight gain of heterozygous mice infused with physiological saline (+0.8 ± 0.23, Student's t-test, P < 0.005). The weight gain may depend on GH dose for it was +2.11 ± 0.22 g in the mice infused with 24 µg rGH/day in contrast with the weight gain of +1.0 ± 0.47 g in the mice that received 11 µg mGH/day, but the sample size (n = 4) for the lower dose of GH was too low for statistical comparison.

The mean concentration of IGF-1 was 389.3 ± 15.31 ng/ml in the heterozygous mice infused with physiological saline. The plasma IGF-1 concentrations were 24.95 and 27.80 ng/ml in two untreated lit/lit mice. Thus the IGF-1 concentration in the lit/lit mice was about 1/15th of the control value. Plasma IGF-1 rose to a mean of 158.1 ± 20.1 ng/ml (minimum 75.6, maximum 210.6 ng/ml) after 1 wk of infusion of 24 µg rGH/day, indicating that the treatment was effective although IGF-1 concentration remained below normal.

Irrespective of the GH dose, GH infusion failed to alter NREMS in the lit/lit mice (Fig. 1). In contrast, REMS increased in the lit/lit mice receiving chronic GH administration. The REMS response to GH was only slightly stronger after the larger GH dose than after the smaller dose (+13 ± 3.2 vs. +11 ± 3.4 min in the 12-h light period), and the sample size did not allow statistical comparisons between the doses. In Fig. 1 and in the statistics, the mice infused with the low and high GH doses were pooled. When comparing the duration of REMS in the lit/lit mice before and after GH treatment, the increases in REMS were significant during the light period [F(1,11) = 23.12, P < 0.001]. After GH infusion, the statistical difference in REMS between the heterozygous mice and the lit/lit mice disappeared. REMS in lit/lit mice at night was not altered by GH administration.

After GH infusion, the nocturnal rise in EEG SWA during NREMS became significant (Wilcoxon test, P < 0.001). The ratio of delta power to total power during NREMS was the same as in the heterozygous mice, i.e., slightly higher than in the lit/lit mice without GH infusion. The other power parameters, including the power in the various EEG frequency ranges, did not differ from values in the heterozygous or lit/lit mice without GH infusion.

Sleep deprivation. The increases in the time spent in NREMS were small after SD; the most obvious change occurred in hour 2 after SD in both groups of mice (Fig. 2). In control mice, however, small increases in NREMS occurred for 6 h, and the changes were significant calculated for the 8 postdeprivation hours of the light period [+3.3 ± 0.85% recording time, i.e., 24 min in 8 h: treatment effect, F(1,12) = 13.79, P < 0.01; treatment × time interaction, F(7,84) = 3.69, P < 0.005]. Also, significant albeit small increases in NREMS were observed during the subsequent dark period [+3.3 ± 1.31% recording time: F(1,12) = 5.85, P < 0.05] in the control mice. In contrast, statistically significant alterations failed to occur in NREMS in the lit/lit mice during the light period (-1.2 ± 1.95% recording time in 8 h) or the dark period (0.0 ± 0.86% recording time). Direct comparisons of the magnitude of changes in NREMS between the controls and the lit/lit mice suggested that NREMS responses tended to be higher in the controls than in the lit/lit mice during the day [F(1,24) = 4.128, P = 0.05] and at night [F(1,24) = 3.989, P = 0.06].


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2.   Mean ± SE hourly values of NREMS, REMS, and EEG SWA during NREMS on the baseline day (open symbols) and on the day of sleep deprivation (closed symbols) in heterozygous and lit/lit mice (n = 13/group). Sleep deprivation was performed during the first 4 h of the light period. Horizontal bars at top mark dark period. The %deviations from baseline values are depicted for SWA.

The time spent in REMS increased during the last hours of the light period after SD in both groups of mice (Fig. 2). Calculated for the 8 postdeprivation hours in the light period, these changes did not reach the level of statistical significance in either group although the SD-induced variations in REMS could be detected in the significant treatment × time interactions [heterozygous mice, F(7,84) = 9.02, P < 0.0001; lit/lit mice, F(7,84) = 8.574, P < 0.0001]. REMS, however, increased significantly at night in both the heterozygous [+2.1 ± 0.28% recording time: F(1,12) = 51.88, P < 0.0001] and the lit/lit mice [+1.74 ± 0.40% recording time: F(1,12) = 17.852, P < 0.005], and these changes did not differ between the two groups.

In heterozygous mice, a prominent EEG SWA response was elicited by SD (Fig. 2); EEG SWA during NREMS was ~50% higher in hour 1 after SD. SD-enhanced EEG SWA declined rapidly during postdeprivation hours 2-4 and was below baseline during the subsequent dark period. The increases in EEG SWA were significant [F(1,12) = 33.5, P < 0.0001] and varied with time [treatment × time interaction, F(7,84) = 58.3, P < 0.0001] during the light period after SD, and the suppression of EEG SWA was also significant at night (paired t-test, P < 0.05). In the lit/lit mice, SD-induced enhancements in EEG SWA were significant during the light period [F(1,12) = 24.6, P < 0.001; interaction: F(7,84) = 28.0, P < 0.0001] and did not differ from those in the controls. The suppression in EEG SWA at night after SD did not reach the level of statistical significance in the lit/lit mice.

Effects of Oct. The amount of NREMS was between 30 and 40% recording time in undisturbed mice during the first hour of the light period (Figs. 1 and 2). As indicated by the low amount of sleep in hour 1 the intraperitoneal injection of the vehicle at light onset was stressful for the mice in both groups (Fig. 3). In the heterozygous mice, injection of Oct significantly delayed sleep onset (32.1 ± 2.5 min after vehicle and 52.2 ± 3.9 min after Oct, paired t-test, P < 0.001) and decreased the time spent in NREMS in hour 1 (paired t-test, P < 0.05). In the Oct-treated control mice, NREMS time returned to normal in hour 2. EEG SWA during NREMS increased significantly in hour 2, remained high in hours 3 and 4, and then returned to baseline in hour 5 (not shown). These enhancements in EEG SWA were statistically significant calculated for the 2- to 4-h time period [F(1,10) = 20.09, P < 0.005]. REMS did not change after Oct treatment in control mice (not shown). In contrast, sleep was not altered after Oct in the lit/lit mice. Each heterozygous and lit/lit mouse displayed at least one bout of drinking during 10 min after administration of 200 µg/kg Oct, whereas drinking never occurred after injection of the vehicle.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   Effects of intraperitoneal injection of octreotide (Oct, 200 µg/kg; n = 11 heterozygous, and n = 12 lit/lit mice), growth hormone-releasing hormone (5 µg/kg; n = 14 heterozygous, and n = 13 lit/lit mice), and ghrelin (400 µg/kg; n = 11 heterozygous, and n = 11 lit/lit mice) on NREMS. Changes in EEG SWA during NREMS are depicted for Oct as percentage difference between the vehicle day and the Oct day (bars). EEG SWA was not determined for hour 1 because the number of 10-s NREMS bouts was too low or NREMS did not occur after Oct in some mice. Closed symbols: injection of peptides; open symbols: injection of vehicle. The sleep effects of Oct were studied during the light period (injection at light onset) whereas the sleep effects of GHRH and ghrelin were studied during the dark period (injection at dark onset). * Significant differences in hour 1 between the peptide day and the vehicle day, and significant increments in SWA in hour 2 after Oct in the heterozygous mice.

Effects of GHRH. GHRH enhanced NREMS in the heterozygous mice (Fig. 3). The latency of sleep onset decreased significantly (39.5 ± 4.3 min after physiological saline, and 27.5 ± 3.2 min after GHRH, paired t-test, P < 0.05), and the time spent in NREMS increased significantly in hour 1 postinjection (paired t-test, P < 0.0005). A second large increase in NREMS time occurred in hour 3. These changes in NREMS were statistically significant when calculated for the 4-h postinjection period [F(1,13) = 30.48, P < 0.0001]. EEG SWA during NREMS and REMS was not altered after injection of GHRH (not shown). In contrast, in the lit/lit mice, GHRH failed to alter latency to sleep onset (41.8 ± 7.3 min after physiological saline and 39.6 ± 7.2 min after GHRH) or any other sleep parameter measured in this study.

Effects of ghrelin. The mean plasma GH concentrations were 20.5 ± 5.71 and 7.21 ± 1.1 ng/ml in heterozygous and lit/lit mice, respectively, 15 min after intraperitoneal injection of physiological saline. The difference between the two groups was statistically significant (Mann-Whitney test, P < 0.05). In response to intraperitoneal injection of 400 µg/kg ghrelin, the GH concentration in the plasma exceeded 128 ng/ml, the top value of the calibration curve, in every control mouse. In the lit/lit mice, after ghrelin injection, the plasma GH concentration was 8.13 ± 2.92 ng/ml, and this value did not differ from the baseline value in these mice.

In the heterozygous mice, ghrelin induced a significant decrease in sleep latency (45.0 ± 6.3 min after saline and 17.2 ± 2.2 min after ghrelin, paired t-test, P < 0.001) and a significant increase in NREMS in hour 1 (paired t-test, P < 0.05) (Fig. 3). Sleep time, however, returned to baseline thereafter, and the changes in NREMS were not significant when calculated for 4 h. REMS and EEG SWA were not altered after injection of ghrelin (not shown). In the lit/lit mice, ghrelin had no effect on sleep latency (43.2 ± 13.7 min after saline and 39.8 ± 9.1 min after ghrelin), duration of NREMS or REMS, or EEG SWA. Bouts of eating were noted in each control mouse and in all but one lit/lit mouse during the initial 10 min after the injection of ghrelin.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The experiments were designed with the anticipation that studies on the lit/lit mice would promote our understanding of the role of the somatotropic axis hormones in sleep regulation. The reduction in spontaneous NREMS in the lit/lit mice as reported here is also characteristic of the TH-hGH transgenic mice, which have decreased GHRH production (57), and of dwarf (dw/dw) rats, which have a defect in GHRH receptor signaling (37). One novelty of the current study is that GH replacement for 8-9 days restores REMS whereas it fails to increase NREMS time in the lit/lit mouse. Although continuous GH delivery does not mimic physiological pulsatile GH secretion (26), it is effective (19) as evidenced in our experiments by the enhanced GH values and plasma IGF-1 concentrations and the weight gain in the lit/lit mice. The differences in the REMS and NREMS responses to GH infusion suggest that the decreases in NREMS are predominantly independent of GH/IGF-1 whereas the GH deficiency may have a major role in the alterations in REMS in the lit/lit mice. Lit/lit mice tended to display less intense SWA than the control mice particularly during NREMS in the dark period, and GH replacement normalized delta power. Although the alterations in the lit/lit mice were only at the border of statistical significance, reduced SWA is in agreement with some observations in GH-deficient humans (2) and may indicate a role of GH in determining delta power. The REMS-promoting activity of GH (and stimulation of delta power) might be associated with some intracerebral metabolic action (reviewed in Ref. 35), for the REMS response to an acute GH injection is blocked by inhibitors of protein synthesis (10).

There is a great variability among mice strains in the effects of SD on NREMS duration (12, 18). Calculated in percent recording time, small, 3.6%, increases in NREMS time were reported during 6 h recovery after 4-h SD in C57BL/6J mice, and these changes did not reach the level of statistical significance (18). The increment in NREMS time was in fact small albeit consistent across several hours in both the light and the dark periods in the heterozygous mice. Apart from a brief enhancement in NREMS in hour 2 after SD, this response did not occur in the lit/lit mice. In contrast, both control and lit/lit mice exhibited enhanced EEG SWA after SD. This is unexpected because the SD-induced enhancements in EEG SWA are greatly attenuated in the dw/dw rats (37). In mice, a 4-h SD is suggested to elicit maximal EEG SWA responses (18), and perhaps this amount of SD is not suitable for the demonstration of small differences in responsiveness.

The deficit in GHRH signaling itself is the likely candidate for the decreases in spontaneous NREMS and for the reduced NREMS response to SD in the lit/lit mice. In fact, the NREMS-promoting activity of GHRH does not require GH (38); instead, this GHRH action is mediated by the hypothalamus/preoptic region (58). These observations imply that GHRH-Rs are expressed by neurons in the hypothalamus and that these receptors are affected by the genetic mutation in the lit/lit mouse. The presence of GHRH-R mRNA was previously described in the rat hypothalamus (47). Current results show that GHRH-R mRNA is also expressed in the hypothalamus/preoptic region of the mouse. The reported point mutation in pituitary GHRH-R (15, 25) was demonstrated in the hypothalamic GHRH-R, suggesting that central GHRHergic activity is abolished the same way as GHRH actions in the pituitary.

That the NREMS-promoting activity is a specific effect of GHRH on GHRH-Rs is demonstrated by the failure of lit/lit mice to respond to GHRH. To our knowledge, the current report is the first description of the effects of GHRH on sleep in mice. GHRH strongly increased the duration of NREMS, but, in contrast to the findings in previously studied species, it failed to increase EEG SWA during NREMS in heterozygous mice. However, the sleep response to an intraperitoneal injection of GHRH at the onset of the active period in the mouse might not be comparable to the effects of systemically injected GHRH during the rest period in humans and rats or to intracerebral administration of GHRH during the active period to the rat (reviewed in Ref. 40).

Somatotropic deficiency could result in developmental alterations causing permanent sleep deficits. Poor maturation of neuronal networks may occur in GH deficiency, including an underdevelopment of the suprachiasmatic nucleus and the pineal gland, which may alter circadian rhythms (34). Although changes in behavior or diurnal rhythms were not obvious in our experiments, a contribution of developmental changes to NREMS alterations in the lit/lit mice currently cannot be excluded.

Ghrelin promoted NREMS and elicited GH secretion in the heterozygous mice. GHS receptors are expressed both in the pituitary somatotroph cells and in the hypothalamus (31, 44), and therefore, GHSs may elicit GH secretion through both sites of action. It seems, however, that stimulation of GH secretion by GHSs requires intact GHRHergic activity (5, 27, 41) in part because GHRH mediates the effect of GHSs (8, 48) and in part because pituitary GHS receptors are downregulated in the absence of GHRH (20). Stimulation of GHRH-containing neurons and inhibition of somatostatinergic neurons, another proposed action of GHSs (51), make ghrelin a candidate as a sleep-promoting peptide. GHSs, however, elicit feeding (56) and stimulate the corticotropin-releasing hormone/vasopressin-ACTH axis (23, 49), and these effects might not be compatible with sleep. In humans, synthetic GHSs have no effects (32) or enhance NREMS (6, 13), and ghrelin promotes slow wave sleep (55). Tolle et al. (50) injected ghrelin three times per day to rats and found inhibition of sleep during 30 min postinjection coinciding with induced eating. Although not analyzed statistically, enhancements in NREMS time could be observed during the subsequent 10-min time blocks in the published figure depicting NREMS. In addition, Tolle et al. (50) reported decreases in REMS in the 9-h observation period during which ghrelin pulses were delivered. Alterations in REMS did not occur in our experiments, but the mice were recorded at night when spontaneous REMS time was already low. Although our results provide evidence for the NREMS-promoting capacity of ghrelin, the efficacy of ghrelin and GHRH cannot be compared without determining dose-response relationships for both peptides. In the lit/lit mice, ghrelin failed to stimulate NREMS and GH secretion while it continued to elicit feeding. This suggests, therefore, that GHRH might be involved in the mediation of the sleep-promoting activity of ghrelin but not in ghrelin-induced feeding. In fact, feeding is attributed to ghrelin-induced stimulation of neuropeptide Y-containing neurons in the arcuate nucleus (9, 43).

Oct elicits prompt suppression of GH secretion in rats (4). This effect is mediated in part via sst2 somatostatin receptors expressed by the pituitary somatotroph cells (42) and in part via sst2 receptors inhibiting GHRHergic neurons in the hypothalamus (24, 59). Oct also elicits immediate inhibition of sleep followed by enhancements in EEG SWA during NREMS starting in hours 2-3 postinjection (4, 16). The changes in GH secretion and sleep after Oct correlate in time with the variations in hypothalamic GHRH contents elicited by Oct (14). Although GHRH might be involved in the sleep response to Oct, somatostatin is a ubiquitous neurotransmitter in the central nervous system, and Oct may elicit a number of effects that inhibit sleep without directly interfering with GHRH. In fact, Oct induces drinking, vasopressin secretion, and rises in blood pressure, which are attributed to a stimulation of intrahypothalamic ANG II release (17). Experiments in the lit/lit mouse demonstrate that the sleep response to Oct is absent in these mice with nonfunctional GHRH-Rs whereas Oct-induced drinking seems to persist. These results suggest that functional GHRH-Rs are necessary for the sleep effects of Oct and that the Oct-induced angiotensinergic activity might not be dependent on GHRH action. That the sleep response to Oct is independent of angiotensin was previously reported; inhibition of angiotensin blocks the effects of Oct on drinking while not interfering with the sleep responses (4).

In conclusion, the results from the lit/lit mice suggest that the decrease in REMS is linked to GH deficiency and that somatostatin and ghrelin may modulate NREMS via GHRH. The NREMS deficit in the lit/lit mice is consistent with the proposed importance of GHRH in the regulation of NREMS although other factors may also contribute to this alteration.


    ACKNOWLEDGEMENTS

We thank Dr. J. W. Wright for advice on the experiments with GH infusion and R. Brown for excellent assistance.


    FOOTNOTES

This work was supported by National Institutes of Health Grants NS-25378, NS-27250, and HD-36520 to J. M. Krueger and by Hungarian Ministry of Health and Science Foundation Grants ETT 04/033/2000 and OTKA-030456.

Address for reprint requests and other correspondence: J. M. Krueger, Dept. of VCAPP, Washington State Univ., Pullman, WA 99164-6520 (E-mail: krueger{at}vetmed.wsu.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

October 3, 2002;10.1152/ajpregu.00361.2002

Received 20 June 2002; accepted in final form 20 September 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   American Physiological Society. Guiding principles for research involving animals and human beings. Am J Physiol Regul Integr Comp Physiol 283: R281-R283, 2002[Free Full Text].

2.   Aström, C. Interaction between sleep and growth hormone. Acta Neurol Scand 92: 281-296, 1997.

3.   Bartke, A, Cecim M, Tang K, Steger RW, Chandrashekar V, and Turyn D. Neuroendocrine and reproductive consequences of overexpression of growth hormone in transgenic mice. Proc Soc Exp Biol Med 206: 345-359, 1994[Medline].

4.   Beranek, L, Hajdu I, Gardi J, Taishi P, Obal F, Jr, and Krueger JM. Central administration of the somatostatin analog octreotide induces captopril-insensitive sleep responses. Am J Physiol Regul Integr Comp Physiol 277: R1297-R1304, 1999[Abstract/Free Full Text].

5.   Conley, LK, Teik JA, Deghenghi R, Imbimbo BP, Giustina A, Locatelli V, and Wehrenberg WB. Mechanism of action of hexarelin and GHRP-6: analysis of the involvement of GHRH and somatostatin in the rat. Neuroendocrinology 61: 44-50, 1995[Web of Science][Medline].

6.   Copinschi, G, Leproult R, Van Onderbergen A, Caufriez A, Cole KY, Schilling LM, Mendel CM, De Lepeleire I, Bolognese JA, and Van Cauter E. Prolonged oral treatment with MK-677, a novel growth hormone secretagogue, improves sleep quality. Neuroendocrinology 66: 278-286, 1997[Web of Science][Medline].

7.   Danguir, J. Intracerebroventricular infusion of somatostatin selectively increases paradoxical sleep in rats. Brain Res 367: 26-30, 1986[Web of Science][Medline].

8.   Dickson, SL, Leng G, and Robinson ICAF Systemic administration of growth hormone-releasing peptide activates hypothalamic arcuate neurons. Neuroscience 53: 303-306, 1993[Web of Science][Medline].

9.   Dickson, SL, and Luckman SM. Induction of c-fos messenger ribonucleic acid in neuropeptide Y and growth hormone (GH)-releasing factor neurons in the rat arcuate nucleus following systemic injection of the GH secretagogue, GH-releasing peptide-6. Endocrinology 138: 771-777, 1997[Abstract/Free Full Text].

10.   Drucker-Colin, RR, Spanis CW, Hunyadi J, Sassin JF, and McGaugh JL. Growth hormone effects on sleep and wakefulness in the rat. Neuroendocrinology 18: 1-8, 1975[Web of Science][Medline].

11.   Ehlers, C, Reed TK, and Henriksen SJ. Effects of corticotropin-releasing factor and growth hormone-releasing factor on sleep and activity in rats. Neuroendocrinology 42: 467-474, 1986[Web of Science][Medline].

12.   Franken, P, Chollet D, and Tafti M. The homeostatic regulation of sleep need is under genetic control. J Neurosci 21: 2610-2621, 2001[Abstract/Free Full Text].

13.   Frieboes, RM, Murck H, Maier P, Schier T, Holsboer F, and Steiger A. Growth hormone-releasing peptide-6 stimulates sleep, growth hormone, ACTH and cortisol release in normal man. Neuroendocrinology 61: 584-589, 1995[Web of Science][Medline].

14.   Gardi, J, Szentirmai E, Hajdu I, Obal F, Jr, and Krueger JM. The somatostatin analog, octreotide, causes accumulation of growth hormone-releasing hormone and depletion of angiotensin in the rat hypothalamus. Neurosci Lett 315: 37-40, 2001[Web of Science][Medline].

15.   Godfrey, P, Rahal JO, Beamer WG, Copeland NG, Jenkins NA, and Mayo KE. GHRH receptor of the little mice contains a missense mutation in the extracellular domain that disrupts receptor function. Nat Genet 4: 227-232, 1993[Web of Science][Medline].

16.   Hajdu, I, Obal F, Jr, Fang J, Krueger JM, and Rollo CD. Sleep of transgenic mice producing excess rat growth hormone. Am J Physiol Regul Integr Comp Physiol 282: R70-R76, 2002[Abstract/Free Full Text].

17.   Hajdu, I, Obal F, Jr, Gardi J, Laczi F, and Krueger JM. Octreotide-induced drinking, vasopressin and pressure responses: role of central angiotensin and acetylcholine. Am J Physiol Regul Integr Comp Physiol 279: R271-R277, 2000[Abstract/Free Full Text].

18.   Huber, R, Deboer T, and Tobler I. Effects of sleep deprivation on sleep and sleep EEG in three mouse strains: empirical data and simulations. Brain Res 857: 8-19, 2000[Web of Science][Medline].

19.   Johansson, JO, Oscarsson J, Bjarnason R, and Bengtsson BA. Two weeks of daily injections and continuous infusion of recombinant human growth hormone (GH) in GH-deficient adults. I. Effects on insulin-like growth factor-1 (IGF-1), GH, and IGF binding proteins, and glucose homeostasis. Metabolism 45: 362-369, 1996[Web of Science][Medline].

20.   Kamegai, J, Wakabayashi I, Miyamoto K, Unterman TG, Kineman RD, and Frohman LA. Growth hormone-dependent regulation of pituitary GH secretagogue receptor (GHS-R) mRNA levels in the spontaneous dwarf rat. Neuroendocrinology 68: 312-318, 1998[Web of Science][Medline].

21.   Kerkhofs, M, Van Cauter E, Van Onderbergen A, Caufriez A, Thorner MO, and Copinschi G. Sleep-promoting effect of growth hormone-releasing hormone in normal men. Am J Physiol Endocrinol Metab 264: E594-E598, 1993[Abstract/Free Full Text].

22.   Kojima, M, Hosoda H, Date Y, Nakazato M, Matsuo H, and Kangawa K. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402: 656-660, 1999[Medline].

23.   Korbonits, M, Kaltsas G, Perry LA, Putignano P, Grossman AB, Besser GM, and Trainer PJ. The growth hormone secretagogue hexarelin stimulates the hypothalamo-pituitary-adrenal axis via arginine vasopressin. J Clin Endocrinol Metab 84: 2489-2495, 1999[Abstract/Free Full Text].

24.   Lanneau, C, Peineau S, Petit F, Epelbaum J, and Gardette R. Somatostatin modulation of excitatory synaptic transmission between periventricular and arcuate hypothalamic nuclei in vitro. J Neurophysiol 84: 1464-1474, 2000[Abstract/Free Full Text].

25.   Lin, SC, Lin CR, Gukovsky I, Lusis AJ, Sawchenko PE, and Rosenfeld MG. Molecular basis of the little mouse phenotype and implications for cell type specific growth. Nature 364: 208-213, 1993[Medline].

26.   MacLeod, JN, Pampori NA, and Shapiro BH. Sex differences in the ultradian pattern of plasma growth hormone concentrations in mice. J Endocrinol 131: 395-399, 1991[Abstract/Free Full Text].

27.   Maheshwari, HG, Rahim A, Shalet SM, and Baumann G. Selective lack of growth hormone (GH) response to the GH-releasing peptide hexarelin in patients with GH-releasing hormone receptor deficiency. J Clin Endocrinol Metab 84: 956-959, 1999[Abstract/Free Full Text].

28.   Marshall, L, Derad I, Starsburger CJ, Fehm HL, and Born J. A determinant factor in the efficacy of GHRH administration in promoting sleep: high peak concentration versus recurrent increasing slopes. Psychoneuroendocrinology 24: 363-370, 1999[Web of Science][Medline].

29.   Meerlo, P, Koehl M, Van der Borght K, and Turek FW. Sleep restriction alters hypothalamo-pituitary-adrenal response to stress. J Neuroendocrinol 14: 397-402, 2002[Web of Science][Medline].

30.   Mendelson, WB, Slater S, Gold P, and Gillin JC. The effect of growth hormone administration on human sleep: a dose response study. Biol Psychiatry 15: 613-618, 1980[Web of Science][Medline].

31.   Mitchell, V, Bouret S, Beauvillain JC, Schilling A, Perret M, Kordon C, and Epelbaum J. Comparative distribution of mRNA encoding the growth hormone secretagogue-receptor (GHS-R) in Microcebus murinus (primate, lemurian) and rat forebrain and pituitary. J Comp Neurol 429: 469-489, 2001[Web of Science][Medline].

32.   Moreno-Reyes, R, Kerkhofs M, L'Hermite-Balériaux M, Thorner MO, Van Cauter E, and Copinschi G. Evidence against a role for the growth hormone-releasing peptide axis in human slow-wave sleep regulation. Am J Physiol Endocrinol Metab 274: E779-E784, 1998[Abstract/Free Full Text].

33.   Ng, FM, and Veis N. Effects of exogenous growth hormone on insulin action and glucose metabolism in the dwarf "little" mouse. Biochem Int 21: 839-847, 1990[Web of Science][Medline].

34.   Noguchi, T. Effects of growth hormone on cerebral development: morphological studies. Horm Res 45: 5-17, 1996[Web of Science][Medline].

35.   Nyberg, F. Growth hormone in the brain: characteristics of specific brain targets for the hormone and their functional significance. Front Neuroendocrinol 21: 330-348, 2000[Web of Science][Medline].

36.   Obal, F, Jr, Alföldi P, Cady AB, Johannsen L, Sary G, and Krueger JM. Growth hormone-releasing factor enhances sleep in rats and rabbits. Am J Physiol Regul Integr Comp Physiol 255: R310-R316, 1988[Abstract/Free Full Text].

37.   Obal, F, Jr, Fang J, Taishi P, Kacsoh B, Gardi J, and Krueger JM. Deficiency of growth hormone-releasing hormone signaling is associated with sleep alterations in the dwarf rat. J Neurosci 21: 2912-2918, 2001[Abstract/Free Full Text].

38.   Obal, F, Jr., Floyd R, Kapas L, Bodosi B, and Krueger JM. Effects of systemic GHRH on sleep in intact and hypophysectomized rats. Am J Physiol Endocrinol Metab 270: E230-E237, 1996[Abstract/Free Full Text].

39.   Obal, F, Jr, Kapas L, Bodosi B, and Krueger JM. Changes in sleep in response to intracerebral injection of insulin-like growth factor-1 (IGF-1) in the rat. Sleep Res Online 1: 87-91, 1998[Medline].

40.   Obal, F, Jr, and Krueger JM. The somatotropic axis and sleep. Rev Neurol (Paris) 157: 5S12-5S15, 2001.

41.   Popovic, V, Damjanovic S, Micic D, Djurovic M, Dieguez C, and Casanueva FF. Blocked growth hormone-releasing peptide (GHRP-6)-induced GH secretion and absence of the synergic action of GHRP-6 plus GH-releasing hormone in patients with hypothalamopituitary disconnection: evidence that GHRP-6 main action is exerted at the hypothalamic level. J Clin Endocrinol Metab 80: 942-947, 1995[Abstract].

42.   Reisine, T. Somatostatin receptors. Am J Physiol Gastrointest Liver Physiol 269: G813-G820, 1995[Abstract/Free Full Text].

43.   Shintani, M, Ogawa Y, Ebihara K, Aizawa-Abe M, Miyanaga F, Takaya K, Hayashi T, Inoue G, Hosoda K, Kojima M, Kangawa K, and Nakao K. Ghrelin, an endogenous growth hormone secretagogue, is a novel orexigenic peptide that antagonizes leptin action through the activation of hypothalamic neuropeptide Y/Y1 receptor pathway. Diabetes 50: 227-232, 2001[Abstract/Free Full Text].

44.   Shuto, Y, Shibasaki T, Wada K, Parhar I, Kamegai J, Sugihara H, Oikawa S, and Wakabayashi I. Generation of polyclonal antiserum against the growth hormone secretagogue receptor (GHS-R). Evidence that the GHS-R exists in the hypothalamus, pituitary and stomach of rats. Life Sci 68: 991-996, 2001[Web of Science][Medline].

45.   Steiger, A, Guldner J, Hemmeter U, Rothe B, Wiedemann K, and Holsboer F. Effects of growth hormone-releasing hormone and somatostatin on sleep EEG and nocturnal hormone secretion in male controls. Neuroendocrinology 56: 566-573, 1992[Web of Science][Medline].

46.   Stern, WC, Jalowiec JE, Shabshelowitz H, and Morgane P. Effects of growth hormone on sleep-waking patterns in cats. Horm Behav 6: 189-196, 1975[Medline].

47.   Takahashi, T, Okimura Y, Yoshimura K, Shigeyoshi Y, Kaji H, Abe H, and Chihara K. Regional distribution of growth hormone-releasing hormone (GHRH) receptor mRNA in the rat brain. Endocrinology 136: 4721-4724, 1995[Abstract].

48.   Tannenbaum, GS, and Bowers CY. Interactions of growth hormone secretagogues and growth hormone-releasing hormone/somatostatin. Endocrine 14: 12-27, 2001.

49.   Thomas, GB, Fairhall KM, and Robinson ICA Activation of the hypothalamo-pituitary-adrenal axis by the growth hormone (GH) secretagogue, GH-releasing peptide-6, in rats. Endocrinology 138: 1585-1591, 1997[Abstract/Free Full Text].

50.   Tolle, V, Bassant MH, Zizzari P, Poindessous-Jazat F, Tomasetto C, Epelbaum J, and Bluet-Pajot M.-T. Ultradian rhythmicity of ghrelin secretion in relation with GH, feeding behavior, and sleep-wake patterns in rats. Endocrinology 143: 1353-1361, 2002[Abstract/Free Full Text].

51.   Tolle, V, Zizzari P, Tomasetto C, Rio MC, Epelbaum J, and Bluet-Pajot M.-T. In vivo and in vitro effects of ghrelin/motilin-related peptide on growth hormone secretion in the rat. Neuroendocrinology 73: 54-61, 2001[Web of Science][Medline].

52.   Toth, LA. Identifying genetic influences on sleep: an approach to discovering the mechanisms of sleep regulation. Behav Genet 31: 39-46, 2001[Web of Science][Medline].

53.   Van Cauter, E, and Plat L. Interrelations between sleep and the somatotropic axis. Sleep 21: 553-565, 1998[Web of Science][Medline].

54.   Wajnrajch, MP, Gertner JM, Harbison MD, Chua SC, Jr, and Laibel RL. Nonsense mutation in the human growth hormone-releasing hormone receptor causes failure analogous to the little (lit) mouse. Nat Genet 12: 88-90, 1996[Web of Science][Medline].

55.   Weikel, JC, Held K, Schmid D, Mathias S, Ising M, and Steiger A. Ghrelin promotes slow wave sleep and release of growth hormone, ACTH and cortisol in young normal men. J Sleep Res 11 (S1): 248, 2002.

56.   Wren, AM, Small CJ, Ward HL, Murphy KG, Dakin CL, Taheri S, Kennedy AR, Roberts GH, Morgan DGA, Ghatei MA, and Bloom SR. The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology 141: 4325-4328, 2000[Abstract/Free Full Text].

57.   Zhang, J, Obal F, Jr, Fang J, Collins BJ, and Krueger JM. Non-rapid eye movement sleep is suppressed in transgenic mice with a deficiency in the somatotropic system. Neurosci Lett 220: 97-100, 1996[Web of Science][Medline].

58.   Zhang, J, Obal F, Jr, Zheng T, Fang J, Taishi P, and Krueger JM. Intrapreoptic microinjection of GHRH or its antagonist alters sleep in rats. J Neurosci 19: 2187-2194, 1999[Abstract/Free Full Text].

59.   Zheng, H, Bailey A, Jiang MH, Honda K, Chen HY, Trumbauer ME, Van der Ploeg LHT, Schaeffer JM, Leng G, and Smith RG. Somatostatin receptor subtype 2 knockout mice are refractory to growth hormone-negative feedback on arcuate neurons. Mol Endocrinol 11: 1709-1717, 1997[Abstract/Free Full Text].


Am J Physiol Regul Integr Comp Physiol 284(1):R131-R139
0363-6119/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. Szentirmai, T. Yasuda, P. Taishi, M. Wang, L. Churchill, S. Bohnet, P. Magrath, B. Kacsoh, L. Jimenez, and J. M. Krueger
Growth hormone-releasing hormone: cerebral cortical sleep-related EEG actions and expression
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2007; 293(2): R922 - R930.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. Szentirmai, L. Kapas, Y. Sun, R. G. Smith, and J. M. Krueger
Spontaneous sleep and homeostatic sleep regulation in ghrelin knockout mice
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2007; 293(1): R510 - R517.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. Szentirmai, L. Kapas, and J. M. Krueger
Ghrelin microinjection into forebrain sites induces wakefulness and feeding in rats
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2007; 292(1): R575 - R585.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. Steiger
Ghrelin and sleep-wake regulation
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2007; 292(1): R573 - R574.
[Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
P. Schussler, A. Yassouridis, M. Uhr, M. Kluge, J. Weikel, F. Holsboer, and A. Steiger
Growth hormone-releasing hormone and corticotropin-releasing hormone enhance non-rapid-eye-movement sleep after sleep deprivation.
Am J Physiol Endocrinol Metab, September 1, 2006; 291(3): E549 - E556.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. Steiger
Eating and sleeping--their relationship to ghrelin and leptin
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2004; 287(5): R1031 - R1032.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
B. Bodosi, J. Gardi, I. Hajdu, E. Szentirmai, F. Obal Jr., and J. M. Krueger
Rhythms of ghrelin, leptin, and sleep in rats: effects of the normal diurnal cycle, restricted feeding, and sleep deprivation
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2004; 287(5): R1071 - R1079.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. Dzaja, M. A. Dalal, H. Himmerich, M. Uhr, T. Pollmacher, and A. Schuld
Sleep enhances nocturnal plasma ghrelin levels in healthy subjects
Am J Physiol Endocrinol Metab, June 1, 2004; 286(6): E963 - E967.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
J. A. Alt, F. Obal Jr., T. R. Traynor, J. Gardi, J. A. Majde, and J. M. Krueger
Alterations in EEG activity and sleep after influenza viral infection in GHRH receptor-deficient mice
J Appl Physiol, August 1, 2003; 95(2): 460 - 468.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/1/R131    most recent
00361.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (37)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Obal, F.
Right arrow Articles by Krueger, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Obal, F., Jr.
Right arrow Articles by Krueger, J. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online