AJP - Regu Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 286: R1093-R1101, 2004. First published March 4, 2004; doi:10.1152/ajpregu.00669.2003
0363-6119/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/6/R1093    most recent
00669.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (30)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Unniappan, S.
Right arrow Articles by Peter, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Unniappan, S.
Right arrow Articles by Peter, R. E.

MODEL ORGANISMS AND COMPARATIVE FUNCTIONAL GENOMICS

In vitro and in vivo effects of ghrelin on luteinizing hormone and growth hormone release in goldfish

Suraj Unniappan and Richard E. Peter

Department of Biological Sciences, University of Alberta, Edmonton, Alberta, Canada T6G 2E9

Submitted 19 November 2003 ; accepted in final form 26 February 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We studied the in vitro and in vivo effects of octanoylated goldfish ghrelin peptides (gGRL-19 and gGRL-12) on luteinizing hormone (LH) and growth hormone (GH) release in goldfish. gGRL-19 and gGRL-12 at picomolar doses stimulated LH and GH release from dispersed goldfish pituitary cells in perifusion and static incubation. Incubation of pituitary cells for 2 h with 10 nM gGRL-12 and 1 or 10 nM gGRL-19 increased LH-{beta} mRNA expression, whereas only 10 nM gGRL-19 increased GH mRNA expression. Somatostatin-14 abolished the stimulatory effects of ghrelin on GH release from dispersed pituitary cells in perifusion and static culture. The GH secretagogue receptor antagonist D-Lys3-GHRP-6 inhibited the ghrelin-induced LH release, whereas no effects were found on stimulation of GH release by ghrelin. Intracerebroventricular injection of 1 ng/g body wt of gGRL-19 or intraperitoneal injection of 100 ng/g body wt of gGRL-19 increased serum LH levels at 60 min after injection, whereas significant increases in GH levels were found at 15 and 30 min after these treatments. Our results indicate that, in addition to its potent stimulatory actions on GH release, goldfish ghrelin peptides have the novel function of stimulating LH release in goldfish.

fish; somatotropes; gonadotropes; somatostatin; mRNA expression


GROWTH HORMONE (GH) secretagogues (GHS) are a group of peptide and nonpeptide synthetic compounds that have potent GH-releasing activity (43). In 1996, a G protein-coupled receptor to which the GHS can bind and elicit a biological response was identified from the pituitary and hypothalamus of humans and swine (16). This receptor has been named the GHS receptor (GHSR) (16). Ghrelin is a recently discovered endogenous ligand of the GHSR (23). Ghrelin has a unique, n-octanoyl modification in the third residue, serine, that is essential for its biological activity (23). In mammals, ghrelin is a multifunctional hormone, mainly involved in regulation of GH secretion (23, 50) and food intake (47, 30). Ghrelin stimulates GH release from rat (23, 38), porcine (11), and bovine (12) somatotropes in vitro. Intracerebroventricular (7) and intraperitoneal (49) injections of ghrelin in rats and intravenous injections in humans (41) and rats (31, 45) increase circulating GH levels.

Recently, we reported the structure of the cDNA encoding ghrelin in the goldfish (48). There are two putative cleavage sites and amidation signals in the mature peptide region, suggesting the presence of two amidated ghrelin peptides, 12 (gGRL-12) and 19 (gGRL-19) amino acids long, in goldfish (48). Although we have not purified the ghrelin peptides from goldfish, in a similar study, it was found that two peptides, orexin-A and orexin-B, originate from the preproorexin mRNA, which has two cleavage sites and amidation signals (41). Strong expression of ghrelin mRNA was found in the gut and spleen and weaker expression in the brain of goldfish (49).

Ghrelin has also been identified from other nonmammalian vertebrates, including chicken (21), bullfrog (17), frog (10), eel (19), tilapia (20, 33), and rainbow trout (18). In bullfrog, chicken, eel, and trout, more than one form of ghrelin was found. In rainbow trout, amidated and nonamidated forms of ghrelin, modified with octanoyl or decanoyl groups, are present (18). The role of the amide group in fish ghrelin is not known (18). Octanoylated ghrelin is present in all species from which ghrelin has been isolated and identified, including the species in which ghrelin with other acyl modifications (e.g., decanoylated ghrelin) was also found (18, 21). Intracerebroventricular injections of octanoylated gGRL-19 stimulated food intake in goldfish (48). Using an assay specific for the n-octanoylated ghrelin, we detected a meal-related change in octanoylated ghrelin in goldfish serum (unpublished observations). Ghrelin stimulates GH and prolactin (PRL) release from incubated whole pituitaries of eel (19) and tilapia (20, 39). Recently, Kaiya et al. (18) found that ghrelin stimulates GH release from incubated whole pituitaries of trout, whereas they found no effect on somatolactin and PRL release. Intracranial injections of ghrelin inhibited water intake in eels (24). Here, we present the effects of ghrelin on luteinizing hormone [LH; recently, a consensus was reached to use the terms LH for fish gonadotropin II (GtH II) and LH-{beta} for fish GtH II{beta} (51)] and GH release in vitro from dispersed pituitary cells and in vivo after intracerebroventricular or intraperitoneal injections in the goldfish. We also report the effects of ghrelin on LH-{beta} and GH mRNA expression. Furthermore, we demonstrate the in vitro effects of somatostatin-14 (SS-14) on ghrelin-induced GH release and the in vitro effects of the GHSR antagonist D-Lys3-GHRP-6 on ghrelin-induced LH and GH release in goldfish.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals

Goldfish (Carassius auratus) of the common or comet variety, ~35–45 g body wt and in sexually regressed stage, were purchased from Mount Parnell Fisheries (Mercersburg, PA) and maintained under a simulated natural photoperiod of Edmonton, AB, Canada. Fish used for the in vitro studies were maintained in a 300-liter flow-through aquarium that received a constant flow of aerated and dechlorinated city water at 17°C; the fish used for the in vivo experiments were kept in 65-liter glass aquaria receiving aerated water at 20°C. Fish were fed commercially prepared fish pellets (Corey Aquafeeds, Corey Fish Mills, Fredericton, NB, Canada) daily at a specific time. Fish were acclimatized to the respective tanks for >=14 days. All protocols were approved by the Faculty of Sciences Animal Care Committee of the University of Alberta, based on the guidelines of the Canadian Council for Animal Care.

Hormones and Receptor Antagonist

gGRL-12 and gGRL-19 with n-octanoyl modification (48) were synthesized in the laboratory of Dr. Jean E. Rivier (Clayton Foundation Laboratories for Peptide Biology, The Salk Institute of Biological Sciences, San Diego, CA). Although goldfish ghrelins have not been isolated and characterized, we have used the octanoylated forms of both putative peptides (gGRL-12 and gGRL-19) in the present study. Ghrelin stocks were made by dissolving the peptide in sterile, double-distilled water. Stocks were kept at –20°C. Peptide stocks were thawed and then diluted in fish physiological saline (3) for in vivo studies or in testing medium for in vitro studies. D-Lys3-GHRP-6 was purchased from Phoenix Pharmaceuticals (Belmont, CA). SS-14 was purchased from Peninsula (Bachem) Laboratories (San Carlos, CA). SS-14 and D-Lys3-GHRP-6 stocks were made by dissolving in sterile double-distilled water and frozen. The stocks were diluted in testing media for experiments. Thawed peptide stocks were never refrozen.

Tissue Culture Reagents

Medium 199 was purchased from Sigma-Aldrich (Oakville, ON, Canada). Bovine serum albumin (BSA, fraction V) was purchased from Calbiochem (EMD Biosciences, San Diego, CA). All other solutions and media used for pituitary dispersion, perifusion, and static incubation experiments and primers for amplifying the GH and LH-{beta} probes were purchased from GIBCO-Invitrogen Life Technologies (Burlington, ON, Canada).

In Vitro Experiments

Dispersion of pituitary cells. Fish were anesthetized by submersion in 0.05% tricaine methane sulfonate (MS-222, Syndel Laboratories, Vancouver, BC, Canada) and euthanized, and pituitaries were removed and placed in dispersion medium (medium 199 with Hanks' salts, 25 mM HEPES, 2.2 g/l NaHCO3, 0.3% BSA, 100,000 U/l penicillin, and 1,000 mg/l streptomycin, with pH adjusted to 7.18 with NaOH). Pituitary cells were dispersed by trypsin-DNase treatment (4), and cells were resuspended in plating medium (which has the same composition as the dispersion medium, except 0.3% BSA was substituted with 1% horse serum).

Column perifusion of pituitary cells. Perifusion experiments were conducted as described elsewhere (5). Briefly, dispersed cells were cultured overnight on preswollen Cytodex beads at 28°C and 5% CO2 humidity. Before the experiment, ~1.5 x 106 dispersed cells were loaded onto each column and perifused with testing medium (medium 199 with Hanks' salts, 25 mM HEPES, 2.2 g/l NaHCO3, 0.3% BSA, 100,000 U/l penicillin, and 1,000 mg/l streptomycin, with pH adjusted to 7.18 with NaOH) for 4 h at a rate of 15 ml/h to stabilize the basal secretion rate of GH and LH. After the initial 4 h of perifusion, six 5-min fractions were collected. The average GH concentration in these fractions was considered the basal hormone release level. On the seventh fraction, a 5-min pulse of testing medium containing the specified concentration (0.001, 0.01, 0.1, 1, and 10 nM) of gGRL-12 or gGRL-19 was administered, and the perifusion medium was switched back to the normal testing medium and 5–13 more 5-min fractions were collected (a total of 12–25 fractions from each column). The perifusate fractions were stored at –20°C until the GH and LH radioimmunoassay (RIA). Only a single dose of gGRL-12 or gGRL-19 was applied to each column.

The effect of SS-14 on ghrelin's stimulatory role on GH release was studied using column perifusion. In this experiment, after the collection of six 5-min fractions, in four perifusion columns the perifusion medium was changed to testing medium containing 100 nM SS-14, while two perifusion columns were continuously perifused with plain testing medium (control columns). After 30 min (6 fractions), a 5-min pulse of 10 nM gGRL-19 was administered to all columns, and perifusion was continued with medium containing SS-14 or plain testing medium. After another 25 min (5 fractions), the medium was switched back to plain testing medium in the four columns perifused with SS-14. A total of 24 fractions was collected from each column. The perifusate fractions were stored at –20°C until the GH and LH RIA.

Static incubation of dispersed pituitary cells. For the 2-h static incubation experiments on GH release, 0.25 x 106 cells·ml–1·well–1 were cultured overnight in plating medium on 24-well Falcon Primaria culture plates (BD Biosciences, Mississauga, ON, Canada) under 5% CO2 humidity and 28°C as described previously (5). Before the experiment, the wells were emptied, 1 ml of fresh testing medium was added, and the plates were again incubated under the same conditions. After 1 h of incubation, plates were removed from the testing medium, and depending on the experiment, 1 ml of plain testing medium or testing medium containing 1 or 10 nM gGRL-12 or gGRL-19, 10 nM gGRL-19 and 1,000 nM SS-14, or 10 nM gGRL-19 and 1,000 nM d-Lys3-GHRP-6 was added, and the plates were incubated again under the same conditions. After 2 h, 800 µl of the medium were collected from each well and stored at –20°C until the RIA for GH and LH. All doses were tested in a minimum of four wells in each experiment, and the experiments were repeated at least three times.

mRNA Expression Studies

Static culture and total RNA extraction. In this experiment, ~2 x 106 cells·ml–1·well–1 were plated. On the day of the experiment, the wells were emptied and 1 ml of new testing medium was added, and the plates were incubated for 1 h. The testing medium was removed, and plain testing medium or testing medium containing 1 or 10 nM gGRL-12 or gGRL-19 was added, and the plates were incubated under the same culture conditions described above. After 2 h, 800 µl of the medium were removed, 1 ml of TRIzol reagent (GIBCO-Invitrogen) was added and mixed by repeated pipetting, and the entire contents of each well were transferred to an RNase-free microfuge tube kept on wet ice. Total RNA was extracted immediately following the manufacturer's (TRIzol, GIBCO-Invitrogen) protocol. The concentration of the RNA was determined using a spectrophotometer at 260/280 nm. The RNA samples were kept at –80°C until the slot-blot analysis was carried out.

Slot-blot analysis of GH and LH mRNA expression. Total RNA (2 µg) was blotted onto a Hybond nylon membrane (Amersham Biosciences, Baie d'Urfe, PQ, Canada) using the Bio-Dot SF blotting apparatus (Bio-Rad Laboratories, Hercules, CA). Specific cDNA probes covering the full length of goldfish LH-{beta} cDNA (GenBank accession no. D88024) and 716 bp of goldfish GH cDNA (GenBank accession no. AF401272) were amplified using specific primers: GtH forward (5'ACTTTTAACAGCCTGCTGAG3') and GtH reverse (5'ACATTTACACAACATTTATT3') for LH-{beta} and GH forward (5'ATGGCTAGAGCATTAGTGCTG3') and GH reverse (5'GATCATAATAACTTAAGGAAG3') for GH. The PCR conditions for amplifying LH-{beta} cDNA probes were denaturation at 94°C for 5 min followed by 35 cycles of denaturation for 1 min at 95°C, annealing at 54°C for 1 min, and extension at 73°C for 1 min. The PCR conditions for amplifying the GH probe were denaturation at 95°C for 5 min followed by 25 cycles of denaturation for 1 min at 95°C, annealing for 1 min at 50°C, and extension for 1 min at 72°C and a final extension at 72°C for 5 min. The probes were labeled with [{alpha}-32P]dCTP using a Rediprime II-Quickprime kit (Qiagen, Mississauga, ON, Canada) following the manufacturer's protocol. The labeled probes were then purified using a QIAquick nucleotide removal kit (Qiagen) following the manufacturer's instructions, and 106 cpm/ml of probe were used for hybridization. First, the membrane was hybridized with the GH probe using previously described methods (48). After hybridization overnight at 65°C, the membranes were washed twice with washing solution (0.04 M NaHPO4, 1 mM EDTA, and 1% SDS) at 65°C. The membranes were then exposed to a PhosphorImager screen (Molecular Dynamics, Sunnyvale, CA) for 3 h, and the screen was scanned using a PhosphorImager 445 SI (Molecular Dynamics) and analyzed using IMAGEQUANT software (Molecular Dynamics). The membrane was then stripped and reprobed with the LH-{beta} probe as described previously and exposed to a phosphor screen for 4 h. The membrane was stripped again and reprobed with an [{alpha}-32P]dCTP-labeled goldfish {beta}-actin (GenBank accession no. AF079831) probe as an internal control. To reduce variability, the control and experimental samples were blotted on the same nylon membrane.

In Vivo Experiments

Intracerebroventricular injections. Our previous studies found that intracerebroventricular injections of 1 ng/g body wt of gGRL-19 stimulated food intake in the goldfish (48). Hence, we selected this dose for intracerebroventricular injections in the present study. Four groups (for sampling at 15, 30, 45, or 60 min) of 12 fish (6 control and 6 experimental fish) each were acclimatized to the aquarium conditions for >=14 days. Intracerebroventricular injections were conducted as described previously (48). Briefly, fish were anesthetized, and a circular saw attached to a dentist drill was used to cut a three-sided flap in the roof of the skull. The flap was folded to the side, and the brain was exposed. Fish were then placed in a stereotaxic apparatus, and the needle of a 5-µl microsyringe (Hamilton, Reno, NV) was placed in the preoptic region of the brain according to the coordinates (+1.0, M, D 1.2) from the brain atlas of Peter and Gill (36). At time 0, fish were injected with 2 µl of fish physiological saline (control fish) or 2 µl of fish physiological saline containing 1 ng/g body wt of gGRL-19 (experimental fish). The cranial cavity was then filled with fish physiological saline, and the skull flap was replaced and sutured using surgical thread. Fish were returned to their respective aquaria to recover from anesthesia (which normally occurs within 5 min). Six control and six experimental fish were anesthetized, and blood samples were collected by caudal puncture at 15 min after injection. Similarly, six control and six experimental fish were sampled at 30, 45, or 60 min after injection. The experiments were conducted in 2 days. Injections were administered in a staggered manner to enable timely sampling. Each fish underwent intracerebroventricular injections and blood sampling only once. Samples were kept at 4°C for several hours to allow clotting and then spun at 8,000 rpm for 5 min for collection of serum. Serum samples were stored at –20°C until the RIA for GH and LH.

Intraperitoneal injections. Previously, we found that intraperitoneal injections of 100 ng/g body wt of gGRL-19 stimulated food intake in goldfish (unpublished observations). Hence, we used 100 ng/g body wt of gGRL-19 for intraperitoneal injections in the present study. Four groups (for sampling at 15, 30, 45, or 60 min) of 16 fish (8 control and 8 experimental fish) each were acclimatized to the aquarium conditions for >=14 days. Intraperitoneal injections were conducted as previously described (15). Briefly, fish were anesthetized and placed in a wet sponge holder. At time 0, a 26-gauge needle (Becton Dickinson, Franklin Lakes, NJ) attached to a 250-µl Hamilton syringe was used to inject one group of fish (n = 2) with 100 µl of fish physiological saline (control fish), and a second group (n = 2) was injected with 100 µl of fish physiological saline containing 100 ng/g of gGRL-19 (experimental fish) in the peritoneal cavity. Eight control and eight experimental fish were anesthetized, and blood samples were collected by caudal puncture at 15 min after injection. Similarly, eight control or eight experimental fish were sampled at 30, 45, or 60 min after injection. The experiments were conducted in 2 days. Injections were administered in a staggered manner to enable timely sampling. Each fish underwent intraperitoneal injections and blood sampling only once. Samples were kept at 4°C for several hours to allow clotting and then spun at 8,000 rpm for 5 min to collect serum. Serum samples were stored at –20°C until the RIA for GH and LH.

Hormone Measurements

All samples were assayed for GH and LH (except the SS experiment samples, which were assayed only for GH). GH and LH levels in the perifusate fractions, static culture samples, and serum samples were measured using previously validated RIAs for GH (28) and LH (37). All samples were assayed in duplicate in the same RIA.

Data Analysis

Data from the perifusion experiments are presented as the percentage of the prepulse GH or LH levels (means ± SE). Prepulse GH or LH levels are the averages of the GH or LH content in the first six fractions of perifusate collected before the administration of the hormone. Because the basal levels of GH in different columns were different, data were first converted to the percent basal of individual columns and then pooled. For static incubation experiments, the data are presented as percentage of GH or LH levels in control wells (means ± SE). The LH and GH mRNA levels are expressed as a ratio of the GH or LH-{beta} mRNA to {beta}-actin mRNA and then normalized as a percentage of its expression levels in the cells in control wells. Statistical analysis of data from the perifusion and static incubation experiments was conducted by ANOVA followed by least significant difference test. Data from the in vivo experiments (intracerebroventricular and intraperitoneal injections) were analyzed using independent t-test. Significance was considered at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell Column Perifusion

Effects of gGRL-12 and gGRL-19 on LH release. gGRL-12 at 0.1, 1, and 10 nM caused a significant stimulation of LH release (Fig. 1A); however, there were no significant differences in the LH release responses between these doses of gGRL-12. No significant effects on LH release were found for 0.001 and 0.01 nM gGRL-12 (Fig. 1A).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. A and B: effects of various concentrations of goldfish ghrelin (gGRL)-12 {GTS[O=C(O)-(CH2)6-CH3]FLSPAQKPQ} and gGRL-19 {GTS[O=C(O)-(CH2)6CH3]FLSPAQKPQGRRPPRM} on luteinizing hormone (LH) release from perifused pituitary cells of goldfish. C and D: effects of various concentrations of gGRL-12 and gGRL-19 on growth hormone (GH) release from perifused pituitary cells of goldfish. For gGRL-12, n = 4 columns (0.001, 0.01, and 0.1 nM) or 6 columns (1 and 10 nM), pooled from 2 different experiments; for gGRL-19, n = 4 columns, pooled from 2 different experiments. PP, prepulse. Results were analyzed using ANOVA followed by least significant difference test. *Significantly higher than PP. #Significantly higher than other treatment groups.

 
gGRL-19 at 0.01, 0.1, 1, and 10 nM caused a significant stimulation of LH release (Fig. 1B); however, there were no significant differences in the LH release responses between these doses of gGRL-19. No effects on LH release were found for 0.001 nM gGRL-19 (Fig. 1B).

Effects of gGRL-12 and gGRL-19 on GH release. gGRL-12 at 0.01, 0.1, 1, and 10 nM caused a significant increase in GH release (Fig. 1C). The effects of 10 nM gGRL-12 in stimulating GH release were significantly greater than the other doses tested. No significant effects on GH were found for 0.001 nM gGRL-12 (Fig. 1C).

gGRL-19 at 0.01, 0.1, 1, and 10 nM caused a significant stimulation of GH release (Fig. 1D); however, there were no significant differences in the GH release responses elicited by 0.01, 0.1, 1, and 10 nM gGRL-19. No significant stimulatory effects on GH release were found for 0.001 nM gGRL-19 (Fig. 1D).

Effects of SS on gGRL-19-induced GH release. SS-14 at 100 nM inhibited the stimulatory effects of 10 nM gGRL-19 on GH release from perifused pituitary cells of goldfish (Fig. 2).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Effects of somatostatin-14 (SS-14) on gGRL-19-induced GH release from dispersed pituitary cells in perifusion. Horizontal bar shows fractions (i.e., 7–19) that were perifused with 100 nM SS-14. Arrow points to fraction in which 10 nM gGRL-19 was administered; n = 4 columns (for SS-14) or 2 columns (positive control without SS-14) from 1 experiment.

 
Static Incubation Experiments

gGRL-12 at 10 nM and gGRL-19 at 10 nM stimulated LH release from dispersed pituitary cells in static culture (Fig. 3, A and B). No effects on LH release were found for 1 nM gGRL-12 or 1 nM gGRL-19.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. A and B: effects of various concentrations of gGRL-12 and gGRL-19 on LH release from dispersed pituitary cells in a 2-h static culture. C and D: effects of various concentrations of gGRL-12 and gGRL-19 on GH release from dispersed pituitary cells in a 2-h static culture. For gGRL-12, n = 24 wells, pooled from 3 different experiments; for gGRL-19, n = 20 wells, pooled from 3 different experiments. Each treatment group was compared with control group using independent t-test. *Significantly different from control.

 
gGRL-12 at 10 nM stimulated GH release from dispersed pituitary cells in static culture (Fig. 3C). gGRL-19 at 1 and 10 nM stimulated GH release (Fig. 3D). No effects on GH release were found for 1 nM gGRL-12.

SS-14 inhibited 10 nM gGRL-19-induced GH release from dispersed pituitary cells in static culture (Fig. 4). D-Lys3-GHRP-6 inhibited the stimulatory effect of ghrelin on LH release from dispersed pituitary cells in static culture (Fig. 5A). The GHSR antagonist D-Lys3-GHRP-6 had no effect on the stimulatory effects of 10 nM gGRL-19 on GH release from dispersed pituitary cells in static culture (Fig. 5B).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4. Effects of somatostatin on ghrelin-induced increase in GH release in static culture. GH levels in control (plain testing medium), 10 nM gGRL-19, or 10 nM gGRL-19 + 1,000 nM SS-14 are shown; n = 12 wells, pooled from 2 different experiments. Each treatment group was compared with control group using independent t-test. *Significantly different from control.

 


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5. Effects of GH secretagogue receptor (GHSR) antagonist D-Lys3-GHRP-6 on gGRL-19-induced LH (A) and GH (B) release from dispersed pituitary cells in static culture. GH or LH levels in control (plain testing medium), 10 nM gGRL-19, or 10 nM gGRL-19 + 1,000 nM D-Lys3-GHRP-6 are shown; n = 8 wells, pooled from 2 different experiments. Each treatment group was compared with control group using independent t-test. *Significantly different from control.

 
LH-{beta} and GH mRNA Expression

gGRL-12 at 10 nM and gGRL-19 at 1 and 10 nM stimulated LH-{beta} mRNA expression in dispersed pituitary cells in static culture (Fig. 6A). Stimulatory effects of 10 nM gGRL-19 on LH-{beta} mRNA expression were greater than those of 10 nM gGRL-12 and 1 nM gGRL-19. No significant stimulatory effects on LH-{beta} mRNA expression were found for 1 nM gGRL-12 (Fig. 6A).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6. Effects of different concentrations of gGRL-12 or gGRL-19 on LH-{beta} (A) and GH mRNA (B) expression in dispersed pituitary cells; n = 4 wells from 1 experiment. Values were compared by ANOVA followed by least significance difference test. *Significantly different from control. #Significantly higher than other treatment groups.

 
gGRL-19 at 10 nM increased GH mRNA expression in dispersed pituitary cells in static culture (Fig. 6B). No stimulatory effects on GH mRNA expression were found for 1 and 10 nM gGRL-12 and 1 nM gGRL-19 (Fig. 6B).

Intracerebroventricular Injections

Intracerebroventricular administration of 1 ng/g body wt of gGRL-19 significantly increased serum LH levels at 60 min after injection (Fig. 7A). No significant changes in serum LH levels were observed at 15, 30, or 45 min after injection (Fig. 7A). Intracerebroventricular administration of 1 ng/g body wt of gGRL-19 caused a significant increase in serum GH levels at 15 and 30 min after injection (Fig. 7B). Serum GH levels at 45 and 60 min after injection were not significantly different from the saline-injected controls (Fig. 7B).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 7. A and B: effects of intracerebroventricular injections of 1 ng/g body wt of gGRL-19 or fish physiological saline (control groups) on serum LH and GH levels in goldfish at 15, 30, 45, or 60 min after injection (n = 6 fish per group). C and D: effects of intraperitoneal injections of 100 ng/g gGRL-19 or fish physiological saline (control groups) on serum LH and GH levels in goldfish at 15, 30, 45, and 60 min after injection (n = 8 fish per group). Saline-injected group for each time point (15, 30, 45, or 60 min) was compared with respective ghrelin-injected group using independent t-test. *Significantly different (P < 0.05) from respective saline-treated control.

 
Intraperitoneal Injections

Intraperitoneal administration of 100 ng/g body wt of gGRL-19 significantly increased serum LH levels at 60 min after injection (Fig. 7C). No significant differences in serum LH levels were found at 15, 30, and 45 min after injection (Fig. 7C). Intraperitoneal administration of 100 ng/g body wt of gGRL-19 caused a significant increase in serum GH levels in goldfish at 15 and 30 min after injection (Fig. 7D). No significant changes in serum GH levels were found at 45 and 60 min after injection (Fig. 7D).


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Effects of Ghrelin on LH and GH Release

A novel finding of this study is the in vitro and in vivo stimulation of LH release in goldfish by gGRL-12 and gGRL-19. Both peptides dose dependently stimulated LH release from perifused pituitary cells and pituitary cells in static culture. These results indicate that ghrelin acts directly on the goldfish gonadotropes. The lowest dose that stimulates LH release from the goldfish pituitary cells is 0.01 nM gGRL-19. The minimal effective dose of ghrelin in this study is 0.001–0.01 nM gGRL-19 or 0.01–0.1 nM gGRL-12, indicating that ghrelin is a potent LH-releasing hormone in goldfish. The minimal effective doses of ghrelin that stimulate LH release are comparable to the minimal effective doses of other LH-releasing hormones in goldfish, such as the gonadotropin-releasing hormone (GnRH) (27) and neuropeptide Y (34). Our results indicate that ghrelin acts directly on the goldfish gonadotropes. In a preliminary study, we found that human ghrelin also stimulates LH release from dispersed pituitary cells in vitro (unpublished observations), adding more supportive evidence for our present findings. Our results contradict a previous report of no effects of ghrelin on LH and follicle-stimulating hormone release in vitro from the pituitary cells of rats (23).

As our in vitro studies indicated that both gGRL-12 and gGRL-19 are biologically active in stimulating LH release, gGRL-19 was used for our in vivo studies. Intracerebroventricular (1 ng/g) and intraperitoneal (100 ng/g) injections of gGRL-19 significantly increased serum LH levels at 60 min after injection. These results agree with the findings of our in vitro studies. However, no effects of ghrelin on LH release in vivo in rats were found (23, 46). In sheep, intracerebroventricular injection of ghrelin decreases LH pulse frequency, but not amplitude (8). Our results indicating stimulation of LH release in vitro and in vivo by ghrelin are unique. The results of the present study indicate that ghrelin may have divergent functions (e.g., LH-releasing activity) in certain animal groups or species. For example, ghrelin is an orexigen in mammals (47, 30) and in goldfish (48), whereas it is a potent anorexigen in chicken (40). Similarly, ghrelin stimulates PRL release in tilapia (39) and eel (19), whereas it has no effects on PRL release in rainbow trout (18).

In the present study, we found that ghrelin dose dependently stimulates GH release from dispersed pituitary cells of goldfish in perifusion and static incubation. These results indicate that ghrelin acts directly on the goldfish somatotropes. The lowest dose that stimulates GH release from goldfish pituitary cells is 0.01 nM. The minimal effective dose of ghrelin in this study is 0.001–0.01 nM, indicating that ghrelin is a potent GH-releasing hormone in goldfish. A recent study found that 1 pM ghrelin is effective in stimulating GH release from porcine somatotropes in vitro (26). In goldfish, zebrafish pituitary adenylate cyclase-activating peptide-38 (zPACAP-38) stimulates GH release from dispersed pituitary cells at doses as low as 0.01 nM (49). The minimal effective doses of ghrelin we found in this study are comparable to the minimal effective doses of ghrelin in mammals and of zPACAP-38 in goldfish. In a preliminary study, we found that human ghrelin also stimulates GH release from dispersed pituitary cells in vitro (unpublished observations), adding more support for our present findings. Ghrelin stimulates GH release from the dispersed pituitary cells of rats (23, 38), pigs (11), and cattle (12). Stimulatory effects of ghrelin on GH release were also reported from studies using the incubated whole pituitaries of tilapia (20, 39), eel (19), and trout (18). Our results agree with these studies that found a stimulatory effect for ghrelin on GH release in mammals and fish.

Intracerebroventricular (1 ng/g) and intraperitoneal (100 ng/g) injections of gGRL-19 significantly increased serum GH levels. These results support our in vitro studies in which ghrelin was found to have a stimulatory effect on GH release. In the present study, intracerebroventricular and intraperitoneal injections of gGRL-19 significantly elevated serum GH levels 15–30 min after injection. By 45–60 min after injection, serum GH levels returned to normal levels. Recently, it was reported that intraperitoneal injections of 250 ng/g body wt of trout ghrelin increased serum GH levels in rainbow trout at 30–60 min after injection, whereas no effects on PRL and somatolactin levels were found (18). Ghrelin has been demonstrated to stimulate GH release in vivo in rats (7, 50, 46), chicken (1, 21), and rainbow trout (18). Our results agree with the results of these studies.

The mechanisms of action of intracerebroventricularly administered ghrelin on GH and LH release are not known. In goldfish, the pituitary is directly innervated by hypothalamic neurons (8). It is possible that the intracerebroventricularly injected ghrelin causes differential actions on the hypothalamic neurons expressing hypophysiotropic peptides [e.g., SS and GH-releasing factor (GnRH)] to stimulate GH or LH release in goldfish. It is also possible that intracerebroventricularly injected ghrelin might diffuse to the pituitary or be transported to the pituitary by the blood vasculature that anastomoses the third ventricle and the pituitary (35).

The results of our present studies on the in vitro and in vivo effects of ghrelin peptides indicate that both putative peptides are biologically active in goldfish. Several structure-activity studies have reported that the acylated NH2-terminal region of ghrelin, composed of four to five amino acids, is biologically active in vitro (2, 29). The octanoylated NH2-terminal region is also called the "bioactive core" or the receptor-binding region of ghrelin (29). Although the number of amino acids in ghrelin peptides varies (15, 17, 18, 21, 48), seven amino acids (GSSFLSP) in the NH2-terminal region of ghrelin are totally conserved among species, except in bullfrog and goldfish, where they are GLTFLSP and GTSFLSP, respectively. Multiple ghrelin peptides (15, 17, 21) and ghrelin peptides with many acyl modifications (15, 17, 18, 21) are present in several species. The diversity in the structure of ghrelin peptides suggests species- or tissue-specific actions of ghrelin and, possibly, the presence of multiple ghrelin receptor(s). Nevertheless, chicken ghrelin (21) stimulates GH release in vivo in rats, whereas bullfrog ghrelin causes a weak stimulation of GH release in vivo in rats (17). Rat ghrelin stimulates GH and PRL release in tilapia (39), and human ghrelin stimulates food intake and LH and GH release in goldfish (unpublished observations) and GH release in chicken (1). These studies showing the biological activity of mammalian ghrelin peptides in nonmammals and vice versa suggest that the octanoylated NH2-terminal conserved region of ghrelin peptides, irrespective of the structural variations, can bind to the ghrelin receptor(s) and elicit some biological responses.

Role of SS-14 on Ghrelin-Induced GH Release

The present study demonstrates that SS-14 can inhibit the stimulatory effects of ghrelin on GH secretion in vitro. SS-14 inhibits basal (52) and stimulated GH release in vitro (34) in the goldfish. The inhibitory actions of SS-14 on ghrelin-stimulated GH release provide further evidence for the direct actions of ghrelin on goldfish pituitary cells. Our results agree with the previous reports on the effects of SS on the GH-releasing activity of ghrelin in mammals (3, 44). Several unpublished observations from our laboratory and similar studies conducted in other cyprinid fish (25) found no effects of SS on LH release.

Role of GHSR Antagonist on Ghrelin-Induced LH and GH Release

GHSR1a is the only known active ghrelin receptor (14). D-Lys3-GHRP-6 is a specific GHSR antagonist used in studies on the effects of ghrelin on GH release in mammals (11, 30). Interestingly, D-Lys3-GHRP-6 inhibited the stimulatory effects of 10 nM gGRL-19 on LH release, whereas no effects were found on the stimulatory effects of 10 nM gGRL-19 on GH release from goldfish pituitary cells in static culture. These results indicate that gonadotropes in goldfish have a GHSR1a-like receptor, whereas somatotropes have a different GHSR. Chen (6) proposed the presence of more than one receptor in mediating the effects of synthetic GHS. Recently, Thompson et al. (45) found that ghrelin stimulates bone marrow adipogenesis in vivo in rats by acting independently of the GHSR1a, suggesting the presence of a receptor other than GHSR1a in mediating the physiological functions of ghrelin in rats. It is also worth mentioning that D-Lys3-GHRP-6 only decreased the ghrelin-induced increase in intracellular calcium concentration in porcine somatotropes (11) and had no effects on ghrelin-stimulated GH release in vivo in rats (31). GHSR has been identified in the pufferfish Spheroides nephelus (32). Pufferfish GHSR has a high structural similarity with the mammalian GHSRs, suggesting that the receptor structure and function are evolutionarily conserved (32). The structure of ghrelin receptor(s) in goldfish is unknown. The identification of the structure and distribution of ghrelin receptor(s) and the binding characteristics of the various ghrelin peptides to these receptors will provide useful information on the species-specific biological actions of ghrelin.

In Vitro Effects of Ghrelin on LH-{beta} and GH mRNA

gGRL-12 at 10 nM and gGRL-19 at 1 and 10 nM stimulated LH-{beta} mRNA expression, whereas only 10 nM gGRL-19 stimulated GH mRNA expression. gGRL-19 elicited a dose-dependent increase in LH-{beta} mRNA expression. These results indicate that, in addition to the stimulation of LH and GH release, ghrelin also stimulates the synthesis of LH and GH in goldfish. Previously, it has been shown that releaser hormones such as GnRH stimulate GH and LH-{beta} mRNA expression in the goldfish pituitary cells in vitro (22). However, in the only study available on the effects of ghrelin on GH mRNA expression in mammals, intracerebroventricular injections of ghrelin had no effects on GH mRNA expression in rat pituitary (7). The basis for the difference in the effects of ghrelin on GH mRNA and LH-{beta} mRNA expression may be due to various factors, including the presence of multiple receptors mediating the actions of ghrelin and the differential effects on gene expression by signaling cascades in the different cell types. In the present study, we found that GHSR antagonist blocks the effects of ghrelin on LH release, whereas no effects were found on GH release, indicating that ghrelin acts on LH and GH release through different receptors. It is also clear that the effects of regulatory peptides on LH subunit mRNA expression are differentially transduced by various intracellular signaling mechanisms (51).

In conclusion, we provide evidence for the LH- and GH-releasing activity of gGRL-12 and gGRL-19 in goldfish. Ghrelin acts directly on goldfish pituitary cells to release LH and GH. Central and peripheral injections of ghrelin stimulate LH and GH release in vivo. Ghrelin also stimulates LH-{beta} and GH mRNA expression, indicating that ghrelin is also involved in the synthesis of LH and GH in goldfish. SS-14 abolishes ghrelin's stimulatory effects on GH secretion. GHSR antagonist did not inhibit the stimulatory effects of ghrelin on GH, whereas it completely abolished the effects of ghrelin on LH release, indicating the presence of more than one receptor in mediating the hypophysiotropic actions of ghrelin. The results of the present study, together with our previous reports on the stimulatory effects of ghrelin on food intake, indicate that ghrelin is a hypophysiotropic orexigen, linking the physiology of food intake, growth, and reproduction in goldfish.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work is supported by Natural Sciences and Engineering Research Council of Canada Grant A06371 to R. E. Peter.


    ACKNOWLEDGMENTS
 
We gratefully acknowledge Dr. Jean E. Rivier and Laura Cervini for a generous gift of goldfish ghrelin peptides, Drs. John P. Chang and Warren K. Yunker for advice on cell culture and RIA, and Dr. Luis Fabian Canosa for critical comments on the manuscript.


    FOOTNOTES
 

Address for reprint requests and other correspondence: R. E. Peter, CW-405 Dept. of Biological Sciences, Univ. of Alberta, Edmonton, AB, Canada T6G 2E9 (E-mail: dick.peter{at}ualberta.ca).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Ahmed S and Harvey S. Ghrelin: a novel hypothalamic GH-releasing factor in domestic fowl (Gallus domesticus). J Endocrinol 172: 117–125, 2002.[Abstract]
  2. Bednarek MA, Feighner SD, Pong SS, McKee KK, Hreniuk DL, Silva MV, Warren VA, Howard AD, Van Der Ploeg LH, and Heck JV. Structure-function studies on the new growth hormone-releasing peptide, ghrelin: minimal sequence of ghrelin necessary for activation of growth hormone secretagogue receptor 1a. J Med Chem 43: 4370–4376, 2000.[CrossRef][Web of Science][Medline]
  3. Broglio F, Van Koetsveld P, Benso A, Gottero C, Prodam F, Papotti M, Muccioli G, Gauna C, Hofland L, Deghenghi R, Arvat E, Van Der Lely AJ, and Ghigo E. Ghrelin secretion is inhibited by either somatostatin or cortistatin in humans. J Clin Endocrinol Metab 87: 4829–4832, 2002.[Abstract]
  4. Burnstock G. Saline for fresh-water fish. J Physiol 141: 35–45, 1958.[Free Full Text]
  5. Chang JP, Cook H, Freedman GL, Wiggs AJ, Somoza GM, de Leeuw R, and Peter RE. Use of pituitary cell dispersion method and primary culture system for the studies of luteinizing hormone releasing hormone action in goldfish, Carassius auratus: initial morphological, static, and cell column perifusion studies. Gen Comp Endocrinol 77: 256–273, 1990.[CrossRef][Web of Science][Medline]
  6. Chen C. Growth hormone secretagogue actions on the pituitary gland: multiple receptors for multiple ligands? Clin Exp Pharmacol Physiol 27: 323–329, 2000.[CrossRef][Web of Science][Medline]
  7. Date Y, Murakami N, Kojima M, Kuroiwa T, Matsukura S, Kangawa K, and Nakazato M. Central effects of a novel acylated peptide, ghrelin, on growth hormone release in rats. Biochem Biophys Res Commun 275: 477–480, 2000.[CrossRef][Web of Science][Medline]
  8. Fryer JN and Maler L. Hypophysiotropic neurons in the goldfish hypothalamus demonstrated by retrograde transport of horseradish peroxidase. Cell Tissue Res 218: 93–102, 1981.[CrossRef][Web of Science][Medline]
  9. Furuta M, Funabashi T, and Kimura F. Intracerebroventricular administration of ghrelin rapidly suppresses pulsatile luteinizing hormone secretion in ovariectomized rats. Biochem Biophys Res Commun 288: 780–785, 2001.[CrossRef][Web of Science][Medline]
  10. Galas L, Chartrel N, Kojima M, Kangawa K, and Vaudry H. Immunohistochemical localization and biochemical characterization of ghrelin in the brain and stomach of the frog, Rana esculenta. J Comp Neurol 450: 34–44, 2002.
  11. Glavaski-Joksimovic A, Jeftinija K, Scanes CG, Anderson LL, and Jeftinija S. Stimulatory effect of ghrelin on isolated porcine somatotropes. Neuroendocrinology 77: 367–379, 2003.[CrossRef][Web of Science][Medline]
  12. Hashizume T, Horiuchi M, Tate N, Nonaka S, Kojima M, Hosoda H, and Kangawa K. Effects of ghrelin on growth hormone secretion from cultured adenohypophysial cells in cattle. Endocr J 50: 280–295, 2003.
  13. Hashizume T, Horiuchi M, Tate N, Nonaka S, Mikami U, and Kojima M. Effects of ghrelin on growth hormone secretion from cultured adenohypophysial cells in pigs. Domest Anim Endocrinol 24: 209–218, 2003.[CrossRef][Web of Science][Medline]
  14. Himick BA and Peter RE. Bombesin acts to suppress feeding behavior and alter serum growth hormone in goldfish. Physiol Behav 55: 65–72, 1994.[CrossRef][Medline]
  15. Hosoda H, Kojima M, Mizushima T, Shimizu S, and Kangawa K. Structural divergence of human ghrelin. Identification of multiple ghrelin-derived molecules produced by posttranslational processing. J Biol Chem 278: 64–70, 2003.[Abstract/Free Full Text]
  16. Howard AD, Feighner SD, Cully DF, Arena JP, Liberator PA, Rosenblum CI, Hamelin M, Hreniuk DL, Palyha OC, Anderson J, Paress PS, Diaz C, Chou M, Liu KK, McKee KK, Pong SS, Chaung LY, Elbrecht A, Dashkevicz M, Heavens R, Rigby M, Sirinathsinghji DJ, Dean DC, Melillo DG, Patchett AA, Nargund R, Griffin PR, DeMartino Ja Gupta SK, Schaeffer JM, Smith RG, and Van der Ploeg LH. A receptor in pituitary and hypothalamus that functions in growth hormone release. Science 273: 974–977, 1996.[Abstract]
  17. Kaiya H, Kojima M, Hosoda H, Koda A, Yamamoto K, Kitajima Y, Matsumoto M, Minamitake Y, Kikuyama S, and Kangawa K. Bullfrog ghrelin is modified by n-octanoic acid at its third threonine residue. J Biol Chem 276: 40441–40448, 2001.[Abstract/Free Full Text]
  18. Kaiya H, Kojima M, Hosoda H, Moriyama S, Takahashi A, Kawauchi H, and Kangawa K. Peptide purification, cDNA and genomic DNA cloning, and functional characterization of ghrelin in rainbow trout. Endocrinology 144: 5215–5226, 2003.[Abstract/Free Full Text]
  19. Kaiya H, Kojima M, Hosoda H, Riley LG, Hirano T, Grau EG, and Kangawa K. Amidated fish ghrelin: purification, cDNA cloning in the Japanese eel and its biological activity. J Endocrinol 176: 415–423, 2003.[Abstract]
  20. Kaiya H, Kojima M, Hosoda H, Riley LG, Hirano T, Grau EG, and Kangawa K. Identification of tilapia ghrelin and its effects on growth hormone and prolactin release in the tilapia, Oreochromis mossambicus. Comp Biochem Physiol B Biochem Mol Biol 135: 421–429, 2003.[CrossRef][Medline]
  21. Kaiya H, Van der Gayten S, Kojima M, Hosoda H, Kitajima Y, Matsumoto M, Geelissen S, Darra VM, and Kangawa K. Chicken ghrelin: purification, cDNA cloning, and biological activity. Endocrinology 143: 3445–3463, 2002.
  22. Klausen C, Chang JP, and Habibi HR. The effect of luteinizing hormone-releasing hormone on growth hormone and luteinizing hormone subunit gene expression in the pituitary of goldfish, Carassius auratus. Comp Biochem Physiol B Biochem Mol Biol 129: 511–516, 2001.[CrossRef][Medline]
  23. Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, and Kangawa K. Ghrelin is a growth hormone releasing acylated peptide from stomach. Nature 402: 656–660, 1999.[CrossRef][Medline]
  24. Kozaka T, Fujii Y, and Ando M. Central effects of various ligands on drinking behavior in eels acclimated to seawater. J Exp Biol 206: 687–692, 2003.[Abstract/Free Full Text]
  25. Lin XW, Lin HR, and Peter RE. Growth hormone and gonadotropin secretion in the common carp (Cyprinus carpio L.): in vitro interactions of gonadotropin-releasing hormone, somatostatin, and the dopamine agonist apomorphine. Gen Comp Endocrinol 89: 62–71, 1993.[CrossRef][Web of Science][Medline]
  26. Malagon MM, Luque RM, Ruiz-Guerrero E, Rodriguez-Pacheco F, Garcia-Navarro S, Casanueva FF, Gracia-Navarro F, and Castano JP. Intracellular signaling mechanisms mediating ghrelin-stimulated growth hormone release in somatotropes. Endocrinology 144: 5372–5380, 2003.[Abstract/Free Full Text]
  27. Marchant TA, Chang JP, Nahorniak CS, and Peter RE. Evidence that luteinizing hormone-releasing hormone also functions as a growth hormone-releasing factor in the goldfish. Endocrinology 124: 2509–2518, 1989.[Abstract/Free Full Text]
  28. Marchant TA, Dulka JG, and Peter RE. Relationship between serum growth hormone levels and the brain and pituitary content of immunoreactive somatostatin in the goldfish, Carassius auratus. Gen Comp Endocrinol 73: 458–468, 1989.[CrossRef][Web of Science][Medline]
  29. Matsumoto M, Hosoda H, Kitajima Y, Morozumi N, Minamitake Y, Tanaka S, Matsuo H, Kojima M, Hayashi Y, and Kangawa K. Structure-activity relationship of ghrelin: pharmacological study of ghrelin peptides. Biochem Biophys Res Commun 287: 142–146, 2001.[CrossRef][Web of Science][Medline]
  30. Nakazato M, Murukami N, Date Y, Kojima M, Matsuo H, Kangawa K, and Matsukura S. A role of ghrelin in the central regulation of feeding. Nature 409: 194–198, 2001.[CrossRef][Medline]
  31. Okimura Y, Ukai K, Hosoda H, Murata M, Iguchi G, Iida K, Kaji H, Kojima M, Kangawa K, and Chihara K. The role of circulating ghrelin in growth hormone (GH) secretion in freely moving male rats. Life Sci 72: 2517–2524, 2003.[CrossRef][Web of Science][Medline]
  32. Palyha OC, Feighner SD, Tan CP, McKee KK, Hreniuk DL, Gao YD, Schleim KD, Yang L, Morriello GJ, Nargund R, Patchett AA, Howard AD, and Smith RG. Ligand activation domain of human orphan growth hormone (GH) secretagogue receptor (GHS-R) conserved from pufferfish to humans. Mol Endocrinol 14: 160–169, 2000.[Abstract/Free Full Text]
  33. Parhar IS, Sato H, and Sakuma Y. Ghrelin gene in cichlid fish is modulated by sex and development. Biochem Biophys Res Commun 305: 169–175, 2003.[CrossRef][Web of Science][Medline]
  34. Peng C, Humphries S, Peter RE, Rivier JE, Blomqvist AG, and Larhammar D. Actions of goldfish neuropeptide Y on the secretion of growth hormone and gonadotropin-II in female goldfish. Gen Comp Endocrinol 90: 306–317, 1993.[CrossRef][Web of Science][Medline]
  35. Peter RE and Fryer JN. Endocrine functions of hypothalamus of actinopterygians. In: Fish Neurobiology. Higher Brain Areas and Functions, edited by Davis RE and Northcutt RG. Ann Arbor, MI: University of Michigan Press, 1983, vol. II, p. 165–201.
  36. Peter RE and Gill VE. A stereotaxic atlas and technique for forebrain nuclei of goldfish, Carassius auratus. J Comp Neurol 159: 69–102, 1975.[CrossRef][Web of Science][Medline]
  37. Peter RE, Nahorniak CS, Chang JP, and Crim LW. Luteinizing hormone release from the pars distalis of the goldfish, Carassius auratus, transplanted beside the brain or into the brain ventricles: additional evidence for a luteinizing hormone release-inhibiting factor. Gen Comp Endocrinol 55: 337–346, 1984.[CrossRef][Web of Science][Medline]
  38. Pinilla L, Barreiro ML, Tena-Sempere M, and Aguilar E. Role of ghrelin in the control of growth hormone secretion in prepubertal rats: interactions with excitatory amino acids. Neuroendocrinology 77: 83–90, 2003.[CrossRef][Web of Science][Medline]
  39. Riley LG, Hirano T, and Grau EG. Rat ghrelin stimulates growth hormone and prolactin release in the tilapia, Oreochromis mossambicus. Zoolog Sci 19: 797–800, 2002.
  40. Saito ES, Kaiya H, Takagi T, Yamasaki I, Denbow DM, Kangawa K, and Furuse M. Chicken ghrelin and growth hormone-releasing peptide-2 inhibit food intake of neonatal chicks. Eur J Pharmacol 453: 75–79, 2002.[CrossRef][Web of Science][Medline]
  41. Sakurai T, Amemiya A, Ishii M, Matsuzaki I, Chemelli RM, Tanaka H, Williams SC, Richardson JA, Kozlowski GP, Wilson S, Arch JR, Buckingham RE, Haynes AC, Carr SA, Annan RS, McNulty DE, Liu WS, Terrett JA, Elshourbagy NA, Bergsma DJ, and Yanagisawa M. Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell 92: 573–585, 1999.
  42. Takaya K, Ariyasu H, Kanamoto N, Iwakura H, Yoshimoto A, Harada M, Mori K, Komatsu Y, Usui T, Shimatsu A, Ogawa Y, Hosoda K, Akamizu T, Kojima M, Kangawa K, and Nakao K. Ghrelin strongly stimulates growth hormone release in humans. J Clin Endocrinol Metab 85: 4908–4911, 2000.[Abstract/Free Full Text]
  43. Tannenbaum GS and Bowers CY. Interactions of growth hormone secretagogues and growth hormone-releasing hormone/somatostatin. Endocrine 14: 21–27, 2001.[CrossRef][Web of Science][Medline]
  44. Tannenbaum GS, Epelbaum J, and Bowers CY. Interrelationship between the novel peptide ghrelin and somatostatin/growth hormone-releasing hormone in regulation of pulsatile growth hormone secretion. Endocrinology 144: 967–974, 2003.[Abstract/Free Full Text]
  45. Thompson NM, Gill DA, Davies R, Loveridge N, Houston PA, Robinson IC, and Wells T. Ghrelin and des-octanoyl ghrelin promote adipogenesis directly in vivo by a mechanism independent of GHS-R1a. Endocrinology 145: 234–242, 2004.[Abstract/Free Full Text]
  46. Tolle V, Zizzari P, Tomasetto C, Rio MC, Epelbaum J, and Bluet-Pajot MT. In vivo and in vitro effects of ghrelin/motilin-related peptide on growth hormone secretion in the rat. Neuroendocrinology 73: 54–61, 2001.[CrossRef][Web of Science][Medline]
  47. Tschop M, Smiley DL, and Heiman ML. Ghrelin induces adiposity in rodents. Nature 407: 908–913, 2000.[CrossRef][Medline]
  48. Unniappan S, Lin X, Cervini L, Rivier J, Kaiya H, Kangawa K, and Peter RE. Goldfish ghrelin: molecular characterization of the complementary deoxyribonucleic acid, partial gene structure, and evidence for its stimulatory role in food intake. Endocrinology 143: 4143–4146, 2002.[Abstract]
  49. Wong AO, Leung MY, Shea WL, Tse LY, Chang JP, and Chow BK. Hypophysiotropic action of pituitary adenylate cyclase-activating polypeptide (PACAP) in the goldfish: immunohistochemical demonstration of PACAP in the pituitary, PACAP stimulation of growth hormone release from pituitary cells, and molecular cloning of pituitary type I PACAP receptor. Endocrinology 139: 3465–3479, 1998.[Abstract/Free Full Text]
  50. Wren AM, Small CJ, Ward HL, Murphy KG, Dakin CL, Taheri S, Kennedy AR, Roberts GH, Morgan DG, Ghatei MA, and Bloom SR. The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology 141: 4325–4328, 2000.[Abstract/Free Full Text]
  51. Yaron Z, Gur G, Melamed P, Rosenfeld H, Elizur A, and Levavi-Sivan B. Regulation of fish luteinizing hormones. Int Rev Cytol 225: 131–185, 2003.[Web of Science][Medline]
  52. Yunker WK, Smith S, Graves C, Davis PJ, Unniappan S, Rivier JE, Peter RE, and Chang JP. Endogenous hypothalamic somatostatins differentially regulate growth hormone secretion from goldfish pituitary somatotropes in vitro. Endocrinology 144: 4031–4041, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
L. F. Canosa, S. Unniappan, and R. E. Peter
Periprandial changes in growth hormone release in goldfish: role of somatostatin, ghrelin, and gastrin-releasing peptide
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2005; 289(1): R125 - R133.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/6/R1093    most recent
00669.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (30)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Unniappan, S.
Right arrow Articles by Peter, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Unniappan, S.
Right arrow Articles by Peter, R. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.