|
|
||||||||
APPETITE, OBESITY AND METABOLISM
1Neurology Service, Veterans Affairs Medical Center, E. Orange, 07018; 2Department of Neurosciences, New Jersey Medical School, Newark, New Jersey 07103; 3Geriatric Research, Education and Clinical Center Veterans Affairs Medical Center-St. Louis, and 4Department of Internal Medicine, Division of Geriatrics, Saint Louis University School of Medicine, St. Louis, Missouri 63104
Submitted 16 July 2003 ; accepted in final form 28 August 2003
| ABSTRACT |
|---|
|
|
|---|
signal transducer and activator of transcription 3; leptin receptor; sympathetic nervous system; leptin resistance
Outbred Sprague-Dawley rats have two populations with regard to the development of DIO. Approximately half the animals initially increase their caloric intake and develop DIO when the energy and fat density of the diet are modestly increased (29, 30, 32, 39, 41). The remaining rats are DR in that they gain no more weight or carcass fat than low-fat, chow-fed controls (29, 30, 32, 39, 41). These weight-gain patterns appear to be inherited as polygenic traits since selective breeding of outbred DIO and DR rats results in two substrains, which breed 100% true to their weight-gain phenotypes after only three to five breeding cycles (33, 36). Furthermore, the DIO phenotype persists in the offspring of matings performed by repeated back crosses between DIO and an obesity-resistant rat strain (34). Before the onset of obesity, outbred DIO-prone rats manifest a number of abnormalities of nervous system function, which might predispose them to develop obesity when offered a 31% fat, high-energy (HE) diet (40). Most prominent among these is a reduced sensitivity to the anorectic effects of centrally administered leptin (32).
The present DIO and DR substrains still breed true to their weight-gain phenotypes after more than 20 generations of selective breeding (33, 53). Although the DIO rats originally became obese, even on low-fat chow (33), the present generations of selectively bred DIO rats become heavier but only slightly more obese when fed chow from weaning (52). As with outbred DIO rats, selectively bred DIO rats now become significantly obese only when they are fed HE diet (34, 35, 53). Most of the accrued body fat on HE diet can be accounted for by increased caloric intake, which is not inhibited despite an early and marked increase in plasma leptin levels (34, 35, 53). This apparently reduced ability to sense and regulate rising leptin levels may well be a major predisposing cause of their obesity (32, 53).
Once transported across the BBB, leptin acts on the long (signaling) form of the leptin receptor (OB-Rb) (7, 58) to produce anorexia (14) and increase sympathetic activity (20). This response is mediated through activation of the Janus kinase 2-signal transducer and activator of transcription-3 (STAT3) pathway (58). Leptin's occupation of OB-Rb leads to phosphorylation of STAT3 (pSTAT3) and subsequent gene transcription (61). Although gene transcription may not be the proximate cause of leptin-induced anorexia, the expression of pSTAT3 serves as a useful surrogate for the activation of OB-Rb (47, 61). In the present studies, we found that preobese, selectively bred DIO rats had reduced arcuate nucleus (Arc) OB-Rb expression in association with reduced leptin-induced anorexia and hypothalamic pSTAT3 expression at a time when leptin BBB transport was normal. Impaired leptin transport developed only after DIO rats became obese and/or aged.
| METHODS |
|---|
|
|
|---|
Experiment I: leptin inhibition of food intake, stimulation of sympathetic activity and pSTAT3 expression. During the first week of lactation, selectively bred DR and DIO dams and pups were placed on a reversed light-dark schedule (lights on 2400; lights off 1200). Pups were fed chow from weaning. At 4 wk of age, nine DIO and eight DR male rats were placed in metabolic cages for collection of 24-h urine norepinephrine (NE) levels and to monitor 4- and 24-h baseline intakes after intraperitoneal injection of 0.5 ml of saline, beginning at lights off (1200). The next day, the rats were injected with murine leptin (10 mg/kg ip in 0.5 ml of saline; Calbiochem), 24-h urines were collected, and intake was monitored at 4 and 24 h. After an additional 5 days, the procedure was repeated again, except that rats were injected with leptin (15 mg/kg ip) on the second day. After an additional 5 days of rest, five DIO and four DR rats were intraperitoneally injected a second time with 15 mg/kg leptin, and four DIO and four DR rats were injected a second time with saline for assessment of brain pSTAT3 expression. After 45 min, they were anesthetized with chloropent and then rapidly perfused with ice-cold saline for 1 min, followed by ice-cold 4% paraformaldehyde in 0.1 M PBS, pH 7.4, at
70 ml/min for 6-7 min. The brains were removed from the skull and postfixed in the 0.1 M PBS/paraformaldehyde solution at 4°C for 24 h. The brains were then sunk in 30% sucrose in PBS overnight with agitation at 4°C and then frozen in 2 methylbutane cooled to -50°C with dry ice. Brains were then stored at -70°C until processed for pSTAT3 immunocytochemistry. Urine NE levels were assayed by high-performance liquid chromotography with electrochemical detection (29).
Immunocytochemistry for pSTAT3 was carried out by modifications of the methods of Peterson et. al. (51). Serial 35-µm brain sections were cut through the hypothalamic Arc, ventromedial (VMN) and dorsomedial (DMN) nuclei (centered on the compact portion of the DMN), and the caudal nucleus tractus solitarius (NTS; at the level of the area postrema). Sections were floated in K+-PBS (KPBS) buffer with gentle agitation and washed three times. They were then incubated for 20 min in freshly prepared buffer containing 1% NaOH and 1% H2O2 in KPBS, and then washed twice for 5 min each in KPBS. Next, sections were placed in 0.3% glycine in KPBS for 10 min followed by two washes of 5 min each with KPBS. Sections were then placed in freshly prepared KPBS containing 0.15% SDS for 10 min and then washed three times for 10 min each in KPBS. Blocking was done with 4% horse serum in KPBS containing 0.4% Triton X for 2 h, and sections were then incubated overnight at 4°C with 1:1,000 dilution of rabbit anti-pSTAT3 antibody (Cell Signaling Technologies) in KPBS containing 4% horse serum and 0.4% Triton X. The next day, the solutions were warmed to room temperature for 1 h, rinsed six times for 10 min each in KPBS containing 1% horse serum and 0.02% Triton X, and incubated for 1 h with 1:250 biotinylated goat anti-rabbit antibody in KPBS containing 1% horse serum. They were then washed three times for 10 min each in KPBS containing 1% horse serum and incubated for 1 h with ABC reagent (Vector Laboratories), which had been prepared 30 min before in KPBS containing 1% horse serum. After six washes in KPBS, the sections were reacted with diaminobenzidine for
20 min, washed three times, mounted on slides, and dehydrated by standard procedures. The number of cells expressing pSTAT3 for saline- and leptin-treated rats was counted in three sections per rat in the Arc, VMN, and DMN portion of the hypothalamus and the caudal NTS by an observer blinded to the experimental groups by using a Bioquant image analysis system (Nashville, TN). The average number of cells counted in the three sections per area in each rat was taken for statistical comparisons.
Experiment II: effects of genotype, diet, and age on BBB leptin transport. Pregnant female DIO and DR rats were transported from the parent colony in E. Orange (B. Levin) to the vivarium in St. Louis (W. A. Banks) where they were allowed to deliver and nurse their pups. These rats were kept at 22-23°C on a 12:12-h light-dark cycle (lights on at 0800) and were fed chow and water ad libitum from weaning. Leptin transport across the BBB was assessed in chow-fed male and female DR and DIO rats at 4 wk (n = 12 per group) and 11 wk of age (n = 8 per group). Transporter activity was also assessed in chow-fed male DR and DIO rats, which were either continued on chow or switched to HE diet for 6 wk beginning at 11 wk of age (n = 8 per group). Transport activity was assessed in final groups of 12 DIO and 14 DR male rats, which were fed chow from weaning to 23 wk of age. Thus transport was assessed in chow-fed DIO and DR females at 4 and 11 wk of age and in chow-fed DIO and DR males at 4, 11, 17, and 23 wk of age, as well as in males fed HE diet from 11 to 17 wk of age.
Assessment of leptin transport. Leptin (Amgen, Thousand Oaks, CA) was radioactively labeled by the lactoperoxidase method with 131I. Radiolabeled leptin (I-Lep) was separated from free iodine on a Sephadex G-10 column. The I-Lep had a specific activity of
100-125 Ci/g and was stored at 4°C until use. The unidirectional influx rate of leptin from blood to brain was measured by multiple-time regression analysis (10, 50). Rats were anesthetized with pentobarbital, and the left jugular vein and right carotid artery were exposed. Rats were given an injection into the jugular vein of 0.2 ml of lactated Ringer solution containing 1% bovine serum albumin and about 5 x 105 counts/million (cpm) of I-Lep. Blood from the carotid artery was obtained between 1 and 10 min after intravenous injection (typically at 1-min intervals), centrifuged for 10 min at 5,000 g at 4°C, and the radioactivity level in the serum determined. Immediately after collection of each arterial blood sample, the rat was decapitated and the level of the radioactivity in the whole brain (with the pituitary and the pineal gland removed) determined. The brain-to-serum ratios of I-Lep in units of microliters per gram [(cpm/g of brain)/(cpm/µl serum)] were plotted against exposure time (Expt; in minutes)
![]() | (1) |
where Cp is serum concentration, (
)d
is an integration time constant, and Cpt is the level of radioactivity in serum at time t (10, 50). The slope of the linear portion of the relation between the brain-to-serum ratios and Expt was calculated by the least squares method (see Statistics below) and measures the unidirectional influx rate from blood to brain and is reported with its standard deviation of the residuals.
Leptin assay. Serum obtained from 10-wk-old DR and DIO male rats was frozen at -70°C until assayed. Leptin was measured with the mouse ELISA (Linco, St. Charles, MO). This assay is 50% cross reactive with rat leptin, and so the reported values were multiplied by two to give "corrected rat" values.
Experiment III: OB-Rb expression. Selectively bred male DIO and DR (n = 8 per group) rats were placed on a reversed 12-h light-dark schedule during the first week of suckling, with lights off at 1200 (see Experiment I). They were fed Purina rat chow (no. 5001) ad libitum from weaning. At 5 wk of age, they were decapitated without fasting during the 2 h before lights on (1000-1200). Their brains were quickly removed and frozen on dry ice. At this time, trunk blood was taken for leptin assay by radioimmunoassay using antibodies directed against rat leptin (Linco). Brains were stored at -70°C until assay. A 300-µm section was cut from frozen brains on a cryostat at -12°C such that the compact portion of the DMN was in the center of the slice. Cut sections were placed in RNA Later (Ambion). After at least 1 h, sections were placed under a dissecting microscope, and the Arc, VMN, and DMN were micropunched bilaterally by minor modifications (30) of the method of Palkovits (49). The punched samples were kept in RNA for <2 wk before being reversed transcribed to cDNA.
Micropunch samples were subsequently assayed by real-time (quantitative) PCR. They were first homogenized ultrasonically in a solution containing guanidinium thiocyanate and nucleotides. Then mRNA was purified by using silica columns (Ambion RNAqueous kit). After removal of genomic DNA with DNase, mRNA was reversed transcribed with random hexamer priming using Superscript 3 (Invitrogen). Samples were then treated with RNaseH (Ambion), and the resulting purified cDNA was aliquoted and frozen. Primer sets for cyclophilin and OB-Rb mRNA were designed by reference to published sequences, and their specificity was verified by using Genbank and by comparing the sequenced PCR product for both cyclophilin and OB-Rb to these references. For each mRNA species, a pair of conventional primers was used in combination with a sequence-specific 6-carboxyfluorescein (FAM)-labeled probe to allow real-time PCR quantitation by using an Applied Biosystems 7700 Sequence detector set for 40 PCR cycles. The primers for cyclophilin were Genbank (NM 017101) forward (253-272) AATGGCACTGGTGGCAAGTC; reverse (330-310) GCCAGGACCTGTATGCTTCAG; FAM-labeled probe (275-290) TCTACGGAGAGAAATT. The primers for OB-Rb were Genbank (AF287268 [GenBank] ) forward (2913-2937) AACCTGTGAGGATGAGTGTCAGAGT; reverse (3005-2984) CCTTGCTCTTCATCAGTTTCCA; FAM-labeled probe ATGCAACGCTGGTCAG (2954-2969). Reference standards for each hypothalamic nucleus were created for cyclophilin and OB-Rb from aliquots of samples from all samples of those areas used. These pooled samples were used to generate standard curves from which the respective quantitative data were read. Data were then expressed as the ratio of OB-Rb to cyclophilin.
Statistics. Food intake and urine NE levels after saline or leptin administration were assessed by one-way ANOVA for repeated measures with post hoc Bonferonni comparisons when significant differences were found. The number of cells expressing pSTAT3 and OB-Rb expression in each brain area were compared by two-way ANOVA (phenotype x treatment) with post hoc Bonferonni comparisons where appropriate.
For leptin transport, regression lines were calculated by the least squares method with the Prism 3.0 program (GraphPad, San Diego, CA) and the slope with its standard deviation of the mean reported. Regression lines were compared for statistical differences with the Prism 3.0 program, which first determines whether there are differences between slopes and, if not, whether there are differences between intercepts. When more than two slopes were compared, ANOVA was followed by Newman-Keuls range test with the standard deviation of the mean taken as the standard error term and, because two means (the slope and the intercept) were calculated from the data, n-1 was used as the value for n.
| RESULTS |
|---|
|
|
|---|
|
|
At baseline, 4-wk-old DIO rats had 35% higher 24-h urine NE levels than DR rats (Fig. 3A; P = 0.05). As with its effect on food intake, injection of 10 mg/kg ip leptin did not alter 24-h urine NE levels in either genotype, although DIO rats no longer had higher levels than DR rats. After 15 mg/kg leptin, 24-h urine NE levels rose significantly above baseline in both DIO (127%; P = 0.006) and DR rats (110%; P = 0.05), and DIO levels were again higher (46%; P = 0.01) than DR levels. When the leptin-induced percent changes from baseline for 24-h urine NE and 4-h intake inhibition were plotted against each other (Fig. 3B), there was a significant correlation between these parameters in DR (r = 0.90; P = 0.01) but not in DIO rats. Curiously, half of the DR rats actually had a reduced 24-h urine NE response to leptin administration compared with saline-injected controls (Fig. 3B). There were no correlations between leptin-induced inhibition of 24-h intake and 24-h urine NE levels for either genotype.
|
Experiment II: Effects of genotype, gender, diet, and age on BBB leptin transport. The impaired anorectic and hypothalamic pSTAT3 expression in 4- to 5-wk-old DIO rats might have been due to reduced BBB transport. To address this issue, transport was compared between DIO and DR rats of differing ages, sexes, and degrees of obesity. At 4 wk of age, there were no differences in leptin transport across the BBB among lean, chow-fed DR or DIO males or females. All four groups had similar transport rates (Table 1; Fig. 4). Body weights differed among the four groups, and the weights of each group were different from those of the other three [Table 1: F(3,43) = 24.5; P < 0.001]. At this age, as in the 4-wk-old rats in Experiment I, DIO rats weighed 10% less than their DR counterparts. At 11 wk of age, there were further differences in body weight among the groups [Fig. 5; F(3,28) = 238; P < 0.001]. DIO males weighed
29% more than DR males (P < 0.001), and DIO females weighed
26% more than DR females (P < 0.001). The mean serum leptin level in seven DIO males (2.54 ± 0.31 ng/ml) was twice as high as in seven DR males (1.34 ± 0.39 ng/ml; P < 0.05). However, there were no significant differences in transport rate among the four groups (Fig. 5).
|
|
|
When 11-wk-old male rats were either switched to HE diet or continued on chow for 6 wk, there were further significant intergroup differences in body weight [Fig. 6; F(3,28) = 2.5; P < 0.001]. DIO rats fed HE diet weighed 24% more than chow-fed DIO rats, 43% more than DR rats fed HE diet, and 54% more than chow-fed DR rats (P < 0.001 for all). The 7% difference in body weight between chow-fed DR and DR rats fed HE diet was not statistically different. The chow-fed DR and DIO rats and DR rats fed HE diet all transported I-Lep into the brain at similar rates of transport that did not differ from one another. However, only small amounts of labeled leptin were recovered from the brains of DIO rats fed HE diet and the ratios of brain to serum leptin were extremely variable among the animals. Thus the relationship between brain-to-serum ratios and time was not statistically significant for this group, i.e., no statistically significant transport had occurred in DIO rats fed HE diet. Nevertheless, a regression line was calculated for these animals to allow for intergroup statistical comparison. This comparison showed significant differences among the slopes of the regression lines for the four groups [F(3,23) = 4.12; P < 0.05]. Post hoc analysis showed that the slope of the line for DIO rats on HE diet was different from that of DR rats on HE diet (P < 0.05) and from that of chow-fed DIO rats (P < 0.05). The half-time disappearance rate of I-Lep from blood did not differ among these four groups, demonstrating that this saturable clearance mechanism was not affected.
|
Final groups of DR and DIO rats were fed chow from weaning to 23 wk of age and were then evaluated for leptin transport (Fig. 7). Diet had no effect on transport rates in DR rats at this age, but the DIO group had lost the ability to transport leptin and was, therefore, significantly lower than time-matched chow-fed DR rats (P < 0.05). Figure 7 summarizes the changes in leptin transport rates for chow-fed DR and DIO male rats at 4, 11, 17, and 23 wk of age.
|
Experiment III: DIO and DR OB-Rb mRNA expression. At 5 wk of age, when peripheral leptin levels were statistically comparable in chow-fed DIO (2.3 ± 0.2 ng/ml) and DR rats (1.8 ± 0.2 ng/ml), DIO Arc OB-Rb mRNA expression was 77% of that in DR rats (Table 2). Despite reduced leptininduced pSTAT3 expression in both the VMN and DMN of DIO rats, there were no differences in OB-Rb expression between DIO and DR rats in those hypothalamic nuclei (Table 2).
|
| DISCUSSION |
|---|
|
|
|---|
The reduced Arc OB-Rb mRNA expression in DIO rats exists before the development of obesity or exposure to HE diet. Reduced mRNA expression does not guarantee that receptor protein expression or binding will be decreased. However, their attenuated leptin-induced Arc pSTAT3 expression suggests that DIO rats had a parallel or even greater reduction in functional Arc leptin signaling (21, 23, 27, 28, 47). It is unclear why there were no similar reductions in DIO VMN and DMN OB-Rb expression by quantitative PCR since their leptin-induced pSTAT3 expression was reduced. Also, our laboratory previously found (35) reduced OB-Rb mRNA expression in both the VMN and DMN of DIO rats by in situ hybridization. However, those reductions were small (
10%) and might not have been detected here by the combination of micropunch and quantitative PCR. Although there is no conclusive evidence that leptin might affect food intake by a direct effect on the VMN, there is evidence that the DMN might play a role comparable to that ascribed to the Arc (8) and that this might be mediated, in part, by leptin (9). However, the selective decrease of both OB-Rb expression and leptin-induced STAT3 activation in the Arc of DIO rats, along with the well-established role of the Arc in energy homeostasis (40, 57), suggests that defective Arc leptin signaling might be a critical determinant of the development of obesity in DIO rats fed HE diet. One cautionary note is that the leptin signaling pathways involved in producing anorexia might not be dependent on STAT3 activation. But assessment of immunoreactive pSTAT3 activation is currently the best surrogate for shortterm postreceptor signaling available at the cellular level for leptin signaling.
Although the present studies suggest that 4- to 5-wk-old DIO rats have reduced leptin sensitivity compared with DR rats, they actually had lighter body weights at 4 wk of age. Because rats at this age have only 5-6% body fat (52), it is likely that their differences in body weight were due to relatively less lean body mass in DIO rats. Although there is no obvious explanation for this apparent reversal of expected relative body weights, it is unlikely that it is due to the lighting schedule used. DIO rats raised under both reversed (Experiment I) and conventional lighting schedules (Experiment II) weighed less than DR rats at 4 wk of age. Although it is unclear why there were differences in body weight at 4 wk of age, these differences disappeared at 5 wk of age.
The reduced responsiveness of 4- to 5-wk-old DIO rats to peripherally injected leptin cannot be explained by reduced access of leptin to central sites. DIO rats at this age had comparable BBB leptin transport to DR rats. Also, outbred DIO rats, from which the selectively bred DIO rats in the present studies are derived (33), have reduced sensitivity to the anorectic effects of centrally administered leptin (32). Moreover, no BBB transport would be required for leptin to reach some neurons in the Arc or NTS since both reside close to brain areas with no BBB (13, 22). Because a major portion of leptin's anorectic effect is mediated through Arc neurons (48, 57), peripherally administered leptin might reach this target, engage the OB-Rb on Arc neurons and activate STAT3, as well as producing anorexia without having to cross the BBB. Similarly, the fact that transport should not be required for STAT3 activation in the NTS suggests that differences between DIO and DR rats in the anorectic effects of peripherally administered leptin are not mediated through the NTS because there was no difference in leptin-induced pSTAT3 activation in this nucleus.
The dissociation between the anorectic effect of leptin and 24-h urine NE levels in DIO rats is in agreement with other studies showing a dissociation between the anorectic and sympathoexcitatory effects of leptin (17, 46, 52). In fact, this dissociation might explain why DIO rats have constitutively elevated urine NE levels (29, 30, 33) and develop obesityassociated hypertension (19) but do not downregulate their food intake or Arc neuropeptide Y expression until plasma leptin levels appreciably exceed those of DR levels (32, 37). Aside from its generally catabolic effect on energy homeostasis, leptin increases both general sympathetic activity and blood pressure (18, 26). Interestingly, the dissociation between leptin-induced anorexia and sympathoexcitation did not hold for DR rats, possibly because urinary NE was used as an index of sympathetic activity. Clearly, sympathetic activity varies by organ system. For example, although DIO-prone rats have constitutively elevated levels of urine NE excretion (29, 33), they actually have reduced cardiac and pancreatic, but not brown adipose, sympathetic activity (30). Similarly, the effect of leptin on sympathetic activity appears to be highly organ specific (25, 45). Another possibility is that altered urine NE levels might be due to an effect of leptin on the renal clearance of NE (16).
Leptin sensitivity appears to decrease as a function of age, increasing dietary fat content and obesity (3, 15, 21, 43, 54-56, 62, 64). In rats, these factors are generally not dissociable, since most rat strains become obese with age and on high-fat diets. Here, selectively bred DIO rats developed defective leptin transport only when fed HE diet for 6 wk from 11 wk of age or when fed chow from weaning to an age of 23 wk. Although we did not measure leptin levels or carcass fat in the 23-wk-old chow-fed rats, our laboratory previously showed (31) that chow-fed DIO rats of comparable age have fourfold higher leptin levels, suggesting that they are fatter than comparable DR rats. In the present study, same-age DR rats never developed defective leptin transport, although there was a tendency toward reduced transport with age in both DR and DIO rats. In light of these results and those of others (3, 21, 24), it seems likely that defective leptin transport in DIO rats is more a function of the development of obesity than of age alone (3, 4, 6). Thus, in support of data derived from inbred mice (4), defective leptin transport in selectively bred DIO rats appears to be an acquired rather than inherited defect (33).
In conclusion, our data support previous studies showing that reductions in central leptin signaling and defects in leptin BBB transport can develop independently and are likely to have different underlying mechanisms. In the DIO rat, reduced central leptin sensitivity appears to be an inherent trait, whereas defective transport is an acquired one. Reduced sensitivity to the anorectic effects of leptin would confer a distinct competitive advantage on feral animals where food availability was limited and only sporadically available. When food was readily available, rats could store more energy as fat before leptin exerted its inhibitory effect on intake and stimulatory effects on thermogenesis. In humans, reduced leptin signaling should confer a similar competitive advantage where energy sources were limited. However, in times of excess food availability, it would promote the development and maintenance of obesity.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
-adrenoceptors during the development of diet-induced obesity in the rat. Obes Res 2: 230-238, 1994.[Medline]
This article has been cited by other articles:
![]() |
C. Le Foll, B. G. Irani, C. Magnan, A. Dunn-Meynell, and B. E. Levin Effects of maternal genotype and diet on offspring glucose and fatty acid-sensing ventromedial hypothalamic nucleus neurons Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2009; 297(5): R1351 - R1357. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Boghossian, K. Lemmon, M. Park, and D. A. York High-fat diets induce a rapid loss of the insulin anorectic response in the amygdala Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2009; 297(5): R1302 - R1311. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Teske and C. M. Kotz Effect of acute and chronic caloric restriction and metabolic glucoprivation on spontaneous physical activity in obesity-prone and obesity-resistant rats Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2009; 297(1): R176 - R184. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Smith, A. P. Chambers, C. J. Price, W. Ho, C. Hopf, K. A. Sharkey, and A. V. Ferguson The subfornical organ: a central nervous system site for actions of circulating leptin Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2009; 296(3): R512 - R520. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Scarpace and Y. Zhang Leptin resistance: a prediposing factor for diet-induced obesity Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2009; 296(3): R493 - R500. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. G. Irani, C. Le Foll, A. A. Dunn-Meynell, and B. E. Levin Ventromedial nucleus neurons are less sensitive to leptin excitation in rats bred to develop diet-induced obesity Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2009; 296(3): R521 - R527. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Patterson, S. G. Bouret, A. A. Dunn-Meynell, and B. E. Levin Three weeks of postweaning exercise in DIO rats produces prolonged increases in central leptin sensitivity and signaling Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2009; 296(3): R537 - R548. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Patterson, A. A. Dunn-Meynell, and B. E. Levin Three weeks of early-onset exercise prolongs obesity resistance in DIO rats after exercise cessation Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2008; 294(2): R290 - R301. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yang and L. A. Barouch Leptin Signaling and Obesity: Cardiovascular Consequences Circ. Res., September 14, 2007; 101(6): 545 - 559. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Levin Why some of us get fat and what we can do about it J. Physiol., September 1, 2007; 583(2): 425 - 430. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Cottone, V. Sabino, T. R. Nagy, D. V. Coscina, and E. P. Zorrilla Feeding microstructure in diet-induced obesity susceptible versus resistant rats: central effects of urocortin 2 J. Physiol., September 1, 2007; 583(2): 487 - 504. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Gorski, A. A. Dunn-Meynell, and B. E. Levin Maternal obesity increases hypothalamic leptin receptor expression and sensitivity in juvenile obesity-prone rats Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2007; 292(5): R1782 - R1791. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Levin Orexins: neuropeptides for all seasons and functions Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2006; 291(4): R885 - R888. [Full Text] [PDF] |
||||
![]() |
J. A. Teske, A. S. Levine, M. Kuskowski, J. A. Levine, and C. M. Kotz Elevated hypothalamic orexin signaling, sensitivity to orexin A, and spontaneous physical activity in obesity-resistant rats Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2006; 291(4): R889 - R899. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Gorski, A. A. Dunn-Meynell, T. G. Hartman, and B. E. Levin Postnatal environment overrides genetic and prenatal factors influencing offspring obesity and insulin resistance Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2006; 291(3): R768 - R778. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Vrang, A. N. Madsen, M. Tang-Christensen, G. Hansen, and P. J. Larsen PYY(3-36) reduces food intake and body weight and improves insulin sensitivity in rodent models of diet-induced obesity Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2006; 291(2): R367 - R375. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Novak, C. M. Kotz, and J. A. Levine Central orexin sensitivity, physical activity, and obesity in diet-induced obese and diet-resistant rats Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E396 - E403. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Morrison, G. J. Morton, K. D. Niswender, R. W. Gelling, and M. W. Schwartz Leptin inhibits hypothalamic Npy and Agrp gene expression via a mechanism that requires phosphatidylinositol 3-OH-kinase signaling Am J Physiol Endocrinol Metab, December 1, 2005; 289(6): E1051 - E1057. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Levin, C. Magnan, S. Migrenne, S. C. Chua Jr., and A. A. Dunn-Meynell F-DIO obesity-prone rat is insulin resistant before obesity onset Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2005; 289(3): R704 - R711. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. A. Cupples Physiological regulation of food intake Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2005; 288(6): R1438 - R1443. [Full Text] [PDF] |
||||
![]() |
D. J. Clegg, S. C. Benoit, J. A. Reed, S. C. Woods, A. Dunn-Meynell, and B. E. Levin Reduced anorexic effects of insulin in obesity-prone rats fed a moderate-fat diet Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2005; 288(4): R981 - R986. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Levin The drive to regain is mainly in the brain Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2004; 287(6): R1297 - R1300. [Full Text] [PDF] |
||||
![]() |
C. M. Boustany, K. Bharadwaj, A. Daugherty, D. R. Brown, D. C. Randall, and L. A. Cassis Activation of the systemic and adipose renin-angiotensin system in rats with diet-induced obesity and hypertension Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2004; 287(4): R943 - R949. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |