AJP - Regu Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 284: R540-R549, 2003. First published October 17, 2002; doi:10.1152/ajpregu.00550.2002
0363-6119/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/2/R540    most recent
00550.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (25)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alway, S. E.
Right arrow Articles by Murlasits, Z. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alway, S. E.
Right arrow Articles by Murlasits, Z. S.
Vol. 284, Issue 2, R540-R549, February 2003

Id2 expression during apoptosis and satellite cell activation in unloaded and loaded quail skeletal muscles

Stephen E. Alway, Julie K. Martyn, Jun Ouyang, Archana Chaudhrai, and Zsolt S. Murlasits

Laboratory of Muscle, Sarcopenia and Muscle Diseases, Division of Exercise Physiology, West Virginia University School of Medicine, Robert C. Byrd Health Science Center, Morgantown, West Virginia 26506


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Inhibitor of differentiation-2 (Id2) is a basic helix-loop-helix protein that acts as a negative regulator of the myogenic regulatory transcription factor family, but Id2 has also been implicated in apoptosis in several cell lines. In this study, we tested the hypothesis that Id2 has a role in both apoptosis-associated muscle atrophy and muscle hypertrophy. A weight corresponding to 12% of the body weight was attached to one wing of Japanese quail to induce hypertrophy in the patagialis (PAT) muscle. Birds in group 1 were killed after 5 (n = 8), 7 (n = 10), or 14 days (n = 10) of loading. The left wing was loaded for 14 days in group 2 birds, and then the weight was removed and the PAT was examined after 7 (n = 10), 14 (n = 10), or 21 (n = 5) days of unloading. A time-released bromodeoxyuridine (BrdU) pellet was implanted subcutaneously with wing weighting to identify activated satellite cells during loading. The left wing was loaded for 14 days, unloaded for 14 days, and then the weight was reattached for a subsequent 7 (n = 10) or 14 days (n = 10) in group 3 birds. BrdU was implanted on the second loading phase in this group. Id2 mRNA as measured by kinetic PCR increased by 3.9-, 2.7-, and 1.6-fold, relative to control levels after 7, 14, and 21 days of unloading (group 2). Id2 protein as estimated by Western blots increased by 1.5-, 1.4-, and 0.75-fold after 7, 14, and 21 days of unloading (group 2). Muscle unloading induced apoptosis, because poly(ADP-ribose) polymerase-(PARP)-positive nuclei increased and caspase 8 levels increased by 2.6- and 1.7-fold after 7 or 14 days of unloading, respectively (group 2). Although BrdU-positive nuclei increased during loading (groups 1 and 3), 50% failed to survive during unloading (group 2). Id2 mRNA increased by 2.2- and 1.8-fold after 5 and 7 days of loading, respectively, but decreased to control levels by 14 days of loading in group 1. Id2 protein levels increased 2.1-fold after 5 days of loading (group 1). In contrast, Id2 did not increase in reloaded muscles of group 3 birds. These data suggest that Id2 may have a role in apoptosis-associated atrophy of skeletal muscles, but its role in muscle hypertrophy is less clear.

muscle atrophy; muscle hypertrophy; MyoD; myogenin


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

INHIBITORS OF DIFFERENTIATION (Id) proteins are basic helix-loop-helix proteins that act as negative regulators of cell differentiation. However, recent data suggest a wider biological role for Id proteins, including apoptosis. For example, Id proteins possess proapoptotic properties in a variety of nonmuscle cell lines (25, 45) as well as cardiac myocytes (59). They also function as cooperating or dominant oncoproteins in immortalization of rodent and human cells and in tumor induction in Id-transgenic mice (44). Therefore, it is also possible that the Id family may play a critical role in regulating skeletal muscle atrophy via apoptosis.

We recently proposed a role for Id repressors in skeletal muscle apoptosis and sarcopenia (8) because Id levels are correlated to muscle wasting (9) and we and others showed increases in markers of apoptosis in muscles of aged animals (8, 22, 49). Because we found high levels of Id2 in sarcopenic muscles of aged rodents (8, 9), we were interested in determining if Id2 might be involved in general pathways leading to apoptosis in muscle during periods of unloading, but under conditions where hypertrophied muscle undergoes atrophy to return to control levels of muscle mass.

Limb unloading is a common means to induce atrophy in skeletal muscles. In rodents, this is usually achieved by hindlimb unweighting (3, 10, 24, 60) or immobilization (24). Presumably, the rapid loss of muscle fiber cross-sectional area and fiber number during unloading indicates that the atrophying myofibers have activated pathways leading to decreased rates of synthesis and increased degradation of myofibrillar proteins (50, 63). Unloading leading to atrophy compared with control muscles is associated with a decrease in nuclei number (30). Allen and colleagues (3) identified TUNEL-positive nuclei in rat skeletal muscle after hindlimb unloading leading to muscle atrophy compared with control muscles, which suggests that some of the nuclei were lost via apoptosis. Nevertheless, hindlimb unloading in rodents results in severe muscle atrophy so that the mass of unloaded muscles decreases to levels that are well below control muscle mass levels. Reductions in hypertrophied muscles to near control levels and restoration of muscle mass to hypertrophied levels after a period of unloading have not been examined in detail, and this type of stimulus may differ from that where unloading induces atrophy below control levels (5, 30, 41). The biochemical signals regulating apoptosis during unloading in skeletal muscle have not been well studied and it is important to know if muscle loss from a beginning hypertrophic state back to control mass levels will invoke apoptotic pathways, or if apoptosis occurs only when muscles atrophy to levels lower than control mass levels. Therefore, in the current study, we examined Id2 in experimentally unloaded muscles that had first achieved hypertrophy to determine if Id2 was involved in unloading-induced atrophy.

In an apparent paradoxical role to apoptosis, Id2 levels are low in control muscles but become elevated in overloaded muscles of young adult rats undergoing hypertrophy (8, 9). This is consistent with a dual role for Id repressor genes as has been reported in mouse 32D.3 myeloid cells (25). Furthermore, Id proteins are involved in cell proliferation and in the timing of differentiation during neurogenesis, lymphopoiesis, and angiogenesis in various cell lines (38, 42, 46) including myoblasts (40).

In this study, we tested the hypothesis that Id2 has a dual role in both muscle hypertrophy and muscle atrophy. Because Id repressor levels increase with muscle wasting induced by aging (9), tetrodotoxin, and denervation (17), our first hypothesis was that if Id2 repressors were involved in pathways leading to apoptosis, Id2 should be elevated as part of a general program involving muscle loss and apoptosis of muscle nuclei. Our second hypothesis was that if Id2 is involved in pathways leading to proliferation of satellite cells, Id2 should be increased during muscle loading, when satellite cell activation is high.

We chose to test these hypotheses using the quail wing loading-unloading model because in quails, satellite cells or muscle precursor cells (MPCs) are activated during stretch-induced hypertrophy (18), and our pilot studies indicated that the number of muscle nuclei decreases during unloading. This is consistent with observations that the number of myofiber nuclei increases during hypertrophy (4, 51) and decreases during muscle atrophy (5, 30, 41), presumably to maintain a constant nuclear-to-cytoplasm ratio. Furthermore, the loading conditions of wing weighting can be easily varied in birds, and wing loading does not interfere with eating or ambulation of the birds. This reduces the potential for conditions other than loading to affect the muscle levels of the genes of interest. Unlike rodent models of surgical ablation or denervation to induce hypertrophy (e.g., reviewed in Ref. 36), stretch overload leading to muscle hypertrophy is induced without surgical intervention, hypertrophy is largely independent of innervation, and the hypertrophy can be easily reversed in the quail model, by simply unloading the wing (6).

These studies were conducted in the quail patagialis (PAT) muscle. The PAT is a twitch muscle composed primarily (~85-90%) of fibers containing fast myosin (13, 33, 56) and it shares functional characteristics that are similar to mammalian twitch skeletal muscles (7). The PAT originates on the scapula and inserts onto the ulna, and it primarily acts as a flexor of the humeral-ulnar joint. Wing loading stretches the PAT and this results in muscle hypertrophy (7, 33, 37, 56).

In this study, we show that following hypertrophy via wing loading, wing unloading induces PAT muscle loss, in part, by apoptosis, as measured by increased caspase 8, caspase 3,7,10, and poly(ADP-ribose) polymerase (PARP) staining. Increased Id2 mRNA and protein levels also accompanied PAT muscle loss. The initial wing weighting that resulted in hypertrophy was accompanied by increased satellite cell activation and elevated Id2 levels. However, the relationship between Id2 and satellite cell activation is unclear, because satellite cells were activated in the PAT during reloading without significant changes in Id2 expression.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Animals

Coturnix quail were hatched and raised in pathogen-free conditions at West Virginia University School of Medicine. The birds were provided with food and water ad libitum. They were housed at a room temperature of 22°C with a 12:12-h light-dark cycle. Young adult birds ages 8-12 wk of age were examined. All experiments carried approval from the institutional animal use and care committee from West Virginia University School of Medicine. The animal care standards were followed by adhering to the recommendations for the care of laboratory animals as advocated by the American Association for Accreditation of Laboratory Animal Care and fully conformed with the American Physiological Society's "Guiding Principles for Research Involving Animals and Human Beings" (12).

Experimental Muscles

The PAT muscle is flexed with the wing on the birds' back at rest, but it is stretched when the wing is extended. In our experimental model of stretch overload, we place a tube containing 12% of the bird's body weight over the left humeral-ulnar joint (11). This maintains the joint in extension throughout the period of stretch and it also induces some stretch at the origin of the PAT muscle. Wing loading results in hypertrophy of the PAT muscles (11, 56). The unstretched right PAT muscle serves as the intra-animal control muscle for each bird.

Weighting, Unweighting, and Bromodeoxyuridine

Three groups of birds were examined. The left wing was loaded in group 1, and birds were killed by an overdose of pentobarbital sodium after 5 days (5W; n = 8), 7 days (7W; n = 10), or 14 days (14W; n = 10) of stretch overload. A subcutaneous time-released bromodeoxyuridine (BrdU) pellet (0.22 µg BrdU · g body mass-1 · day-1; Innovative Research, Sarasota, FL) was implanted in each bird while anesthetized with 2% isoflurane, at the point when the wing was first weighted. BrdU is a thymidine analog and is incorporated in nuclei during DNA synthesis. BrdU was therefore used to identify activated satellite cells during periods of muscle growth. The left wing was loaded for 14 days in group 2 and then the weight was removed. BrdU was implanted at the point of initial wing weighting for birds in group 2. Birds in group 2 were killed after 7 days (7U; n = 10), 14 days (14U; n = 10), or 21 days (21U; n = 5) of unloading. Birds in group 3 had the left wing loaded for 14 days, then the weight was removed for 14 days, and finally the wing weight was reattached to the left wing. BrdU was implanted in group 3 birds concurrent with the second loading period (reloading of the limb). The birds in group 3 were killed after either 7 days (7R; n = 10) or 14 days (14R; n = 10) of reloading.

Muscle Weight and Preparation

The PAT muscles were dissected from the surrounding tissue, removed, blotted, weighed, and frozen in isopentane cooled to the temperature of liquid nitrogen and then stored at -80°C until used for analyses. Frozen 8-µm tissue cross sections from left and right muscles were placed on the same glass slide to control for processing differences (e.g., incubation time or temperature, etc.). The remainder of the tissue was processed for isolation of total RNA or total protein.

Kinetic PCR Assays

Total RNA was extracted from PAT muscles in TriReagent (Molecular Research, Cincinnati, OH). RNA was treated with DNase I (2224, Ambion, Austin, TX) to remove any DNA contamination and quantified at 260 nm (the 260/280 ratio was ~1.96-2.0). Superscript II reverse transcriptase (8064071, Invitrogen Life Tech., Bethesda, MD) was used to make cDNA according to the manufacturer's recommendations. Kinetic (real time) PCR was conducted using SYBR Green PCR Reagents kit (4304886, Applied Biosystems, Foster City, CA) on a GeneAMP 5700 sequence detector (Applied Biosystems). Primers (Invitrogen Life Tech.) were designed against myogenin (forward 5' CGTGCACAGTCCTCCCATGGA 3'; reverse 5' GCAAGCGGGAGCCCAGGAAGT 3'), MyoD (forward 5' CGGCCGCCGATGACTTCTATGAC 3'; reverse 5' TCCAGGTCCTCGAAGAAGTGCATGT 3'), myosin light chain (MLC; forward 5' CATGCCGTCTCAGGAATCAACTCAAG 3'; reverse 5' CCAATTTGGGTGCCGCGATCTTA 3'), Id2 (forward 5' GAATTCTCAGCATGAAAGCTTTCAGCC 3'; reverse 5' CTCGAGATTCAG CCACAGAGCGCT 3'), and cyclophilin (forward 5' GA GGGCCGACGAGCGCAAG 3'; reverse 5' GCCGAAGAGCCCGATGACGAC 3'). All primers were designed with an annealing temperature of 58-60°C. PCR amplification and sequences were optimized over a range of cDNA templates and primer concentrations, and the PCR products were verified. The threshold for kinetic detection was set to occur over linear amplifications over several ranges of primers and RNA levels. Preliminary experiments were conducted to optimize the conditions (i.e., RNA and primer concentrations, etc.) giving maximum change in fluorescence (Delta Rn), absence of nonspecific amplification, and equal amplification efficiencies of the genes of interest and cyclophilin. Absence of nonspecific amplification was confirmed by PCR product analysis using agarose gel electrophoresis. All samples were run in duplicate, with control and experimental samples run on the same plate.

The relative quantification of gene expression was calculated using the comparative CT method as described in detail elsewhere (34). Briefly, CT value reflects the cycle number at which a significant increase in Delta Rn (i.e., fluorescence) is first detected. DNA copy number and CT values are inversely related. Validation methods were conducted over a 10-fold range of cDNA and over a twofold range of primer concentrations to confirm that the efficiency of the genes of interest and cyclophilin was equal. A sample was considered positive at the cycle in which the change in the fluorescence of SYBR Green exceeds an arbitrary threshold value. The threshold value was set at the midpoint of the run and cycle number plot. The reproducibility of the assay was tested by ANOVA comparing repeat runs of samples, and mean values generated at individual time points were compared by a Student's t-test. Comparative CT calculations for MyoD, myogenin, MLC, and Id2 were expressed relative to the cyclophilin signal generated from the same cDNA sample. To achieve quantitative values, CT values were first averaged from duplicate runs for each sample. The average CT for the gene of interest was subtracted from the corresponding averaged cyclophilin CT value for that sample to give a Delta CT value. Delta Delta CT values were achieved by subtracting the control (right) Delta CT value from the experimental (left) Delta CT value. Delta Delta CT values that were 2.0 indicated a twofold difference between experimental and intra-animal control muscles. Therefore, left-right Delta Delta CT > 2.0 were considered to represent a significant change in gene expression in the experimental compared with the control level of gene expression. This provided a reasonable difference in gene expression between intra-animal samples, which exceeds the potential errors existing with the kinetic PCR quantification method. Setting a higher threshold of differences in gene expression for significance would have decreased the sensitivity for identifying potentially lower differences in gene levels that may have biological relevance during loading or unloading.

Western Blot Analyses

Western blotting was conducted as reported previously (9) with only minor modifications. Sixty micrograms of soluble protein were loaded on each lane of a 12% SDS-polyacrylamide gel and separated for 1.5 h at 20°C (9). Ten micrograms of an Id2 peptide (Santa Cruz, CA) were loaded on one lane of each gel and this was used as a positive control for Id2 Western blots. The gels were blotted to nitrocellulose membranes (1620097, Bio-Rad, Hercules, CA) and stained with Ponceau S (P7170, Sigma Chemical, St. Louis, MO) to confirm similar loading and transfers in each lane. The membranes were probed with a polyclonal antibody against Id2 (C-20, Santa Cruz Biotech, Santa Cruz, CA), at a concentration of 3 µg/ml overnight at 4°C. The signals were developed by chemiluminescence (34084, Pierce Biotechnology, Rockford, IL) using peroxidase-conjugated secondary antibodies (A132P, Chemicon International, Temecula, CA) and then the membranes were exposed to X-ray film (BioMax MS-1, Eastman Kodak, Rochester, NY). The resulting bands were quantified as optical density × band area with Kodak imaging software (Eastman Kodak) and expressed in arbitrary units.

Assessment of Caspase 3,7,10 and 8

Caspase 3,7,10 and caspase 8 were measured by commercial colorimetric apoptosis assay kits (526118, 526126, bioWorld, Dublin, OH), using the free dye of 7-amino-4-trifluromethyl coumarin (AFC) as a standard, according to the procedures outlined by the manufacturer. Briefly, 10 mg of tissue were homogenized in the lysis buffer supplied with the kit. Lysates were incubated in 50 µM of the AFC-conjugated substrate at 22°C and read at 380 nm using a Dynex MRX plate reader controlled through PC software (ThermoLabsystem, Franklin, MA). All data were read in duplicate and averaged for each muscle. Samples were incubated in fluoromethyl ketone as a negative control. Control and experimental animals were run on the same microplate. Data were calculated from the optical density (OD) change per minute, and the data are expressed in arbitrary units per milligram of protein per minute.

Immunocytochemistry

Activated satellite cells have incorporated BrdU into their DNA. Immunocytochemistry was used to identify immunopositive BrdU nuclei (555627, BD Biosciences, PharMingen, San Diego, CA), at a concentration of 10 µg/ml, by methods routinely used in our laboratory (18, 33, 35). BrdU will also label fibroblasts and other mitotically active cells in the interstitium. However, these cells would reside outside of muscle fibers. Labeled nuclei were quantified if they could clearly be associated with either the periphery or interior of a muscle fiber. All of the nuclei from six nonoverlapping fields were quantified with light microscopy at an objective magnification of ×40. The BrdU labeling index was expressed as a percent of the total nuclei and determined by: (the number of BrdU-positive nuclei associated with muscle fibers)/(labeled + unlabeled nuclei associated with muscle fibers) × 100.

PARP-1 is a zinc-finger nuclear protein activated by DNA breaks that are highly expressed in the nucleus (reviewed in Ref. 55). The enzyme poly(ADP-ribose) polymerase (PARP) uses beta -nicotinamide adenine dinucleotide (beta NAD+) to form nicotinamide and poly(ADP-ribose) polymers (54). Under basal conditions, PARP-1 participates in genome repair (20). During apoptosis, transient stimulation of PARP-1 causes poly(ADP-ribose) accumulation and a depletion of NAD+ and ATP and ultimately cell death (29). Caspases cleave PARP-1 into two fragments, of 24 and 89 kDa. PARP-positive nuclei were examined to determine if nuclei in loaded or unloaded muscles had undergone apoptosis. PARP-positive nuclei were identified by immunocytochemistry using a polyclonal rabbit, anti-PARP p85 fragment antibody (G7341, Promega, Madison, WI) at a dilution of 1:100 according to the manufacturer's recommendations. Color development was via routine immunocytochemistry using avidin-biotin and diaminobenzidine (PK6101, Vector Laboratories, Burlingame, CA). The nuclei were counterstained with hematoxylin (CATHE-M, Walnut Creek, CA). Data were expressed as a PARP labeling index. This was determined by counting the number of PARP-positive nuclei to total fibers/total number of nuclei × 100. The PARP index for each muscle was calculated from six nonoverlapping fields taken with a microscope objective of ×40.

Statistical Analyses

Data were examined with an ANOVA (time point × experimental condition) using SPSS software, version 10.0. The within-subject variable was experimental induction of hypertrophy/atrophy and the between-animal variable was time. Bonferroni post hoc analyses were conducted when significant time effects were found. Significance level was set at P < 0.05. For real-time PCR, Delta Delta CT > 2.0 represented significant differences from time 0. Data are presented as means ± SE.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Muscle Mass

Left PAT muscle mass was 14 ± 5, 23 ± 6, and 44 ± 10% greater than the corresponding right (control) muscles in 5W, 7W, and 14W birds, respectively. In group 2 birds, the left muscle mass was 17 ± 4% (P < 0.05) greater than control mass after 7 days of unweighting, but it was not different from control mass in 14U and 21U birds. Muscle mass in the left PAT of group 3 was 33 ± 2% (7R) and 34 ± 4% (14R) greater than right muscles (Fig. 1).


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 1.   Right (control) and left (experimental) muscle weights after 0, 5 (5W), 7 (7W), or 14 (14W) days of wing weighting or 7, 14, or 21 days of unweighting (7U, 14U, 21U) or following 14 days of loading and after reloading the wings for 7 (7R) or 14 (14R) days following 14 days of unloading. *P < 0.05, significantly different from the intra-animal control.

BrdU-Positive Nuclei

BrdU-positive nuclei associated with the muscle fibers (i.e., not fibroblasts) were taken to indicate activated satellite cells. BrdU-positive nuclei rarely were present in right PAT muscles of any birds. The BrdU labeling index was 5.3 and 7.4% of the total nuclei population in 7W and 14W birds, respectively (Fig. 2). The labeling index was 4.7, 3.9, and 1.8% in the left PAT muscles from 7U, 14U, and 21U birds, respectively, in group 2. The BrdU labeling index in left muscles in group 3 birds was 6.4 and 6.9% in 7R and 14R birds, respectively (Fig. 2).


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 2.   Subcutaneous bromodeoxyuridine (BrdU) pellet was implanted at the point of wing weighting. BrdU-positive nuclei were identified by immunocytochemistry. Hematoxylin counterstaining identified total nuclei. The labeling index was expressed as a percent of the labeled to total (labeled + unlabeled nuclei). Abbreviations for the time points are the same as in Fig. 1. *P < 0.05, significantly different from the intra-animal control. **P < 0.05, experimental muscles at 14W, 7R, and 14R are significantly different from experimental muscles at other time points.

Quantification of MyoD, Myogenin, and MLC mRNA

MyoD, myogenin, and MLC mRNA were determined via real-time PCR. A change of 2.0 in Delta Delta CT represents a twofold difference between the genes expressed in experimental and control muscles. A significant left-right muscle Delta Delta CT value was set at >2.0 to account for potential methodological errors inherent in real-time PCR quantification methods. The Delta Delta CT value for group 3 birds was <1.0 for MyoD and MLC at all time points examined (Fig. 3). Myogenin Delta Delta CT for group 3 birds was 1.1, 0.5, and 0.9 for 7U, 14U, and 21U birds, respectively. Wing unloading in group 3 birds weighting increased MyoD Delta Delta CT to 3.2, 3.1, and 2.2 in 5W, 7W, and 14W birds, respectively, and 3.4 and 2.2 in 7R and 14R birds, respectively (Fig. 3). Myogenin Delta Delta CT was 2.2, 3.4, and 16 in 5W, 7W, and 14W birds and 27 and 39 in 7R and 14R birds. MLC Delta Delta CT values did not exceed 2.0 until day 14 of stretch (5 W, 1.5; 7W, 0.9; 14W, 2.2). Delta Delta CT was 1.9 and 1.6 in 7R and 14R birds, respectively.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   MyoD and myogenin mRNA were measured via real-time PCR. Primers were made for MyoD, myogenin, and myosin light chain (MLC). Data are calculated as Delta CT by obtaining the average from duplicate runs for the CT for each gene of interest - cyclophilin CT for the sample. Delta Delta CT was calculated as left PAT muscle Delta CT - control (right) Delta CT for duplicate samples. Abbreviations for the time points are the same as in Fig. 1. Delta Delta CT levels > 2.0 are significantly different from time 0. * P < 0.05, significantly different from time 0 or the intra-animal control.

Quantification of Id2 mRNA Levels

Id2 Delta Delta CT was 2.2 in 5W birds and 1.8 in 7W birds of group 1 as determined by kinetic PCR. Id2 levels were similar to control in 14W birds. In group 2, Id2 Delta Delta CT was 3.9, 2.7, and 1.6 in 7U, 14U, and 21U birds, respectively. Id2 levels were similar in 21U and 7W birds. Id2 mRNA levels did not change in birds of group 3 (Fig. 4A).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4.   A: inhibitor of differentiation-2 (Id2) expression levels were determined by real-time PCR. Data are calculated as Id2 Delta CT by obtaining average from duplicate runs for Id2 CT - cyclophilin CT for the sample. Delta Delta CT was calculated as left patagialis (PAT) muscle Id2 Delta CT - control (right) Id2 Delta CT for duplicate samples. Abbreviations for time points are the same as in Fig. 1. **P < 0.05, 7U was significantly greater than all other times. Data with the same letter over respective bars indicate that they are not different from each other. Delta Delta CT levels > 2.0 are significantly different from time 0. B: Western blot following incubation with Id2. Sixty micrograms of protein were separated via 12% SDS-PAGE for 1.2 h and electroblotted to nitrocellulose. Incubation was with an anti-rabbit polyclonal antibody to Id2 (Santa Cruz, CA), and blot was developed with horseradish peroxidase-linked chemiluminescence (Pierce, IN). B, bottom: Ponceau S staining. This blot shows that similar protein loading occurred in each lane. Peptide control was not visible with Ponceau S staining at ~15 kDa, although other bands were visible. Nevertheless, strong immunopositive reaction occurred on the membrane in the 15-kDa position as shown in top gel. C: signals in each lane were quantified by Kodak 1D analysis software. Data are expressed as optical density (OD) × resulting band area and expressed in arbitrary units. *P < 0.05, unstretched control (0), or 5 (5W), 7 (7W), 14 (14W) days of weighting; 7 (7U), 14 (14U), or 21 (21U) days of unloading following 14 days of weighting; or 7 (7R) or 14 (14R) days of reloading following 14 days of unloading. P, control protein lysate.

Id2 Protein Levels

The Western blot OD × area data for each time point are given in Fig. 4B. Left-right Id2 protein levels were 3.1 in 5W birds from group 1. Left-right protein levels in 7W and 14W birds from group 1 were not statistically different from day 0, 7R, or 14R. Left-right OD × area data for 7U, 14U, and 21U birds in group 2 were 2.5, 2.4, and 1.7.

Indicators of Apoptosis

Caspase 3,7,10. Caspase 3,7,10 was 0.94 ± 4 arbitrary units (AU) · mg protein-1 · min-1 in control muscles at time 0. Left-right caspase levels decreased in muscles from 5W, 7W, and 14W birds to 0.55, 0.61, and 0.53, respectively. Left-right caspase levels increased to 2.14 and 1.41 in 7U and 14U days of unloading in group 2 birds, but caspase was similar in left and right muscles in 21U birds. Left-right muscle caspase was 0.94 and 0.79 in 7R and 14W birds from group 3 (Fig. 5A).


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5.   A: caspase 3,7,10 levels were estimated from muscle lysates and calculated as caspase arbitrary units (AU) · mg protein-1 · min-1. Right: ratio of left (experimental) to right (control) caspase levels. Abbreviations for time points are the same as in Fig. 1. *P < 0.05, data are significantly different from time 0 (unstretched control and intra-animal control data). **P < 0.05, caspase levels in muscle samples from 7U and 14U were greater than all other time points. B: caspase 8 was estimated from muscle lysates and calculated as caspase AU · mg protein-1 · min-1. Right: ratio of left (experimental) to right (control) caspase levels. Abbreviations for time points are the same as in Fig. 1. *P < 0.05, data are significantly different from control muscles at time 0. **P < 0.05, caspase 8 data from 7U was significantly greater than all other time points.

Caspase 8. Caspase 8 was 1.12 ± 0.11 AU · mg protein-1 · min-1. It was significantly lower in left PAT muscles from 14W birds (69 ± 2) relative to time 0. The ratio of left-right caspase 8 in group 1 was 0.81, 0.72, and 0.61 in 5W, 7W, and 14W, respectively. Left-right caspase 8 was 2.43, 1.86, and 1.51 in 7U, 14U, and 21U birds from group 2 and 1.08 and 0.71 in 7R and 14R birds from group 3 (Fig. 5B). Caspase 8 levels were significantly higher in left muscles from 7U, 14U, and 21U birds than time 0 or any loaded conditions.

PARP labeling. The 89-kDa fragment of cleaved PARP-1 was detected on frozen sections in experimental muscles from group 2 birds, but positive cells were not detected in control muscles or muscles from group 3 birds (Fig. 6). The PARP labeling index was 0.0 ± 0.1% in control muscles of all groups and in both group 1 and group 3 birds, but it was 21.9 ± 4.1, 11.9 ± 3.8, and 10.25 ± 2.4% in 7U, 14U, and 21U birds, respectively.


View larger version (69K):
[in this window]
[in a new window]
 
Fig. 6.   Frozen muscle sections were incubated with a polyclonal, rabbit, anti-PARP p85 fragment antibody. Color development was via routine immunocytochemistry using avidin-biotin and diaminobenzidine. Nuclei were counterstained with hematoxylin. Arrows indicate PARP-positive nuclei in muscles unweighted for 7 days, following 14 days of loading. PARP-positive nuclei were not found in control muscles or muscles during reloading.

Relationship of Id2 and Apoptosis

A strong positive correlation (r = 0.87) was found between caspase 8 and Id2 mRNA levels in unloaded muscles (Fig. 7). In general, caspase 8 and Id2 levels tended to be highest in 7U and Id2 mRNA declined proportionally to caspase 8 as the duration of unloading increased.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 7.   Relationship between the increase in Id2 mRNA (as measured by kinetic PCR and expressed as Delta Delta CT) and caspase 8 in lysates from muscles unloaded for 7 (7U), 14 (14U), or 21 (21U) days.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Loss of muscle under pathological conditions (1, 2) and limb unloading is associated with a decrease in nuclei number (5, 30, 41, 51), which occurs at least in part through activation of pathways leading to apoptosis (3). However, because experimental conditions of limb unloading previously used models that reduce muscle mass well below controls levels, we examined conditions where muscle mass is first increased by overload, then reduced toward control levels by unloading. In this study, we report that loss of muscle mass in nonpathological conditions where muscle mass is not reduced below control levels increases Id2 expression, concomitant with activation of apoptosis. These findings are consistent with the suggestion that one role of Id2 may be in pathways leading to apoptosis of skeletal muscle (8).

Muscle Unloading and Apoptosis

Several pieces of data confirm that apoptosis regulates muscle mass and MPC loss during wing unloading, where hypertrophied muscles lost mass and approached control mass levels. First, the BrdU labeling index declined during unweighting, compared with the initial 14 days of weighting-induced hypertrophy. This was not the result of loss of BrdU signaling from the nuclei, because we detected similar levels of BrdU-positive nuclei after 1 and 3 mo of constant weighting, where muscle mass does not increase following 21-30 days of stretch (unpublished data). The decline in the number of BrdU-positive nuclei during unweighting must be the result of either apoptosis or degeneration of satellite cells. Although we cannot know for certain if each satellite cell that had been activated during overload (group 1 birds) did not survive as a result of apoptosis, we did find PARP-positive nuclei and increased caspase levels in unloaded muscles, indicating that some of the nuclei must die via activation of pathways leading to apoptosis. The elevated caspases may have contributed to increased cleavage of PARP-1 (26), leading to an increased incidence of PARP-1-positive nuclei in unloaded muscles. Our data are consistent with that of Dirks and Leeuwenburgh (22) who recently showed strong correlations between caspase 3 and apoptotic markers in gastrocnemius from old rats, suggesting that mitochondrial pathways may be responsible for part of the apoptosis associated with muscle loss leading to sarcopenia. Nevertheless, because PARP-1 activity may trigger apoptosis via apoptosis initiating factor, which promotes apoptosis through a caspase-independent pathway (62), we cannot rule out the possibility that mitochondrial associated pathways may not be entirely responsible for the greater incidence of PARP-1 nuclei in unloaded muscles.

The data suggest that unloading may have activated the death domain receptor, TNF-alpha pathway, because caspase 8 was increased during unloading-stimulated muscle loss. If TNF-alpha pathways had not been stimulated, we would not have expected to find elevated caspase 8 levels in unloaded muscle samples (57, 58). TNF-alpha activation is thought to occur in sarcopenic muscles of elderly humans, and this is partially offset by a hypertrophic stimulus such as resistance exercise (27). Additional work is needed to clarify the role of the death domain receptor in regulation of caspases and apoptosis in unloading.

Id2 and Apoptosis

Id2 mRNA and protein levels are increased during the onset of unloading-associated apoptosis and muscle loss. The correlation between Id2 protein levels and caspase 8 levels was 0.87 in unloaded muscles. This is consistent with the idea that Id2 proteins have a role in apoptosis-associated muscle loss. This role may also extend to other members of the Id family, because Id1 has been shown to increase during denervation, which stimulated atrophy (17, 28). However, the relationship of Id1 and apoptosis was not examined.

The greatest loss of muscle mass occurred during the first 7 days of wing unloading. This corresponded to the highest expression of Id2 and caspase levels in unloaded muscles compared with other time points. Id2 expression declined in experimental muscles from 14U and 21U animals relative to 7U animals; nevertheless Id2 levels were still elevated above control levels throughout unloading. This is consistent with a role for Id2 in apoptosis-generated muscle loss, because we would expect Id2 to be high during large mass declines. The decrease in Id2 with prolonged unloading also fits with a role for Id2 in apoptosis because Id2 should decrease as the difference between the current mass and the control levels declines, and we would not expect muscle mass or Id2 in the left PAT to drop any lower than control (right) levels during unloading. We did not measure caspase 9 or Bax/Bcl2, so we do not know if mitochondria-initiated apoptosis via caspase pathways or death domain signaling pathways is primarily involved in regulating satellite cell or muscle fiber apoptosis during unloading-induced muscle loss as is the case in aging (22, 49).

Id2 and Satellite Cell Proliferation

The second purpose of the study was to determine if Id2 had a potential role in regulation of satellite cell proliferation of adult muscle. In this study, we found an increase in BrdU-positive nuclei during loading (group 1) and reloading (group 3). Because many of these nuclei presumably died during unloading, new satellite cells were recruited to sustain muscle growth during reloading in group 3 birds. There is evidence that Id proteins have an important role in the regulation of cell proliferation, and Id gene expression is enhanced in response to mitogenic stimuli (14, 19) and is associated with the induction of DNA synthesis (47). In addition, overexpression of Id inhibits differentiation and prolongs proliferation of cells of muscle lineages in culture (15, 16, 31, 32), but we do not know if this function is similar in vivo.

Fifty-two percent of the increase in the BrdU index at 14 days of loading occurred in the first 5 days of loading (Fig. 4) and this period corresponded to the greatest elevation in Id2 protein. Thus, these data indicate that Id2 levels are elevated during initial loading of fast quail muscles, when satellite cell activation is the greatest (18). Nevertheless, Id2 quickly returns to control levels during continued loading, during a time that the rate of satellite cell activation also declines. However, it is interesting that reloading (group 3) did not stimulate increases in Id2 mRNA or protein, even though the incidence of BrdU-positive nuclei was similar to the labeling index of group 1 birds and myogenin levels were high. Although satellite cell activation was dissociated from Id2 in group 3, we cannot rule out the possibility that Id2 had increased before our first time point (7R) that was examined during reloading.

Increases in MyoD and myogenin have been previously reported with loading of the PAT (37). MLC expression was significantly elevated for only 14W birds. In this study, we extended our previous findings by showing significant increases in MyoD and myogenin during loading (group 1) and reloading (group 3). It is not clear why MLC did not increase in reloaded muscles in group 3 birds, because MLC expression is at least partially controlled by MyoD (61) and MyoD was elevated during reloading. It is possible that the reloaded muscle conditions result in different adaptive patterns than initial loading. Another possibility is that the Delta Delta CT of 2.0 used for significance was too stringent, and the slightly smaller increase in MLC in left muscles of group 3 birds still represented a biologically important change in the reloaded muscle that was similar to loaded muscles in group 1 birds.

The elevation in myogenin corresponded to the period of decreasing Id2 in PAT muscles from group 1 birds. Id2 was not increased in left PAT muscles from group 3 birds, but myogenin was elevated to even greater levels than found for group 1. Further work is needed to determine if a high level of Id2 is directly linked to lower myogenin expression and delayed differentiation of activated satellite cells during the onset of overload.

Perspectives

Our data suggest that in young adult quail, Id2 may play a potential role in apoptosis-induced loss of muscle during unloading. The increases in Id2 were of a similar magnitude and time course as the increases in the caspase and PARP apoptotic markers. Although these results do not prove a causative role for Id2 in apoptosis in skeletal muscle following unweighting, it has been shown to at least partly play such a role in muscle damage and disease (21, 48, 52). Further experiments are required to establish if Id2 has a regulatory role in apoptosis of adult skeletal muscle via caspase regulation and/or the death domain receptor.

Myonuclei are postmitotic, and they cannot divide to contribute to muscle growth (39, 43). Therefore, satellite cells or their progeny MPC provide the only important source for adding new nuclei to initiate muscle regeneration, muscle hypertrophy, and postnatal muscle growth in muscles of both young and aged animals (53). Typically, muscles in mammals and birds that have a higher level of fast myosin heavy chain expression appear to be less dependent on adding new nuclei via MPCs than slow muscles (23, 41). This also appears to be the case for the PAT because limited acute hypertrophy can occur without marked activation of satellite cells in PAT quail muscles (33). However, sustained hypertrophy is prevented by irradiation that eliminates proliferation of MPCs (unpublished observations). In this study, we show that satellite cells are activated in modulating muscle remodeling in response to overload in the fast PAT. Nevertheless, the role of Id2 in regulating pathways associated with satellite cell activation in PAT muscles is less clear. Although Id2 may have a role in early stages of satellite cell proliferation, it appears that increased levels of Id2 are not required for satellite cell activation. Nevertheless, it is possible that Id2 increased transiently and earlier in reloading (group 3) than the initial loading phase (group 1).


    ACKNOWLEDGEMENTS

The authors appreciate excellent technical help that was provided by S. Ong.


    FOOTNOTES

These studies were supported by National Institutes of Health Grant AG-17143 to S. E. Alway.

Address for reprint requests and other correspondence: S. E. Alway, Laboratory of Muscle, Sarcopenia and Muscle Diseases, Division of Exercise Physiology, West Virginia Univ. School of Medicine, Robert C. Byrd Health Science Center, Morgantown, WV 26506-9227 (E-mail: salway{at}hsc.wvu.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published October 17, 2002;10.1152/ajpregu.00550.2002

Received 6 September 2002; accepted in final form 16 October 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Adams, V, Gielen S, Hambrecht R, and Schuler G. Apoptosis in skeletal muscle. Front Biosci 6: D1-D11, 2001[Web of Science][Medline].

2.   Adams, V, Lenk K, Schubert A, Gielen S, Schuler G, and Hambrecht R. Differentially expressed genes in L6 rat skeletal muscle myoblasts after incubation with inflammatory cytokines. Cytokine 13: 342-348, 2001[Web of Science][Medline].

3.   Allen, DL, Linderman JK, Roy RR, Bigbee AJ, Grindeland RE, Mukku V, and Edgerton VR. Apoptosis: a mechanism contributing to remodeling of skeletal muscle in response to hindlimb unweighting. Am J Physiol Cell Physiol 273: C579-C587, 1997[Abstract/Free Full Text].

4.   Allen, DL, Monke SR, Talmadge RJ, Roy RR, and Edgerton VR. Plasticity of myonuclear number in hypertrophied and atrophied mammalian skeletal muscle fibers. J Appl Physiol 78: 1969-1976, 1995[Abstract/Free Full Text].

5.   Allen, DL, Roy RR, and Edgerton VR. Myonuclear domains in muscle adaptation and disease. Muscle Nerve 22: 1350-1360, 1999[Web of Science][Medline].

6.   Alway, SE. Perpetuation of muscle fibers after removal of stretch in the Japanese quail. Am J Physiol Cell Physiol 260: C400-C408, 1991[Abstract/Free Full Text].

7.   Alway, SE. Attenuation of Ca(2+)-activated ATPase and shortening velocity in hypertrophied fast twitch skeletal muscle from aged Japanese quail. Exp Gerontol 37: 665-678, 2002[Web of Science][Medline].

8.   Alway, SE, Degens H, Krishnamurthy G, and Smith CA. Potential role for Id myogenic repressors in apoptosis and attenuation of hypertrophy in muscles of aged rats. Am J Physiol Cell Physiol 283: C66-C76, 2002[Abstract/Free Full Text].

9.   Alway, SE, Degens H, Lowe DA, and Krishnamurthy G. Increased myogenic repressor Id mRNA and protein levels in hindlimb muscles of aged rats. Am J Physiol Regul Integr Comp Physiol 282: R411-R422, 2002[Abstract/Free Full Text].

10.   Alway, SE, Lowe DA, and Chen KD. The effects of age and hindlimb suspension on the levels of expression of the myogenic regulatory factors MyoD and myogenin in rat fast and slow skeletal muscles. Exp Physiol 86: 509-517, 2001[Abstract].

11.   Alway, SE, Winchester PK, Davis ME, and Gonyea WJ. Regionalized adaptations and muscle fiber proliferation in stretch- induced enlargement. J Appl Physiol 66: 771-781, 1989[Abstract/Free Full Text].

12.   American Physiological Society. Guiding principles for research involving animals and human beings. Am J Physiol Regul Integr Comp Physiol 283: R281-R283, 2002[Free Full Text].

13.   Ashmore, CR, Lee YB, Summers P, and Hitchcock L. Stretch-induced growth in chicken wing muscles: nerve-muscle interaction in muscular dystrophy. Am J Physiol Cell Physiol 246: C378-C384, 1984[Abstract/Free Full Text].

14.   Barone, MV, Pepperkok R, Peverali FA, and Philipson L. Id proteins control growth induction in mammalian cells. Proc Natl Acad Sci USA 91: 4985-4988, 1994[Abstract/Free Full Text].

15.   Benezra, R, Davis RL, Lassar A, Tapscott S, Thayer M, Lockshon D, and Weintraub H. Id: a negative regulator of helix-loop-helix DNA binding proteins. Control of terminal myogenic differentiation. Ann NY Acad Sci 599: 1-11, 1990[Medline].

16.   Biederer, CH, Ries SJ, Moser M, Florio M, Israel MA, McCormick F, and Buettner R. The basic helix-loop-helix transcription factors myogenin and Id2 mediate specific induction of caveolin-3 gene expression during embryonic development. J Biol Chem 275: 26245-26251, 2000[Abstract/Free Full Text].

17.   Carlsen, H, and Gundersen K. Helix-loop-helix transcription factors in electrically active and inactive skeletal muscles. Muscle Nerve 23: 1374-1380, 2000[Web of Science][Medline].

18.   Carson, JA, and Alway SE. Stretch overload-induced satellite cell activation in slow tonic muscle from adult and aged Japanese quail. Am J Physiol Cell Physiol 270: C578-C584, 1996[Abstract/Free Full Text].

19.   Christy, BA, Sanders LK, Lau LF, Copeland NG, Jenkins NA, and Nathans D. An Id-related helix-loop-helix protein encoded by a growth factor- inducible gene. Proc Natl Acad Sci USA 88: 1815-1819, 1991[Abstract/Free Full Text].

20.   D'Amours, D, Sallmann FR, Dixit VM, and Poirier GG. Gain-of-function of poly(ADP-ribose) polymerase-1 upon cleavage by apoptotic proteases: implications for apoptosis. J Cell Sci 114: 3771-3778, 2001[Medline].

21.   Dalla, LL, Sabbadini R, Renken C, Ravara B, Sandri M, Betto R, Angelini A, and Vescovo G. Apoptosis in the skeletal muscle of rats with heart failure is associated with increased serum levels of TNF-alpha and sphingosine. J Mol Cell Cardiol 33: 1871-1878, 2001[Web of Science][Medline].

22.   Dirks, A, and Leeuwenburgh C. Apoptosis in skeletal muscle with aging. Am J Physiol Regul Integr Comp Physiol 282: R519-R527, 2002[Abstract/Free Full Text].

23.   Dupont-Versteegden, EE, Murphy RJ, Houle JD, Gurley CM, and Peterson CA. Mechanisms leading to restoration of muscle size with exercise and transplantation after spinal cord injury. Am J Physiol Cell Physiol 279: C1677-C1684, 2000[Abstract/Free Full Text].

24.   Fitts, RH, Metzger JM, Riley DA, and Unsworth BR. Models of disuse: a comparison of hindlimb suspension and immobilization. J Appl Physiol 60: 1946-1953, 1986[Abstract/Free Full Text].

25.   Florio, M, Hernandez MC, Yang H, Shu HK, Cleveland JL, and Israel MA. Id2 promotes apoptosis by a novel mechanism independent of dimerization to basic helix-loop-helix factors. Mol Cell Biol 18: 5435-5444, 1998[Abstract/Free Full Text].

26.   Germain, M, Affar EB, D'Amours D, Dixit VM, Salvesen GS, and Poirier GG. Cleavage of automodified poly(ADP-ribose) polymerase during apoptosis. Evidence for involvement of caspase-7. J Biol Chem 274: 28379-28384, 1999[Abstract/Free Full Text].

27.   Greiwe, JS, Cheng B, Rubin DC, Yarasheski KE, and Semenkovich CF. Resistance exercise decreases skeletal muscle tumor necrosis factor alpha in frail elderly humans. FASEB J 15: 475-482, 2001[Abstract/Free Full Text].

28.   Gundersen, K, and Merlie JP. Id-1 as a possible transcriptional mediator of muscle disuse atrophy. Proc Natl Acad Sci USA 91: 3647-3651, 1994[Abstract/Free Full Text].

29.   Ha, HC, Hester LD, and Snyder SH. Poly(ADP-ribose) polymerase-1 dependence of stress-induced transcription factors and associated gene expression in glia. Proc Natl Acad Sci USA 99: 3270-3275, 2002[Abstract/Free Full Text].

30.   Hikida, RS, Van Nostran S, Murray JD, Staron RS, Gordon SE, and Kraemer WJ. Myonuclear loss in atrophied soleus muscle fibers. Anat Rec 247: 350-354, 1997[Medline].

31.   Jen, Y, Weintraub H, and Benezra R. Overexpression of Id protein inhibits the muscle differentiation program: in vivo association of Id with E2A proteins. Genes Dev 6: 1466-1479, 1992[Abstract/Free Full Text].

32.   Lasorella, A, Noseda M, Beyna M, Yokota Y, and Iavarone A. Id2 is a retinoblastoma protein target and mediates signalling by Myc oncoproteins. Nature 407: 592-598, 2000[Medline].

33.   Lee, J, and Alway SE. Adaptations of myonuclei to hypertrophy in patagialis muscle fibers from aged quail. Mech Ageing Dev 88: 185-197, 1996[Web of Science][Medline].

34.   Livak, KJ, and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2[-Delta Delta C(T)] Method. Methods 25: 402-408, 2001[Web of Science][Medline].

35.   Lowe, DA, and Alway SE. Stretch-induced myogenin, MyoD, and MRF4 expression and acute hypertrophy in quail slow-tonic muscle are not dependent upon satellite cell proliferation. Cell Tissue Res 296: 531-539, 1999[Web of Science][Medline].

36.   Lowe, DA, and Alway SE. Animal models for inducing muscle hypertrophy: are they relevant for clinical applications in humans? J Orthop Sports Phys Ther 32: 36-43, 2002[Web of Science][Medline].

37.   Lowe, DA, Lund T, and Alway SE. Hypertrophy-stimulated myogenic regulatory factor mRNA increases are attenuated in fast muscle of aged quails. Am J Physiol Cell Physiol 275: C155-C162, 1998[Abstract/Free Full Text].

38.   Matsumura, ME, Lobe DR, and McNamara CA. Contribution of the helix-loop-helix factor Id2 to regulation of vascular smooth muscle cell proliferation. J Biol Chem 277: 7293-7297, 2002[Abstract/Free Full Text].

39.   Mauro, A. Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol 9: 493-495, 1961[Medline].

40.   Melnikova, IN, Bounpheng M, Schatteman GC, Gilliam D, and Christy BA. Differential biological activities of mammalian Id proteins in muscle cells. Exp Cell Res 247: 94-104, 1999[Web of Science][Medline].

41.   Mitchell, PO, and Pavlath GK. A muscle precursor cell-dependent pathway contributes to muscle growth after atrophy. Am J Physiol Cell Physiol 281: C1706-C1715, 2001[Abstract/Free Full Text].

42.   Mori, S, Nishikawa SI, and Yokota Y. Lactation defect in mice lacking the helix-loop-helix inhibitor Id2. EMBO J 19: 5772-5781, 2000[Web of Science][Medline].

43.   Moss, FP, and Leblond CP. Satellite cells as the source of nuclei in muscles of growing rats. Anat Rec 170: 421-435, 1971[Medline].

44.   Norton, JD. ID helix-loop-helix proteins in cell growth, differentiation and tumorigenesis. J Cell Sci 113: 3897-3905, 2000[Abstract].

45.   Norton, JD, and Atherton GT. Coupling of cell growth control and apoptosis functions of Id proteins. Mol Cell Biol 18: 2371-2381, 1998[Abstract/Free Full Text].

46.   Parrinello, S, Lin CQ, Murata K, Itahana Y, Singh J, Krtolica A, Campisi J, and Desprez PY. Id-1, itf-2, and id-2 comprise a network of helix-loop-helix proteins that regulate mammary epithelial cell proliferation, differentiation, and apoptosis. J Biol Chem 276: 39213-39219, 2001[Abstract/Free Full Text].

47.   Peverali, FA, Basdra EK, and Papavassiliou AG. Stretch-mediated activation of selective MAPK subtypes and potentiation of AP-1 binding in human osteoblastic cells. Mol Med 7: 68-78, 2001[Web of Science][Medline].

48.   Podhorska-Okolow, M, Sandri M, Zampieri S, Brun B, Rossini K, and Carraro U. Apoptosis of myofibres and satellite cells: exercise-induced damage in skeletal muscle of the mouse. Neuropathol Appl Neurobiol 24: 518-531, 1998[Web of Science][Medline].

49.   Pollack, M, Phaneuf S, Dirks A, and Leeuwenburgh C. The role of apoptosis in the normal aging brain, skeletal muscle, and heart. Ann NY Acad Sci 959: 93-107, 2002[Web of Science][Medline].

50.   Price, SR, and Mitch WE. Mechanisms stimulating protein degradation to cause muscle atrophy. Curr Opin Clin Nutr Metab Care 1: 79-83, 1998[Medline].

51.   Roy, RR, Monke SR, Allen DL, and Edgerton VR. Modulation of myonuclear number in functionally overloaded and exercised rat plantaris fibers. J Appl Physiol 87: 634-642, 1999[Abstract/Free Full Text].

52.   Sandri, M, and Carraro U. Apoptosis of skeletal muscles during development and disease. Int J Biochem Cell Biol 31: 1373-1390, 1999[Web of Science][Medline].

53.   Schultz, E, and McCormick KM. Skeletal muscle satellite cells. Rev Physiol Biochem Pharmacol 123: 213-257, 1994[Web of Science][Medline].

54.   Soldani, C, Lazze MC, Bottone MG, Tognon G, Biggiogera M, Pellicciari CE, and Scovassi AI. Poly(ADP-ribose) polymerase cleavage during apoptosis: when and where? Exp Cell Res 269: 193-201, 2001[Web of Science][Medline].

55.   Soldani, C, and Scovassi AI. Poly(ADP-ribose) polymerase-1 cleavage during apoptosis: an update. Apoptosis 7: 321-328, 2002[Web of Science][Medline].

56.   Summers, PJ, Ashmore CR, Lee YB, and Ellis S. Stretch-induced growth in chicken wing muscles: role of soluble growth-promoting factors. J Cell Physiol 125: 288-294, 1985[Web of Science][Medline].

57.   Sun, XM, Bratton SB, Butterworth M, MacFarlane M, and Cohen GM. Bcl-2 and Bcl-xL inhibit CD95-mediated apoptosis by preventing mitochondrial release of Smac/DIABLO and subsequent inactivation of X-linked inhibitor-of-apoptosis protein. J Biol Chem 277: 11345-11351, 2002[Abstract/Free Full Text].

58.   Sun, XM, MacFarlane M, Zhuang J, Wolf BB, Green DR, and Cohen GM. Distinct caspase cascades are initiated in receptor-mediated and chemical-induced apoptosis. J Biol Chem 274: 5053-5060, 1999[Abstract/Free Full Text].

59.   Tanaka, K, Pracyk JB, Takeda K, Yu ZX, Ferrans VJ, Deshpande SS, Ozaki M, Hwang PM, Lowenstein CJ, Irani K, and Finkel T. Expression of Id1 results in apoptosis of cardiac myocytes through a redox-dependent mechanism. J Biol Chem 273: 25922-25928, 1998[Abstract/Free Full Text].

60.   Thompson, LV, Johnson SA, and Shoeman JA. Single soleus muscle fiber function after hindlimb unweighting in adult and aged rats. J Appl Physiol 84: 1937-1942, 1998[Abstract/Free Full Text].

61.   Wentworth, BM, Donoghue M, Engert JC, Berglund EB, and Rosenthal N. Paired MyoD-binding sites regulate myosin light chain gene expression. Proc Natl Acad Sci USA 88: 1242-1246, 1991[Abstract/Free Full Text].

62.   Yu, SW, Wang H, Poitras MF, Coombs C, Bowers WJ, Federoff HJ, Poirier GG, Dawson TM, and Dawson VL. Mediation of poly(ADP-ribose) polymerase-1-dependent cell death by apoptosis-inducing factor. Science 297: 259-263, 2002[Abstract/Free Full Text].

63.   Zarzhevsky, N, Menashe O, Carmeli E, Stein H, and Reznick AZ. Capacity for recovery and possible mechanisms in immobilization atrophy of young and old animals. Ann NY Acad Sci 928: 212-225, 2001[Web of Science][Medline].


Am J Physiol Regul Integr Comp Physiol 284(2):R540-R549
0363-6119/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
J. Physiol.Home page
K. Gundersen and J. C. Bruusgaard
Nuclear domains during muscle atrophy: nuclei lost or paradigm lost?
J. Physiol., June 1, 2008; 586(11): 2675 - 2681.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
P. M. Siu, E. E. Pistilli, Z. Murlasits, and S. E. Alway
Hindlimb unloading increases muscle content of cytosolic but not nuclear Id2 and p53 proteins in young adult and aged rats
J Appl Physiol, March 1, 2006; 100(3): 907 - 916.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
P. M. Siu and S. E. Alway
Subcellular responses of p53 and Id2 in fast and slow skeletal muscle in response to stretch-induced overload
J Appl Physiol, November 1, 2005; 99(5): 1897 - 1904.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P. M. Siu and S. E. Alway
Age-related apoptotic responses to stretch-induced hypertrophy in quail slow-tonic skeletal muscle
Am J Physiol Cell Physiol, November 1, 2005; 289(5): C1105 - C1113.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
P. M. Siu, E. E. Pistilli, and S. E. Alway
Apoptotic responses to hindlimb suspension in gastrocnemius muscles from young adult and aged rats
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2005; 289(4): R1015 - R1026.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
P. M. Siu, E. E. Pistilli, M. J. Ryan, and S. E. Alway
Aging Sustains the Hypertrophy-Associated Elevation of Apoptotic Suppressor X-Linked Inhibitor of Apoptosis Protein (XIAP) in Skeletal Muscle During Unloading
J. Gerontol. A Biol. Sci. Med. Sci., August 1, 2005; 60(8): 976 - 983.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P. M. Siu and S. E. Alway
Id2 and p53 participate in apoptosis during unloading-induced muscle atrophy
Am J Physiol Cell Physiol, May 1, 2005; 288(5): C1058 - C1073.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P. M. Siu, E. E. Pistilli, D. C. Butler, and S. E. Alway
Aging influences cellular and molecular responses of apoptosis to skeletal muscle unloading
Am J Physiol Cell Physiol, February 1, 2005; 288(2): C338 - C349.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. J. Rorie, V. D. Thomas, P. Chen, H. H. Pierce, J. P. O'Bryan, and B. E. Weissman
The Ews/Fli-1 Fusion Gene Switches the Differentiation Program of Neuroblastomas to Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumors
Cancer Res., February 15, 2004; 64(4): 1266 - 1277.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
S. E. Alway, H. Degens, G. Krishnamurthy, and A. Chaudhrai
Denervation Stimulates Apoptosis But Not Id2 Expression in Hindlimb Muscles of Aged Rats
J. Gerontol. A Biol. Sci. Med. Sci., August 1, 2003; 58(8): B687 - 697.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. Selman and C. Leeuwenburgh
The role of Id2 and apoptosis during skeletal muscle remodeling
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2003; 284(2): R538 - R539.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/2/R540    most recent
00550.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (25)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alway, S. E.
Right arrow Articles by Murlasits, Z. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alway, S. E.
Right arrow Articles by Murlasits, Z. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online