|
|
||||||||
1 Endocrine and 4 Transplant Research Laboratories, St. Luke's Medical Center, Milwaukee; and 2 Department of Medicine, Medical College of Wisconsin, Milwaukee, Wisconsin 53215; and 3 Department of Biology, Boston University, Boston, Massachusetts 02215
| |
ABSTRACT |
|---|
|
|
|---|
The adrenocortical
response to hypoxia may be a critical component of the adaptation to
this common neonatal stress. Little is known about adrenal function in
vivo in hypoxic neonates. The purpose of this study was to evaluate
adrenocortical responses to ACTH in suckling rat pups exposed to
hypoxia from birth to 5-7 days of age compared with normoxic
controls. We also evaluated potential cellular controllers of
steroidogenic function in situ. In 7-day-old pups at 0800, hypoxia from
birth resulted in increased basal (12.2 ± 1.4 ng/ml;
n = 12) and ACTH-stimulated (94.0 ± 9.4 ng/ml;
n = 14) corticosterone levels compared with normoxic
controls (basal = 8.3 ± 0.5 ng/ml; n = 11;
stimulated = 51.3 ± 3.8 ng/ml; n = 8). This
augmentation occurred despite no significant difference in plasma ACTH
levels in normoxic vs. hypoxic pups before (85 ± 4 vs. 78 ± 8 pg/ml) or after (481 ± 73 vs. 498 ± 52 pg/ml) porcine ACTH injection (20 µg/kg). This effect was similar in the afternoon at 6 days of age and even greater at 5 days of age at 0800. The aldosterone response to ACTH was not augmented by exposure to hypoxia
from birth. Adrenocortical hypoxia-inducible factor (HIF)-1
mRNA was
undetectable by RT-PCR. Steroidogenic acute regulatory (StAR) protein
in adrenal subcapsules (zona fasciculata/reticularis) was augmented by
exposure to hypoxia; this effect was greatest at 5 days of age.
Peripheral-type benzodiazepine receptor (PBR) protein was also
increased at 6 and 7 days of age in pups exposed to hypoxia from birth.
We conclude that hypoxia from birth results in an augmentation of the
corticosterone but not aldosterone response to ACTH. This effect
appears to be mediated at least in part by an increase in controllers
of mitochondrial cholesterol transport (StAR and PBR) and to occur
independently of measurable changes in endogenous plasma ACTH. The
augmentation of the corticosterone response to acute increases in ACTH
in hypoxic pups is likely to be an important component of the overall
physiological adaptation to hypoxia in the neonate.
adrenocorticotropin; aldosterone; newborn; steroidogenic acute regulatory protein; peripheral-type benzodiazepine receptor; hypoxia-inducible factor
| |
INTRODUCTION |
|---|
|
|
|---|
HYPOXIA is one of the most common causes of neonatal morbidity and mortality (10, 17). Considerable attention has been paid to the short- and long-term neurological, cardiopulmonary, and renal consequences of neonatal hypoxia (3, 8, 14, 34, 36). In comparison, the adrenal adaptation in vivo to prolonged neonatal hypoxia has not been extensively studied. One pertinent study in human infants with hypoxemia due to bronchiolitis demonstrated an augmented cortisol, but not aldosterone, response to ACTH (12). This suggests a zone-specific adrenal adaptation to hypoxia.
We have extensively examined dispersed adrenal cells in vitro removed from suckling rats exposed to hypoxia from birth (28). We have found that, as opposed to adult rats (29), steroidogenesis in vitro is augmented in adrenal cells from hypoxic neonatal rats despite no changes in steroidogenic enzyme expression, in steroidogenesis in isolated mitochondria, or in morphology as assessed by immunohistofluorescence or electron microscopy (28). This suggests that hypoxia-induced changes in intracellular factors may alter steroidogenic enzyme activity independently of steroidogenic enzyme expression.
The critical question, however, is whether chronic hypoxia in the
neonate alters adrenal function in vivo. Therefore, the purpose of the
present study was to examine the corticosterone and aldosterone
responses in vivo to ACTH injection in neonatal rats exposed to hypoxia
from birth. We also evaluated the expression of steroidogenic acute
regulatory (StAR) and peripheral-type benzodiazepine receptor (PBR)
proteins, two principal intracellular controllers of
steroidogenesis (2, 23, 35), as well as hypoxia-inducible factor (HIF)-1
, a transcription factor thought to be involved in the
cellular and molecular response to low oxygen tension
(11).
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Animal Treatment and Exposure to Hypoxia
All animal experimental procedures were approved by Medical College of Wisconsin and Aurora Health Care Institutional Animal Care and Use Committees and conformed to the "Guiding Principles for Research Involving Animals and Human Beings" of the American Physiological Society. Timed pregnant Sprague-Dawley rats (Harlan, Indianapolis, IN; n = 79) were obtained at 14 days gestation and maintained on a standard sodium diet and water ad libitum in a controlled environment (0600-1800 lights on). Parturition occurred spontaneously on the afternoon of gestational day 21 during which rats were kept under observation. As soon as a litter was completely delivered, the pups were weighed and cross-fostered (8-10 pups/dam), and the dam and its pups were moved to an environmental chamber and exposed to normobaric normoxia (21% O2) or hypoxia (12% O2) as described in detail previously (28, 36). We have previously shown that this exposure leads to arterial PO2 levels in adults of about 50-55 Torr with sustained respiratory alkalosis with metabolic compensation (27, 30, 31).ACTH Injection and Blood and Tissue Sampling
Experiment 1: 7 days of age. At 0800 at 7 days of age (60 litters), three to four pups per litter were quickly removed from the chamber, weighed, and decapitated (basal samples). Trunk blood was collected in sodium EDTA (3-4 pups/tube), adrenal glands were removed, and some were weighed. A subset of blood samples was allowed to clot, and serum was frozen for the measurement of corticosteroid-binding capacity (see below). Adrenal glands that were weighed were not saved for subsequent analysis because of the time delay required for accurate assessment of weight. Capsules (zona glomerulosa; ZG) and subcapsules (zonae fasciculata/reticularis; ZF/R) were separated and immediately frozen for subsequent analysis (see below). The remaining pups were weighed and injected intraperitoneally with porcine ACTH (Sigma) diluted in normal saline as described in detail previously (40). Pups were injected with 20 µg/kg ACTH (10 µl/g body wt) and immediately returned to their home cages with their dams in the appropriate normoxic or hypoxic environment. The pups were then decapitated at 15, 30, 45, and 60 min after ACTH injection, with blood and adrenal glands collected as described above. To generate a more complete ACTH-corticosterone dose-response curve, additional pups were injected with 10 µg/kg ACTH and decapitated at 30 min.
Experiment 2: 5-6 days of age. We then determined if increases in endogenous ACTH earlier in the hypoxic exposure, or in the afternoon, might account for changes in adrenal function. Another group of pups and their dams was exposed to hypoxia from birth to 0800 at 5 days of age (8 litters) or to 1400 at 6 days of age (11 litters). Sampling was performed as described above except that adrenal glands were not weighed but were all immediately separated and frozen for analysis. ACTH (20 µg/kg) was injected as described above, with pups decapitated 30 min after injection.
Hormone assays. Plasma ACTH and corticosterone were analyzed in unextracted plasma by radioimmunoassay using reagents purchased from ICN Pharmaceuticals (Costa Mesa, CA) as described previously (28-31). Because of hyperlipidemia that occurs in suckling rats (26), plasma was centrifuged at 16,000 g for 2 min before assay to avoid interference of lipids in the ACTH assay. Plasma samples after ACTH injection were diluted 1:5 for analysis of plasma ACTH. Plasma aldosterone was analyzed by solid-phase radioimmunoassay (Diagnostic Systems Labs, Webster, TX) following the manufacturer's specifications, except that standards and samples were assayed with 50 µl (instead of 100 µl), which still provided sufficient sensitivity (25 pg/ml).
Serum corticosteroid-binding capacity. Serum corticosteroid-binding globulin (CBG) was estimated by two different methods. Both involved assessing the difference in binding of [3H]corticosterone to diluted serum in the absence (total binding) and presence (nonspecific binding) of excess corticosterone. One method involved stripping the serum with charcoal before assay (7), while the other did not (18). Because hypoxia induces hyperlipidemia in suckling rats (26) and hyperlipidemia alters the serum binding of corticosterone (4, 13), we repeated these measurements after delipidation of serum using Lipoclear (Statspin, Norwood, MA).
RT-PCR for Adrenal HIF-1
and StAR mRNA
HIF-1
.
The reactions were subjected to 35 amplification cycles on a
Perkin Elmer-Cetus thermal cycler. The amplification cycle profile was
95°C denaturation for 1 min, followed by primer annealing at 48°C
for 1 min and extension for 2 min at 72°C. Primers were designed with
the aid of commercially available software (Primer Designer, S&E
Software, State Line, PA) from previously published sequences of mouse
(39) and human (38) HIF-1
genes. The
primers for rat templates were chosen based on maximum areas of
sequence similarity between the mouse and human genes and similarity in GC content and melting temperature. The following are the 5'
3'
sequences of the sense (S) and antisense (AS) primers used in these
studies: HIF-1
S, ATACTGATTGCATCTCCATCTTCTACC; HIF-1
AS,
TCAGTTAACTTGATCCAAAGCTCTGAG. The primers were synthesized by
Operon Technologies (Alameda, CA). PCR products were separated by gel electrophoresis.
StAR. PCR for StAR mRNA was performed using previously published methods and primer sequences (33). Semiquantitative analysis was performed by normalizing the StAR signal to the housekeeping gene L19 as described previously (22). Gels were digitized and scanned using an Alphaimager System (Alpha Innotech, San Leandro, CA).
StAR and PBR Protein Immunoblot Analysis
StAR and PBR protein immunoblot analysis was performed as described in detail previously (40) with antibodies kindly provided by V. Papadopoulos (Georgetown Univ. School of Medicine). Protein was extracted from adrenal ZG and ZF/R and fractionated by one-dimensional SDS-PAGE on a 15% acrylamide gel. Proteins were transferred onto 0.45-µm nitrocellulose membranes for 30 min using a Trans-Blot Cell (Idea, Corvalis, OR). Membranes were blocked for nonspecific absorption using 3% (wt/vol) dry nonfat milk. The blots were treated for immunodetection of PBR, stripped, and reblotted for detection of StAR protein using anti-PBR and anti-StAR at 1:1,000 dilution prepared as previously described (40). Data were normalized to
-actin protein using anti-mouse actin antibody at
1:1,000 dilution (Sigma, St. Louis, MO). Goat anti-mouse
IgG-horseradish peroxidase was used as secondary antibody at 1:6,000
followed by chemiluminescent detection with reagents from Perkin Elmer (Boston, MA). NIH Image J software was used to quantify blots.
Statistical Analysis
Data were analyzed by unpaired t-test and two- and three-factor ANOVA (P < 0.05). Data from gels were analyzed after logarithmic transformation. Post hoc analysis was performed by Duncan's multiple range test. Correlation analysis was performed by linear regression using Sigmastat software. Data are presented as means ± SE.| |
RESULTS |
|---|
|
|
|---|
Exposure to hypoxia from birth to 7 days of age resulted in
~29% lower body weight and ~16% lower adrenal weight compared with normoxic controls (Fig. 1). Because
the difference in adrenal weight between normoxic and hypoxic rats was
not as great as the difference in body weight, the ratio of adrenal
weight to body weight was ~16% greater in pups exposed to hypoxia
(Fig. 1).
|
Figure 2 shows plasma ACTH and
corticosterone levels in rat pups exposed to normoxia or hypoxia from
birth before (0 min) and after injection of ACTH (20 µg/kg). Hypoxia
resulted in a small but significant increase in basal corticosterone
(12.2 ± 1.4 ng/ml) compared with normoxic controls (8.3 ± 0.5 ng/ml) without any change in basal ACTH. Basal serum
corticosteroid-binding capacity was so low using either method
(7, 18) that the true binding could not be reliably
distinguished from nonspecific binding even after delipidation (data
not shown).
|
Injection of ACTH (20 µg/kg) resulted in a significant increase in plasma ACTH that was not different between normoxic and hypoxic pups (Fig. 2). There was a tendency for plasma ACTH to be lower in normoxic pups 60 min after injection, but there were no overall differences between hypoxic and normoxic data by ANOVA. Pups exposed to hypoxia demonstrated a marked augmentation of the corticosterone response to ACTH at all times assessed. The augmentation of the corticosterone response to ACTH in hypoxic pups was approximately 1.4-fold at 15 min, 1.7-fold at 30 min, 1.8-fold at 45 min, and 3.2-fold at 60 min.
Figure 3 shows plasma ACTH and
corticosterone without and with 10 and 20 µg/kg ACTH injection
(30-min samples), with the 30-min results for 20 µg/kg replotted from
Fig. 2 for comparison. Although the increase in plasma ACTH was related
to the dose of ACTH, the corticosterone response on average was already
maximal at 10 µg/kg. As in Fig. 2, basal and ACTH-stimulated
corticosterone were augmented in hypoxic rats. These data were
replotted (Fig. 4) individually (assuming
linearity) to demonstrate the relationship between plasma ACTH and
corticosterone (stimulus response). Hypoxia induced a significant shift
upward in this relationship (i.e., y-intercept was
significantly increased).
|
|
A prior increase in endogenous ACTH earlier in the hypoxic exposure or
in the afternoon could have accounted for increased adrenal weight
(relative to body weight) and augmented corticosterone responses to
ACTH. To evaluate this possibility, we studied pups at 5 days of age in
the morning and on the afternoon of day 6 (the afternoon
before experiments shown in Figs. 1-4). Figure
5 shows these results with data from
7-day-old rats replotted from Fig. 2 for comparison. Basal and
ACTH-stimulated corticosterone was similar in normoxic pups regardless
of age or time of day. Exposure to hypoxia from birth again resulted in
an increase in basal corticosterone without a change in basal ACTH.
This effect was more pronounced on day 5 compared with
day 6 and on day 6 compared with day
7. The hypoxia-induced augmentation of ACTH-stimulated corticosterone was more pronounced on day 5 compared with
day 6 and on day 6 compared with day
7. The qualitative response was not altered by the time of day.
There was no significant overall effect of hypoxia from birth on basal
or ACTH-stimulated plasma aldosterone (Fig.
6). However, at day 5, basal
aldosterone was increased in hypoxic rats. Body weight in 5-day-old
rats exposed to hypoxia (8.2 ± 0.2 g; n = 26) was less than normoxic controls (10.9 ± 0.01 g;
n = 26). Body weight in 6-day-old rats exposed to
hypoxia (9.5 ± 0.2 g; n = 21) was less than
normoxic controls (12.9 ± 0.2 g; n = 25).
|
|
The ratio of StAR to L19 mRNA in adrenal subcapsules serves as a
semiquantitative index of StAR expression as described previously (33). Exposure to hypoxia from birth to 7 days of age
tended to increase ZF/R StAR/L19 mRNA (0.5 ± 0.1) compared with
normoxic controls (0.4 ± 0.1). Interestingly, StAR/L19 mRNA was
higher in ZF/R from normoxic adult rats (0.6 ± 0.1) used as a
positive control. There was no effect of hypoxia on ZG StAR/L19 mRNA
(data not shown). We were unable to detect the expression of HIF-1
mRNA by RT-PCR in neonatal adrenal glands from normoxic or hypoxic pups, although it was detectable in the kidney and liver (data not shown).
StAR and PBR proteins were analyzed by normalizing target protein band
intensity to
-actin with the ratio in the adult adrenal arbitrarily
set as unity. ZF/R StAR and PBR proteins were significantly greater in
5-day-old (AM) vs. 6-day-old (PM) or 7-day-old (AM) adrenal glands
(Fig. 7). Exposure to hypoxia from birth
resulted in a significant increase in ZF/R StAR protein at each age,
with the effect being largest at 5 days of age. There was no effect of
hypoxia from birth on ZF/R PBR at 5 days of age. However, at 6 days of
age (PM) and 7 days of age (AM), there was a significant increase in
ZF/R PBR in the rat pups exposed to hypoxia from birth. ACTH injection
did not significantly alter StAR mRNA or StAR or PBR protein within the
time frame (60 min) analyzed (data not shown). Finally, there was no
effect of hypoxia and/or ACTH on StAR or PBR protein in the ZG (data
not shown).
|
| |
DISCUSSION |
|---|
|
|
|---|
This study examined the control of corticosterone release in vivo in rat pups exposed to hypoxia from birth compared with normoxic controls. We found that 1) hypoxia resulted in a lower body weight and adrenal weight but an increased ratio of adrenal to body weight; 2) hypoxia from birth resulted in increased basal corticosterone despite no difference in plasma ACTH compared with normoxic controls; 3) hypoxia from birth resulted in an augmented corticosterone, but not aldosterone, response to exogenous ACTH; 4) the augmentation in corticosterone response was greatest at 5 days of age compared with 6 and 7 days of age; 5) this effect could not be attributed to an increased ACTH in the AM or PM or earlier in the exposure; and 6) the increase in steroidogenesis was associated with an increase in StAR and, to a lesser extent, PBR protein, in the adrenal subcapsule (ZF/R).
We have previously demonstrated augmented early pathway (P450scc) activity in intact dispersed adrenal cells from hypoxic rat pups but not in isolated mitochondria (28). This suggested that factors such as StAR or PBR proteins, which are known to mediate the rate-limiting mitochondrial cholesterol transport step, might be involved in the augmentation observed (2, 23, 35). If this were the case, we hypothesized that the adrenocortical response to exogenous ACTH in vivo should be augmented in hypoxic pups compared with normoxic controls.
Because it is well known that body weight is lower in pups, juvenile, or adult rats exposed to hypoxia, it was important to ensure that the increase in ACTH was similar across groups. For that reason, ACTH was injected adjusting for body weight. We found that the increase in plasma ACTH achieved in normoxic and hypoxic rats was similar, leading to a controlled adrenal stimulus.
We also found an effect specific to corticosterone (subcapsule) because the aldosterone response to ACTH was not affected by hypoxia in neonatal pups. This is quite different from the response in adults, where aldosteronogenesis is decreased during hypoxia because of a decrease in expression of P450c11AS (29). This confirms our previous proposition that the neonatal adrenal response to hypoxia is dramatically different from in the adult and is similar to a study in hypoxic human neonates (12).
What then could account for the augmented basal corticosterone response to ACTH in rat pups exposed to hypoxia from birth? Our initial hypothesis was that plasma ACTH was increased at some time during the exposure to hypoxia and that its trophic effects were responsible (6, 19). Consistent with that was the increase in relative adrenal weight we observed. We were unable, however, to demonstrate an increase in ACTH at 7 days of age. It remains possible that other posttranslational products of proopiomelanocortin may be involved (6).
Even though neonatal rats have not been reported to have a significant
circadian rhythm for corticosterone, we still thought that perhaps ACTH
was increased in the PM and/or earlier in the exposure to hypoxia. This
did not turn out to be the case. We have not completely eliminated the
possibility that a small, essentially undetectable increase in ACTH,
when integrated over time, might account for increased steroidogenesis
and adrenal weight in vivo (1). We have also previously
demonstrated that morphological changes in adrenal zonation and
mitochondrial density are not responsible for changes in
steroidogenesis in the neonatal rat exposed to hypoxia from birth
(28). The typical experimental approach using exogenous
glucocorticoids to suppress ACTH release in adults is not useful in
neonatal rats because even short-term dexamethasone significantly
reduces the expression of P450c11
(W. Engeland, personal
communication). Our data do suggest that some factor(s) other than ACTH
may be causing the increased corticosteronogenesis and adrenal weight
in hypoxic pups. Because increased leptin has been shown to inhibit
corticosterone but not aldosterone production in adult rats
(20), it is possible that a decrease in leptin that we
have demonstrated in hypoxic rat pups (24, 25) allowed an
increased steroidogenic response in the ZF/R but not the ZG.
Another possible explanation for an increased corticosterone with no change in ACTH is that hypoxia resulted in an increase in CBG and/or albumin binding. We tried several different methods to assess serum corticosterone binding (7, 18). Because CBG levels were so low to start with, consistent with previous studies (7, 13), we were unable to reliably distinguish true binding from nonspecific binding. Adding to this difficulty was the dramatic hyperlipidemia that occurs in suckling rats exposed to hypoxia (26). Because of possible interference of increased serum lipids with the measurement of serum binding capacity (4, 13), we also measured CBG activity in serum after delipidation and still could not generate an acceptable signal-to-noise ratio. Therefore, we are not able to completely eliminate an increase in CBG as a possibility. Arguing against this is that serum binding of corticosterone is extremely low between 5 and 7 days of age and may not be able to account for dramatic changes in total steroid levels (7). Also, when corticosterone and ACTH were correlated (Fig. 4), there was a cluster of data points in which basal (pre-ACTH injection) corticosterone was not elevated.
Because mitochondria isolated from adrenals from hypoxic neonatal rats do not show augmentation in vitro but whole cells do (28), the final remaining probable mechanism is an intracellular factor or factors involved in steroidogenesis. We chose to study the two best described, StAR and PBR, both of which are involved in regulating the rate-limiting step of steroidogenesis (cholesterol transport from the outer to the inner membrane of the mitochondria) (2, 23, 35). Although the data are semiquantitative, the results are quite consistent with StAR and PBR involvement.
StAR protein was higher in adrenals from 5-day-old rats compared with 6- and 7-day-old rats, and hypoxia augmented this effect. This was associated with the large augmentation of the corticosterone response to ACTH in hypoxic pups at 5 days of age. PBR protein was not augmented at 5 days of age but was augmented at 6 and 7 days of age. These data suggest that a complex interaction of StAR and PBR proteins may account for some of the effect on corticosterone production observed. Adding that to the increase in relative adrenal weight, most of the effect of hypoxia could be accounted for. It has been previously reported by one of us (40) that the ontogenic expression of immunoreactive PBR and PBR ligand-binding activity is correlated with the ontogenic pattern of ACTH-inducible steroidogenesis in neonatal rats during the so-called stress hyporesponsive period. The results suggested that PBR activity might be one of the factors determining the timing of the mature phenotype of the rat adrenal cortex. The present results are consistent with this hypothesis and extend those observations by implicating a possible role for both PBR and StAR protein in stimulus-induced enhancement of neonatal adrenocortical activity. This conclusion is also strengthened by the finding that hypoxia did not augment the aldosterone response to ACTH and that capsular (ZG) StAR and PBR were not significantly altered by hypoxia.
It is likely, however, that other factors are involved. We do not think
that the transcription factor HIF-1
is involved (11, 38), because its mRNA was not detectable in neonatal adrenal glands. We were concerned that the RT-PCR technique was not producing reliable results (even though it was able to detect HIF-1
mRNA in
the liver and kidney from these pups). We sent adrenal glands to G. Semenza at the Johns Hopkins Medical Institutions for analysis of mRNA
by Northern blotting and protein by Western blotting (38), and Semenza, too, could not detect a signal for either (personal communication).
StAR protein was increased, but StAR mRNA was not. It is important to note that the RT-PCR for analysis of StAR mRNA is a semiquantitative method and that small changes may have not been detected. It is also important to realize that a change in StAR protein during posttranslational processing is the important functional endpoint and that it can occur without changes in mRNA levels (2). Of particular interest is that StAR and PBR proteins were highest at 5 days of age and that this correlated with the most robust steroidogenic response to ACTH whether in normoxic or hypoxic pups. This further suggests that StAR and PBR are important intracellular proteins mediating steroidogenesis in the newborn rat (40).
One interesting ACTH-independent controller that could be considered in future experiments is the possibility that factors from the adrenal medulla and/or innervation of the neonatal adrenal might be involved in adrenocortical function (9). In particular, it has been suggested that expression of tyrosine hydroxylase correlates with the stress-hyporesponsive period in the adrenal cortex of the rat pup at around the age we studied (21, 37). It may be that locally produced factors from the adrenal medulla (including ACTH) might be activated during hypoxia, which might alter adrenal sensitivity to exogenous ACTH or endogenous ACTH from the pituitary.
It seems likely, then, that some combination of a small, essentially undetectable change in ACTH (1) and/or some as yet unidentified systemic or local factor(s) results in an increase in adrenal weight and in StAR/PBR in rats exposed to hypoxia from birth. These factors lead to an increase in basal and ACTH-stimulated corticosterone in hypoxic rat pups.
Perspectives
We suggest that augmented corticosterone is an integral component of the metabolic adaptation to hypoxia in the neonate. Although increased circulating glucocorticoids may have detrimental effects on neurological development in the neonate (32), an increase in corticosterone in the hypoxic pups is likely to be instrumental in the cardiovascular and metabolic adaptation (5) and, ultimately, improved survival. Although these beneficial effects are numerous, several are worth special mention. One effect we have demonstrated involving increased corticosterone is a significant decrease in insulin sensitivity (24, 25). This is likely to maintain glucose delivery to the brain and heart under hypoxic conditions. Another phenomenon of particular interest is the effect of corticosterone on the development of the hepatic and exocrine pancreatic function, which we have shown is necessary to maintain neonatal hypoxic hyperlipidemia (15, 16). Therefore, in addition to the clear effects of corticosterone on maintaining cardiovascular reactivity during hypoxia, the effects on intermediate metabolism in the neonatal pup are vital components in the adaptation to hypoxia.| |
ACKNOWLEDGEMENTS |
|---|
We thank E. Bruder, B. Jankowski, and P. Homar for excellent
technical assistance. We also thank Dr. V. Papadopoulos of Georgetown Univ. School of Medicine for the StAR and PBR antisera and G. Semenza
at Johns Hopkins Medical Institutions for performing initial HIF-1
Northern and Western blots.
| |
FOOTNOTES |
|---|
This research was supported by National Institutes of Health (NIH) Grants DK-54685 to H. Raff and DK-55793 to E. P. Widmaier. J. J. Hong was supported by NIH Training Grant T32-HD-07387.
Address for reprint requests and other correspondence: H. Raff, St. Luke's Physician's Office Bldg., 2801 W. KK River Pkwy Suite 245, Milwaukee, WI 53215 (E-mail: hraff{at}mcw.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
September 12, 2002;10.1152/ajpregu.00501.2002
Received 20 August 2002; accepted in final form 9 September 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Akana, SF,
Shinsako J,
and
Dallman MF.
Relationships among adrenal weight, corticosterone, and stimulated adrenocorticotropin levels in rats.
Endocrinology
113:
2226-2231,
1983
2.
Artemenko, IP,
Zhao D,
Hales DB,
Hales KH,
and
Jefcoate CR.
Mitochondrial processing of newly synthesized steroidogenic acute regulatory protein (StAR), but not total StAR, mediates cholesterol transfer to cytochrome P-450 side chain cleavage enzyme in adrenal cells.
J Biol Chem
276:
46583-46596,
2001
3.
Boksa, P,
Wilson W,
and
Rochford J.
Responses to stress and novelty in adult rats born vaginally, by cesarean section or by cesarean section with acute anoxia.
Biol Neonate
74:
48-59,
1998[Web of Science][Medline].
4.
Boonstra, R,
and
Tinnikov AA.
Increased corticosteroid binding capacity of plasma albumin but not of corticosteroid-binding globulin caused by ACTH-induced changes in free fatty acid concentrations in snowshoe hares and rabbits.
J Endocrinol
156:
205-212,
1998[Abstract].
5.
Chumas, PD,
Del Bigio MR,
Drake JM,
and
Tuor UI.
A comparison of the protective effect of dexamethasone to other potential prophylactic agents in neonatal rat model of cerebral hypoxia-ischemia.
J Neurosurg
79:
414-420,
1993[Web of Science][Medline].
6.
Coulter, CL,
Ross JT,
Owens JA,
Bennett HP,
and
McMillen IC.
Role of pituitary POMC-peptides and insulin-like growth factor II in the developmental biology of the adrenal gland.
Arch Physiol Biochem
110:
99-105,
2002[Medline].
7.
D'Agostino, J,
and
Henning SJ.
Hormonal control of postnatal development of corticosteroid-binding globulin.
Am J Physiol Endocrinol Metab
240:
E402-E406,
1981
8.
El-Khodor, BG,
and
Boksa P.
Transient birth hypoxia increases behavioral responses to repeated stress in the adult rat.
Behav Brain Res
107:
171-175,
2000[Web of Science][Medline].
9.
Engeland, WC,
Wotus C,
and
Rose JC.
Ontogeny of innervation of rat and ovine fetal adrenals.
Endocr Res
24:
889-898,
1998[Web of Science][Medline].
10.
Frankel, L,
and
Stevenson DK.
Metabolic emergencies of the newborn: hypoxemia and hypoglycemia.
Compr Ther
13:
14-19,
1987[Medline].
11.
Gassmann, M,
and
Wenger RH.
HIF-1, a mediator of the molecular response to hypoxia.
News Physiol Sci
12:
214-218,
1997
12.
Hanukoglu, A,
Fried D,
Nakash I,
and
Hanukoglu I.
Selective increases in adrenal steroidogenic capacity during acute respiratory disease in infants.
Eur J Endocrinol
133:
552-556,
1995
13.
Haourigui, M,
Vallette G,
Martin ME,
Sumida C,
Benassayag C,
and
Nunez EA.
In vivo effect of free fatty acids on the specific binding of glucocorticosteroids to corticosterone binding globulin and liver receptors in immature rats.
Steroids
59:
46-54,
1994[Web of Science][Medline].
14.
Hoeger, H,
Engelmann M,
Bernert G,
Seidl R,
Bubna-Littitz H,
Mosgoeller W,
Lubec B,
and
Lubec G.
Long term neurological and behavioral effects of graded perinatal asphyxia in the rat.
Life Sci
66:
947-962,
2000[Web of Science][Medline].
15.
Lee, PC,
Jelinek B,
Struve M,
Bruder ED,
and
Raff H.
Effect of neonatal hypoxia on the development of hepatic lipase in the rat.
Am J Physiol Regul Integr Comp Physiol
279:
R1341-R1347,
2000
16.
Lee, PC,
Struve M,
Lewis SM,
and
Raff H.
Neonatal hypoxia in the rat: effects on exocrine pancreatic development.
J Pediatr Gastroenterol Nutr
34:
542-547,
2002[Web of Science][Medline].
17.
Low, JA,
Froese AB,
Galbraith RS,
Smith JT,
Sauerbrei EE,
and
Derrick EJ.
The association between preterm newborn hypotension and hypoxemia and outcome during the first year.
Acta Paediatr
82:
433-437,
1993[Web of Science][Medline].
18.
Moraska, A,
Deak T,
Spencer RL,
Roth D,
and
Fleshner M.
Treadmill running produces both positive and negative physiological adaptations in Sprague-Dawley rats.
Am J Physiol Regul Integr Comp Physiol
279:
R1321-R1329,
2000
19.
Nagaya, M,
and
Widmaier EP.
ACTH and stress accelerate maturation of adrenocortical function in neonatal rats.
Endocrine
1:
247-252,
1993.
20.
Nowak, KW,
Pierzchala-Koziec K,
Tortorella C,
Nussdorfer GG,
and
Malendowicz LK.
Effects of prolonged leptin infusion on rat pituitary-adrenocortical function.
Int J Mol Med
9:
61-64,
2002[Web of Science][Medline].
21.
Okimoto, DK,
Blaus A,
Schmidt M,
Gordon MK,
Dent GW,
and
Levine S.
Differential expression of c-fos and tyrosine hydroxylase mRNA in the adrenal gland of the infant rat: evidence for an adrenal hyporesponsive period.
Endocrinology
143:
1717-1725,
2002
22.
Orly, J,
Rei Z,
Greenberg NM,
and
Richards JS.
Tyrosine kinase inhibitor AG18 arrests follicle-stimulating hormone-induced granulosa cell differentiation: use of reverse transcriptase-polymerase chain reaction assay for multiple messenger ribonucleic acids.
Endocrinology
134:
2336-2346,
1994
23.
Papadopoulos, V,
Amri H,
Boujrad N,
Cascio C,
Culty M,
Garnier M,
Hardwick M,
Li H,
Vidic B,
Brown AS,
Reversa JL,
Bernassau JM,
and
Drieu K.
Peripheral benzodiazepine receptor in cholesterol transport and steroidogenesis.
Steroids
62:
21-28,
1997[Web of Science][Medline].
24.
Raff, H,
Bruder ED,
and
Jankowski BM.
The effect of hypoxia on plasma leptin and insulin in newborn and juvenile rats.
Endocrine
11:
37-39,
1999[Web of Science][Medline].
25.
Raff, H,
Bruder ED,
Jankowski BM,
and
Colman RJ.
Effect of neonatal hypoxia on leptin, insulin, growth hormone and body composition in the rat.
Horm Metab Res
33:
151-155,
2001[Web of Science][Medline].
26.
Raff, H,
Bruder ED,
Jankowski BM,
and
Goodfriend TL.
Neonatal hypoxic hyperlipidemia in the rat: effects on aldosterone and corticosterone synthesis in vitro.
Am J Physiol Regul Integr Comp Physiol
278:
R663-R668,
2000
27.
Raff, H,
and
Chadwick CJ.
Aldosterone responses to ACTH during hypoxia in conscious rats.
Clin Exp Pharmacol Physiol
13:
827-830,
1986[Web of Science][Medline].
28.
Raff, H,
Jankowski BM,
Bruder ED,
Engeland WC,
and
Oaks MK.
The effect of hypoxia from birth on the regulation of aldosterone in the 7-day-old rat: plasma hormones, steroidogenesis in vitro, and steroidogenic enzyme mRNA.
Endocrinology
140:
3147-3153,
1999
29.
Raff, H,
Jankowski BM,
Engeland WC,
and
Oaks MK.
Hypoxia in vivo inhibits aldosterone synthesis and aldosterone synthase mRNA in the rat.
J Appl Physiol
81:
604-10,
1996
30.
Raff, H,
and
Roarty TP.
Renin, ACTH, and aldosterone during acute hypercapnia and hypoxia in conscious rats.
Am J Physiol Regul Integr Comp Physiol
254:
R431-R435,
1988
31.
Raff, H,
Sandri RB,
and
Segerson TP.
Renin, ACTH, and adrenocortical function during hypoxia and hemorrhage in conscious rats.
Am J Physiol Regul Integr Comp Physiol
250:
R240-R244,
1986
32.
Rivest, S.
Editorial: are glucocorticoids good or bad for brain development and plasticity.
Endocrinology
143:
1157-1158,
2002
33.
Ronen-Fuhrmann, T,
Timberg R,
King SR,
Hales KH,
Hales DB,
Stocco DM,
and
Orly J.
Spatio-temporal expression patterns of steroidogenic acute regulatory protein (StAR) during follicular development in the rat ovary.
Endocrinology
139:
303-315,
1998
34.
Soulier, V,
Dalmaz Y,
Cottet-Emard JM,
Lagercrantz H,
and
Pequignot JM.
Long-term influence of neonatal hypoxia on catecholamine activity in carotid bodies and brainstem cell groups of the rat.
J Physiol
498:
523-530,
1997
35.
Stocco, DM,
and
Clark RJ.
Regulation of the acute production of steroids in steroidogenic cells.
Endocr Rev
17:
221-244,
1996
36.
Thomas, T,
and
Marshall JM.
A study on rats of the effects of chronic hypoxia from birth on respiratory and cardiovascular responses evoked by acute hypoxia.
J Physiol
487:
513-525,
1995
37.
Walker, CD.
Chemical sympathectomy and maternal separation affect neonatal stress responses and adrenal sensitivity to ACTH.
Am J Physiol Regul Integr Comp Physiol
268:
R1282-R1288,
1995.
38.
Wang, GL,
Jiang BH,
Rue EA,
and
Semenza GL.
Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular oxygen tension.
Proc Natl Acad Sci USA
92:
5510-5514,
1995
39.
Wenger, RH,
Rolfs A,
Marti HH,
Guenet JL,
and
Gassman M.
Nucleotide sequence, chromosomal assignment and mRNA expression of mouse hypoxic-inducible factor-1
.
Biochem Biophys Res Commun
223:
54-59,
1996[Web of Science][Medline].
40.
Zilz, A,
Castello R,
Papadopoulos V,
and
Widmaier EP.
Developmental expression of the peripheral-type benzodiazepine receptor and the advent of steroidogenesis in rat adrenal glands.
Endocrinology
140:
859-864,
1999
This article has been cited by other articles:
![]() |
E. D. Bruder, J. K. Taylor, K. J. Kamer, and H. Raff Development of the ACTH and corticosterone response to acute hypoxia in the neonatal rat Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2008; 295(4): R1195 - R1203. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. D. Bruder, J. J. Lee, E. P. Widmaier, and H. Raff Microarray and real-time PCR analysis of adrenal gland gene expression in the 7-day-old rat: effects of hypoxia from birth Physiol Genomics, April 24, 2007; 29(2): 193 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. D. Bruder, P. C. Lee, and H. Raff Metabolomic analysis of adrenal lipids during hypoxia in the neonatal rat: implications in steroidogenesis Am J Physiol Endocrinol Metab, May 1, 2004; 286(5): E697 - E703. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Raff, L. Jacobson, and W. E. Cullinan Elevated corticosterone and inhibition of ACTH responses to CRH and ether in the neonatal rat: effect of hypoxia from birth Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2003; 285(5): R1224 - R1230. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Scholz The adrenal response of neonates to hypoxia Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2003; 284(1): R76 - R77. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |