AJP - Regu Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 284: R1213-R1218, 2003. First published January 16, 2003; doi:10.1152/ajpregu.00434.2002
0363-6119/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/5/R1213    most recent
00434.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zimmerman, M. A.
Right arrow Articles by Selzman, C. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zimmerman, M. A.
Right arrow Articles by Selzman, C. H.
Vol. 284, Issue 5, R1213-R1218, May 2003

Relative contribution of the TNF-alpha receptors to murine intimal hyperplasia

Michael A. Zimmerman1, Leonid L. Reznikov2, Amy C. Sorensen1, and Craig H. Selzman1

Divisions of 1 Cardiothoracic Surgery and 2 Infectious Disease, University of Colorado Health Sciences Center, Denver, Colorado 80262


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Tumor necrosis factor-alpha (TNF-alpha ) is an important mediator in the inflammatory response to vascular injury. The present study sought to determine the relative contribution of each TNF-alpha receptor subtype (p55 and p75) to intimal hyperplasia (IH) and characterize the mechanisms of transcriptional regulation after vascular injury. A murine model of wire carotid arterial injury was employed to induce IH in wild-type (WT), p55-deficient (p55-/-), and p75-deficient (p75-/-) mice. Compared with injured WT and p75-/- animals, p55-/- mice demonstrated a twofold reduction in IH. Additionally, p55-/- mice demonstrated a decrease in expression of nuclear factor-kappa B mRNA and protein. These observations suggest an important role for the p55 receptor in IH after mechanical endoluminal injury. Suppression of the transcriptional activator nuclear factor-kappa B may provide a mechanism by which p55-mediated IH is attenuated.

vasculature; restenosis; carotid arteries


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

TUMOR NECROSIS FACTOR (TNF)-alpha is an important mediator of the inflammatory response to vascular injury (6, 18, 25). In vitro, TNF-alpha induces adhesion molecule expression, promotes monocyte cytokine release, and stimulates vascular smooth muscle cell (VSMC) proliferation (15, 24). In vivo, TNF-alpha has been causally linked to intimal hyperplasia (IH) in vein graft and low-shear-stress models (3, 16). TNF-alpha exerts its downstream effects via activation of two cell surface receptors, TNF receptor types 1 and 2 (p55 and p75, respectively) (10). The p55 receptor transduces an array of proinflammatory signals, resulting in adhesion molecule expression and monocyte/macrophage activation (4, 7, 13). Although signaling through p75 has been linked to T lymphocyte proliferation, it had no effect on cytokine or adhesion molecule expression (5, 11). The relative contribution of each receptor subtype to the development of IH is unknown.

TNF-alpha activates the transcriptional regulator nuclear factor-kappa B (NF-kappa B), subsequently promoting the expression of numerous proinflammatory genes. Although both receptor subtypes may activate NF-kappa B, the respective signaling pathways are distinct to each receptor and may vary with different cell types and conditions (8). In addition, the net effect of NF-kappa B activation may differ depending on the receptor stimulated. In particular, p55-mediated activation of NF-kappa B prevents cell death (9). Failure to activate NF-kappa B in p55-deficient mice was linked to endotoxin resistance (14). Although TNF-alpha stimulation of p75 may result in NF-kappa B activation in vitro (20), the downstream effects are not well characterized. The influence of each TNF receptor to NF-kappa B activation has not been evaluated in an in vivo model of vascular injury.

We previously demonstrated that TNF-alpha deficiency results in attenuation of IH after murine carotid arterial injury (27). Furthermore, arterial injury in TNF-deficient mice was associated with decreased expression of NF-kappa B mRNA, NF-kappa B protein, basic fibroblast growth factor, and monocyte chemotactic factor-1. The purpose of the present study was to extend these observations and determine the relative contribution of each TNF-alpha receptor subtype (p55 and p75) to the inflammatory response to vascular injury and IH.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Murine model of carotid injury. This study utilized 8-wk-old, 25- to 30-g, male wild-type (WT) C57BL/6J mice, TNF p55-deficient (p55-/-) mice (B6.129-Tnfrsf1atm1Mak strain; Jackson Laboratory, Bar Harbor, ME), and TNF p75-deficient (p75-/-) mice (B6.129-Tnfrsf1btm1Mwm strain; Jackson Laboratory). Both receptor-deficient groups (p55-/- and p75-/-) have been backcrossed onto the C57BL/6J strain (2, 14). All experimental protocols were approved by the University of Colorado Animal Review Committee. General anesthesia was achieved by intraperitoneal administration of ketamine (80 mg/kg; Fort Dodge Laboratories, Fort Dodge, IA) and xylazine (20 mg/kg; Phoenix Pharmaceutical, St. Joseph, MO). Murine common carotid injury was performed as previously described (27). Euthanasia was performed according to the guidelines set forth by the American Veterinary Medical Association Panel on Euthanasia with general anesthesia and pentobarbital sodium (100 mg/kg). For morphometric analysis, animals were killed at 28 days and received an intracardiac injection of 500 µl of heparinized saline followed by 4% paraformaldehyde. Inasmuch as transcription factor expression and activation occur much earlier than the resultant morphological changes, animals to be studied for NF-kappa B were euthanized at 3 days. Animal care was provided by the University of Colorado animal facility.

IH and morphometric analysis. The right and left common carotid arteries were harvested, embedded in paraffin, and sectioned for hematoxylin and eosin or elastin staining. Serial sections were taken along the length of the vessel at 150-µm intervals. Qualitative review of these specimens revealed the area of greatest luminal stenosis. At this point, 20-30 sections were taken at 4-µm intervals; multiple samples (6-8) were subjected to quantitative morphometric analysis. Plain images were taken on the confocal microscope, and the following structures were identified: lumen, internal elastic lamina (IEL), external elastic lamina, and neointima. Intimal (specimen from lumen to IEL) and medial areas (specimen from IEL to external elastic lamina) were measured using Slidebook software (version 3.0.2.12). Intimal-to-medial ratios were also calculated.

Sections stained for muscle-specific actin were treated as previously described (23). Briefly, at 28 days, paraffin-embedded samples were deparaffinized with xylene and PBS washes. After proteolysis with pronase (Sigma Chemical, St. Louis, MO), samples were incubated with muscle-specific actin primary polyclonal antibody (Enzo Diagnostics, Farmingdale, NY) for 10 min. After PBS washes, secondary incubation was performed with the peroxidase-antiperoxidase technique.

Immunohistochemistry. Three days after injury, bilateral common carotid arteries were isolated and removed. The right common carotid arteries were examined as uninjured contralateral controls. All tissue was immediately preserved in tissue freezing medium (Triangle Biomedical Sciences, Durham, NC). Slides were fixed in 70% acetone-30% methanol solution for 10 min. After the slides were air-dried, they were washed three times in PBS for 10 min. Specimens were blocked with 10% goat serum for 1 h at room temperature and then incubated at 4°C overnight with rabbit anti-mouse NF-kappa B p65 polyclonal IgG (Santa Cruz Biotechnology, Santa Cruz, CA). After the sections were washed three times in PBS, they were incubated for 1 h in the dark at room temperature in Cy3-labeled goat anti-rabbit IgG. Negative controls were run in parallel with all sections by substitution of a nonspecific rabbit anti-mouse antibody. Cell wall glycoproteins and nuclei were stained with Alexa green wheat germ agglutinin-488 (Molecular Probes, Eugene, OR) and bis-benzimide (Sigma Chemical), respectively. Fluorescent images were evaluated and photographed with appropriate filter cubes using an automated Leica DMRXA confocal microscope with full software control (Intelligent Image Innovations).

Reverse transcriptase-quantitative PCR. Three days after injury, RT-PCR was performed on individual arterial samples as previously described (27). Briefly, total RNA was isolated using an mRNA isolation kit (Ambion, Austin, TX) and then the samples were treated with DNase. The primers for the NF-kappa B p65 subunit were as follows: AGATCTTCTTGCTGTGCGACAA (forward) and GTGCCTCCCAGCCTGGT (reverse). By using an mRNA 18S target probe as an internal control, the relative number of amplified target DNA copies was calculated. Values are expressed as a relative fold increase of mRNA in the injured arteries vs. contralateral controls.

NF-kappa B ELISA. A transcription factor assay was used to investigate NF-kappa B p65 subunit activity in individual arterial specimens as previously described (27). This assay is based on the specific binding of the active form of NF-kappa B from tissue extract to an NF-kappa B consensus site oligonucleotide attached to the plate and has been shown to be 10-fold more sensitive than electrophoretic mobility shift assay (17).

Carotid specimens from WT, p55-/-, and p75-/- mice were skeletonized, harvested bilaterally, and fixed at -70°C. The tissue was diced into small pieces with a cooled razor blade and placed in lysis buffer. A mechanical homogenizer was then applied for 30 s, maintaining a temperature of 4°C. Samples were incubated on ice for 30 min and centrifuged at 10,000 g for 10 min. Supernatants were transferred to separate tubes and recentrifuged. Tissue protein content was measured by the Coomassie protein assay (Pierce, Rockford, IL). Twenty micrograms of total protein were loaded onto each well and assayed according to the manufacturer's directions (Active Motif, Carlsbad, CA). Positive controls for the NF-kappa B p65 subunit were provided from cellular extract previously evaluated by ELISA and electrophoretic mobility shift assay. To enhance the sensitivity of the assay, WT and mutated consensus oligonucleotides were employed in each reaction. Quantification of the NF-kappa B p65 subunit was expressed as mean absorbance per arterial sample.

Statistical analysis. Values are means ± SE. Analysis of variance with Bonferroni-Dunn post hoc analysis was used to analyze differences between experimental groups. Statistical significance was accepted within 95% confidence limits.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

TNF receptors and IH. The effects of vascular injury were examined in WT, p55-/-, and p75-/- mice. Qualitatively, p55-/- animals had less hyperplasia than WT and p75-/- mice (Fig. 1). Quantitatively, the intimal area of the WT (n = 6) injured vessels was greater than that of the noninjured vessels (18.6 ± 2.3 × 103 vs. 0.7 ± 0.2 × 103 µm2, P < 0.05; Fig. 2). Compared with the WT mice, injured p55-/- (n = 6) animals demonstrated a twofold reduction in intimal area (18.6 ± 2.3 × 103 vs. 9.7 ± 1.5 × 103 µm2, P < 0.05). Importantly, there was no difference in intimal area between injured WT and p75-/- (n = 6) specimens (18.6 ± 2.3 × 103 vs. 20.1 ± 4.2 × 103 µm2, P = 0.27).


View larger version (105K):
[in this window]
[in a new window]
 
Fig. 1.   Vascular injury and intimal hyperplasia (IH). At 28 days after vascular injury, mouse carotid arteries were sectioned and examined by microscopy (×100). Intimal area of injured wild-type (WT) specimens (A, elastin stain) was greater than on the noninjured contralateral side (B, elastin stain). Scale bar, 50 µm. Mice deficient in p55 (C, hematoxylin stain) develop minimal IH compared with WT and p75-deficient (p75-/-) mice (D, hematoxylin stain).



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 2.   Vascular injury and intimal area. At 28 days after vascular injury, WT mice developed an increase in intimal area compared with noninjured controls (n = 6). *P < 0.05. Animals deficient in p55 (p55-/-) demonstrate a 2-fold decrease in intimal area compared with injured WT and p75-/- animals (n = 6). **P < 0.05. However, intimal area in injured p55-/- mice was still elevated compared with uninjured contralateral control. dagger P < 0.05. +, Carotid injury; -, no injury.

To verify that these differences were exclusively related to intimal changes, we also measured medial areas and calculated intimal-to-medial ratios. There were no differences in medial areas between injured groups. Furthermore, intimal-to-medial ratios support exclusive intimal proliferation. The WT injured vessels demonstrated a twofold increase in the intimal-to-medial ratio compared with the injured p55-/- vessels (1.55 ± 0.2 vs. 0.8 ± 0.07, P < 0.05).

We previously implied that TNF signaling was important in VSMC proliferation. Therefore, we wished to characterize the influence of TNF and its receptors on VSMC expression in vivo. Indeed, we observed that uninjured control samples stained positive for muscle cell-specific actin in the tunica media (Fig. 3). The neointima of WT and TNF p55-/- mice stained heavily for muscle-specific actin.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 3.   IH and smooth muscle cells. At 28 days after vascular injury, carotid arteries were sectioned and examined by microscopy (×400). Uninjured sections contained muscle cell-specific actin in the tunica media (A). p55-/- (B) and WT (C) vessels contain actin in tunica media and neointima. IEL, internal elastic lamina.

p55 receptor and NF-kappa B. We utilized several methods to characterize the influence of the p55 receptor on NF-kappa B activation. As shown in Fig. 4A, 72 h after injury, NF-kappa B mRNA was 5.5-fold higher in the injured WT (n = 3) than in the contralateral control and p55-/- animals (n = 3, P < 0.05). Immunohistochemically, NF-kappa B was identified in the intima and media of WT and p55-/- animals (Fig. 4B). Mean integrated Cy3 intensity/vessel area (µm2) of the injured WT mice demonstrated a twofold increase compared with the injured p55-/- sections. An intranuclear signal could be identified at the site of injury. Results were consistent across multiple sections in three separate animals.


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 4.   Vascular injury and nuclear factor-kappa B (NF-kappa B). A: RT-PCR was performed for NF-kappa B p65 mRNA 3 days after injury. Values are expressed as a relative fold increase in mRNA in injured specimens vs. uninjured controls. Compared with contralateral controls, injured WT mRNA expression was markedly elevated (*P < 0.05). Injured p55-/- specimens demonstrated a decrease in mRNA expression compared with injured WT (**P < 0.05). B: immunofluorescence (×40) revealed a 2-fold increase in mean NF-kappa B-labeled Cy3-integrated intensity/vessel area (µm2) in injured WT vs. p55-/- samples. Intranuclear NF-kappa B was localized at the site of vascular injury in the WT. C: unbound NF-kappa B p65 subunit [absorbance (lambda )/sample] was determined by ELISA. WT mice exhibited a 5-fold increase in NF-kappa B p65 vs. uninjured contralateral control (*P < 0.05). p55-/- injured animals had less NF-kappa B p65 than WT animals (**P < 0.05). However, NF-kappa B in injured p55-/- animals was still elevated compared with uninjured contralateral control (dagger P < 0.05). There were no differences in absorbance between injured WT and injured p75-/- mice.

We next measured unbound NF-kappa B p65 subunit protein in individual arteries (Fig. 4C). WT (n = 3) injured specimens maintain a fivefold increase in unbound p65 absorbance compared with the contralateral control (3.1 ± 0.65 vs. 0.65 ± 0.33, P < 0.05). Compared with WT mice, injury in p55-/- mice (n = 3) resulted in a twofold decrease in NF-kappa B absorbance (3.1 ± 0.65 vs. 1.65 ± 0.33, P < 0.05). There was no difference in absorbance between the injured p75-/- (n = 3) and WT (2.7 ± 0.55 vs. 3.1 ± 0.65) animals. To monitor the specificity of the assay, a WT and a mutated p65-specific consensus oligonucleotide were used. When added to the reaction, the WT oligonucleotide consistently prevented p65 binding to the plate and resulted in zero absorbance at 450 nm. Mutated consensus oligonucleotide had no effect.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The p55 receptor subtype promotes expression of cytokines and adhesion molecules and stimulates cell proliferation (11). Early observations suggested that the p55 receptor was the primary mediator of nonspecific immune responses, inasmuch as p55-deficient mice were resistant to lethal doses of lipopolysaccharide (19). Conversely, despite this link between p55 and inflammation, Tartaglia and colleagues (26) observed that the p55 receptor protected against the cytotoxic effects of TNF-alpha in vitro.

To our knowledge, only two studies have explored the role of the p55 receptor after vascular injury in vivo. Schreyer and colleagues (21) observed accelerated atherosclerosis in p55-deficient mice fed an atherogenic diet, despite no difference in plasma lipid levels compared with WT. They concluded that p55 has a protective role against fatty-streak formation. A follow-up study utilizing the same atherogenic model reported no difference in atherosclerotic lesion development between mice deficient in TNF-alpha or the p75 receptor and controls (22). Similarly, no differences were noted in plasma cholesterol or lipid fractions between experimental groups. Thus these investigators concluded that the p55 receptor was instrumental in transmitting antiatherogenic signals.

Our data suggest an alternative role of the p55 receptor after vascular injury. In the present study, mice lacking p55 demonstrated a markedly attenuated hyperplastic response compared with WT mice. This is contrary to the p55-mediated protective effect reported in the hyperlipidemic model. Similar to previous studies, however, we observed no difference in lesion morphology or intimal area in the p75-/- animals compared with controls.

There could be several explanations for our conflicting data. Compared with the data from Schreyer and colleagues (21), we noted that IH is attenuated in p55- and TNF-alpha -deficient mice (21, 27). Hyperlipidemia and direct mechanical injury are two pathologically distinct insults. Pure mechanical injury does not address issues specific to lipid metabolism and plaque development. Additionally, rodent models of hyperlipidemia are devoid of VSMC proliferation and migration (1). Temporally, wire injury is an acute and extremely noxious injury. It is possible that differential expression of each receptor, coupled with removal of the endothelium, could explain the conflicting results. Hyperlipidemia, on the other hand, is chronic and indolent in nature. Histologically, Schreyer and colleagues examined the aorta, whereas we scrutinized the common carotid artery. Perhaps minute structural differences in these vessels could account for the differential responses to vascular injury. Thus we are unable to directly compare wire-induced IH with a model of dietary-induced experimental atherosclerosis. Finally, our results must acknowledge several caveats important with transgenic animals. Namely, our mice may have significant alterations in the expression of nonknockout receptors and their respective coupling to intracellular signals.

Our study corroborates that of Linder and Collins (8), in that vascular injury can actually induce expression of NF-kappa B p65 mRNA. This response is attenuated in animals that lack the p55 receptor, suggesting an important role for p55-mediated signals in NF-kappa B p65 transcription in vivo. Recently, the differential contribution of each receptor subtype to NF-kappa B activation in vitro was reported (12). Interestingly, the p55 receptor was a strong activator of NF-kappa B, and the p75 receptor was not. Our in vivo data corroborate these findings, inasmuch as reduction in unbound NF-kappa B p65 protein parallels IH attenuation in the injured p55-/- mice compared with WT and p75-/- animals.

Previously, we demonstrated that mechanical injury in TNF-alpha -deficient animals completely abolished IH and NF-kappa B activation. One could infer from the present study that TNF-induced activation of the p55 receptor resulted in increased transcriptional activity and inflammation, which cumulatively promoted IH. Yet an important finding in the present study is that p55 deficiency did not completely mitigate injury-induced NF-kappa B activation and IH. We acknowledge that TNF-alpha may also exert proinflammatory signals via the p75 receptor. However, we are unable to conclude from the present study that the residual IH in the p55-/- animals is mediated directly by p75 signaling pathways. Likely, other TNF-alpha -independent pathways are involved, in part, in the inflammatory response and, ultimately, IH.


    ACKNOWLEDGEMENTS

This study was supported by a grant from the Pacific Vascular Research Foundation (C. H. Selzman).


    FOOTNOTES

Address for reprint requests and other correspondence: C. H. Selzman, Div. of Cardiothoracic Surgery, Box C-310, University of Colorado Health Sciences Center, 4200 East Ninth Ave., Denver, CO 80262 (E-mail: craig.selzman{at}UCHSC.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.\

First published January 16, 2003;10.1152/ajpregu.00434.2002

Received 19 July 2002; accepted in final form 13 January 2003.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Clowes, AW, Breslow JL, and Karnovsky MJ. Regression of myointimal thickening following carotid endothelial injury and development of aortic foam cell lesions in long-term hypercholesterolemic rats. Lab Invest 36: 73-81, 1977[Web of Science][Medline].

2.   Erickson, SL, de Sauvage FJ, Kikly K, Carver-Moore K, Pitts-Meek S, Gillett N, Sheehan KC, Schreiber RD, Goeddel DV, and Moore MW. Decreased sensitivity to tumour-necrosis factor but normal T-cell development in TNF receptor-2-deficient mice. Nature 372: 560-563, 1994[Medline].

3.   Faries, PL, Marin ML, Veith FJ, Ramirez JA, Suggs WD, Parsons RE, Sanchez LA, and Lyon RT. Immunolocalization and temporal distribution of cytokine expression during the development of vein graft intimal hyperplasia in an experimental model. J Vasc Surg 24: 463-471, 1996[Web of Science][Medline].

4.   Giuffre, L, Cordey AS, Monai N, Tardy Y, Schapira M, and Spertini O. Monocyte adhesion to activated aortic endothelium: role of L-selectin and heparan sulfate proteoglycans. J Cell Biol 136: 945-956, 1997[Abstract/Free Full Text].

5.   Grell, M, Douni E, Wajant H, Lohden M, Clauss M, Maxeiner B, Georgopoulos S, Lesslauer W, Kollias G, and Pfizenmaier K. The transmembrane form of tumor necrosis factor is the prime activating ligand of the 80-kDa tumor necrosis factor receptor. Cell 83: 793-802, 1995[Web of Science][Medline].

6.   Libby, P. Coronary artery injury and the biology of atherosclerosis: inflammation, thrombosis, and stabilization. Am J Cardiol 86: 3J-8J, 2000[Web of Science][Medline].

7.   Libby, P, and Galis ZS. Cytokines regulate genes involved in atherogenesis. Ann NY Acad Sci 748: 158-168, 1995[Web of Science][Medline].

8.   Lindner, V, and Collins T. Expression of NF-kappa B and Ikappa B-alpha by aortic endothelium in an arterial injury model. Am J Pathol 148: 427-438, 1996[Abstract].

9.   Liu, ZG, Hsu H, Goeddel DV, and Karin M. Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-kappa B activation prevents cell death. Cell 87: 565-576, 1996[Web of Science][Medline].

10.   MacEwan, DJ. TNF receptor subtype signalling: differences and cellular consequences. Cell Signal 14: 477-492, 2002[Web of Science][Medline].

11.   Mackay, F, Rothe J, Bluethmann H, Loetscher H, and Lesslauer W. Differential responses of fibroblasts from wild-type and TNF-R55-deficient mice to mouse and human TNF-alpha activation. J Immunol 153: 5274-5284, 1994[Abstract].

12.   McFarlane, SM, Pashmi G, Connell MC, Littlejohn AF, Tucker SJ, Vandenabeele P, and MacEwan DJ. Differential activation of nuclear factor-kappa B by tumour necrosis factor receptor subtypes. TNFR1 predominates whereas TNFR2 activates transcription poorly. FEBS Lett 515: 119-126, 2002[Web of Science][Medline].

13.   Neumann, B, Machleidt T, Lifka A, Pfeffer K, Vestweber D, Mak TW, Holzmann B, and Kronke M. Crucial role of 55-kilodalton TNF receptor in TNF-induced adhesion molecule expression and leukocyte organ infiltration. J Immunol 156: 1587-1593, 1996[Abstract].

14.   Pfeffer, K, Matsuyama T, Kundig TM, Wakeham A, Kishihara K, Shahinian A, Wiegmann K, Ohashi PS, Kronke M, and Mak TW. Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell 73: 457-467, 1993[Web of Science][Medline].

15.   Pober, JS, Bevilacqua MP, Mendrick DL, Lapierre LA, Fiers W, and Gimbrone MA, Jr. Two distinct monokines, interleukin 1 and tumor necrosis factor, each independently induce biosynthesis and transient expression of the same antigen on the surface of cultured human vascular endothelial cells. J Immunol 136: 1680-1687, 1986[Abstract].

16.   Rectenwald, JE, Moldawer LL, Huber TS, Seeger JM, and Ozaki CK. Direct evidence for cytokine involvement in neointimal hyperplasia. Circulation 102: 1697-1702, 2000[Abstract/Free Full Text].

17.   Renard, P, Ernest I, Houbion A, Art M, Le Calvez H, Raes M, and Remacle J. Development of a sensitive multi-well colorimetric assay for active NFkappa B. Nucleic Acids Res 29: E21, 2001[Medline].

18.   Ross, R. Atherosclerosis---an inflammatory disease. N Engl J Med 340: 115-126, 1999[Free Full Text].

19.   Rothe, J, Lesslauer W, Lotscher H, Lang Y, Koebel P, Kontgen F, Althage A, Zinkernagel R, Steinmetz M, and Bluethmann H. Mice lacking the tumour necrosis factor receptor 1 are resistant to TNF-mediated toxicity but highly susceptible to infection by Listeria monocytogenes. Nature 364: 798-802, 1993[Medline].

20.   Rothe, M, Sarma V, Dixit VM, and Goeddel DV. TRAF2-mediated activation of NF-kappa B by TNF receptor 2 and CD40. Science 269: 1424-1427, 1995[Abstract/Free Full Text].

21.   Schreyer, SA, Peschon JJ, and LeBoeuf RC. Accelerated atherosclerosis in mice lacking tumor necrosis factor receptor p55. J Biol Chem 271: 26174-26178, 1996[Abstract/Free Full Text].

22.   Schreyer, SA, Vick CM, and LeBoeuf RC. Loss of lymphotoxin-alpha but not tumor necrosis factor-alpha reduces atherosclerosis in mice. J Biol Chem 277: 12364-12368, 2002[Abstract/Free Full Text].

23.   Selzman, CH, Gaynor JS, Turner AS, Johnson SM, Horwitz LD, Whitehill TA, and Harken AH. Ovarian ablation alone promotes aortic intimal hyperplasia and accumulation of fibroblast growth factor. Circulation 98: 2049-2054, 1998[Abstract/Free Full Text].

24.   Selzman, CH, McIntyre RC, Jr, Shames BD, Whitehill TA, Banerjee A, and Harken AH. Interleukin-10 inhibits human vascular smooth muscle proliferation. J Mol Cell Cardiol 30: 889-896, 1998[Web of Science][Medline].

25.   Selzman, CH, Miller SA, and Harken AH. Therapeutic implications of inflammation in atherosclerotic cardiovascular disease. Ann Thorac Surg 71: 2066-2074, 2001[Abstract/Free Full Text].

26.   Tartaglia, LA, Weber RF, Figari IS, Reynolds C, Palladino MA, Jr, and Goeddel DV. The two different receptors for tumor necrosis factor mediate distinct cellular responses. Proc Natl Acad Sci USA 88: 9292-9296, 1991[Abstract/Free Full Text].

27.   Zimmerman, MA, Selzman CH, Reznikov LL, Miller SA, Raeburn CD, Emmick J, Meng X, and Harken AH. Lack of TNFalpha attenuates intimal hyperplasia following mouse carotid injury. Am J Physiol Regul Integr Comp Physiol 283: R505-R512, 2002[Abstract/Free Full Text].


Am J Physiol Regul Integr Comp Physiol 284(5):R1213-R1218
0363-6119/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. Zhang, P. Sivashanmugam, J.-H. Wu, L. Brian, S. T. Exum, N. J. Freedman, and K. Peppel
Tumor Necrosis Factor Receptor-2 Signaling Attenuates Vein Graft Neointima Formation by Promoting Endothelial Recovery
Arterioscler Thromb Vasc Biol, February 1, 2008; 28(2): 284 - 289.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
N. R. Ferreri
Estrogen-TNF interactions and vascular inflammation
Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H2566 - H2569.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Takaoka, S. Uemura, H. Kawata, K.-i. Imagawa, Y. Takeda, K. Nakatani, N. Naya, M. Horii, S. Yamano, Y. Miyamoto, et al.
Inflammatory Response to Acute Myocardial Infarction Augments Neointimal Hyperplasia After Vascular Injury in a Remote Artery
Arterioscler Thromb Vasc Biol, September 1, 2006; 26(9): 2083 - 2089.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. Zhang, K. Peppel, L. Brian, L. Chien, and N. J. Freedman
Vein Graft Neointimal Hyperplasia Is Exacerbated by Tumor Necrosis Factor Receptor-1 Signaling in Graft-Intrinsic Cells
Arterioscler Thromb Vasc Biol, December 1, 2004; 24(12): 2277 - 2283.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/5/R1213    most recent
00434.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zimmerman, M. A.
Right arrow Articles by Selzman, C. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zimmerman, M. A.
Right arrow Articles by Selzman, C. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online