|
|
||||||||
APPETITE, OBESITY, DIGESTION, AND METABOLISM
agonism on adipose tissue remodeling, insulin sensitivity, and lipemia in absence of glucocorticoids
1Laval Hospital Research Center, Department of Anatomy and Physiology, School of Medicine; and 2Research Center of Laval University Hospital Center, Laval University, Québec, Quebec, Canada G1K 7P4
Submitted 25 May 2004 ; accepted in final form 8 July 2004
| ABSTRACT |
|---|
|
|
|---|
(PPAR
) agonists improve insulin sensitivity and lipemia partly through enhancing adipose tissue proliferation and capacity for lipid retention. The agonists also reduce local adipose glucocorticoid production, which may in turn contribute to their metabolic actions. This study assessed the effects of a PPAR
agonist in the absence of glucocorticoids (adrenalectomy, ADX). Intact, ADX, and intact pair-fed (PF) rats were treated with the PPAR
agonist rosiglitazone (RSG) for 2 wk. RSG increased inguinal (subcutaneous) white (50%) and brown adipose tissue (6-fold) weight but not that of retroperitoneal (visceral) white adipose tissue. ADX but not PF reduced fat accretion in both inguinal and retroperitoneal adipose depots but did not affect brown adipose mass. RSG no longer increased inguinal weight in ADX and PF rats but increased brown adipose mass, albeit less so than in intact rats. RSG increased cell proliferation in white (3-fold) and brown adipose tissue (6-fold), as assessed microscopically and by total DNA, an effect that was attenuated but not abrogated by ADX. RSG reduced the expression of the glucocorticoid-activating enzyme 11
-hydroxysteroid dehydrogenase 1 (11
-HSD1) in all adipose depots. RSG improved insulin sensitivity (reduction in fasting insulin and homeostasis model assessment of insulin resistance, both 50%) and triacylglycerolemia (75%) regardless of the glucocorticoid status, these effects being fully additive to those of ADX and PF. In conclusion, RSG partially retained its ability to induce white and brown adipose cell proliferation and brown adipose fat accretion and further improved insulin sensitivity and lipemia in ADX rats, such effects being therefore independent from the PPAR
-mediated modulation of glucocorticoids.
peroxisome proliferator-activated receptor-
; 11
-hydroxysteroid dehydrogenase; triacylglycerols
(PPAR
) is a ligand-activated nuclear receptor whose
2 form is highly expressed in white adipose tissue (WAT) where it regulates the expression of a number of genes involved in adipogenesis and anabolic lipid metabolism (3, 41). The net result of PPAR
activation is a remodeling of WAT with a larger number of smaller adipocytes (2, 14, 48, 57). PPAR
activation also efficaciously ameliorates whole body and muscle insulin resistance (41, 43, 48) as well as hypertriacylglycerolemia (2, 29), albeit at the expense of some gain in fat mass. Synthetic thiazolidinedione PPAR
ligands are used clinically to treat insulin resistance and type 2 diabetes (41, 55).
In addition to beneficial alterations in the pattern of adipocytokine production, the insulin-sensitizing action of PPAR
agonists is believed to derive largely from an enhanced lipid retention by adipose tissue, which in turn reduces exposure of other insulin-sensitive tissues to fatty acids (3, 25). This is achieved through several pathways, which include a depot-specific induction of the expression of proteins involved in triacylglycerol-derived fatty acid uptake and binding, de novo fatty acid and triacylglycerol synthesis, and fatty acid reesterification, along with downregulation of genes involved in lipid release (3, 41). Another relevant gene that has been found to be downregulated in WAT by PPAR
agonists (4, 28) is that which codes for 11
-hydroxysteroid dehydrogenase 1 (11
HSD1), an enzyme expressed in the brain, liver, and adipose tissue that locally converts inactive glucocorticoids into bioactive forms such as cortisol in humans and corticosterone (Cort) in rodents (45). This enzyme is particularly relevant to the metabolic effects of PPAR
agonism because excess glucocorticoids promote visceral obesity, hyperlipidemia, and insulin resistance (52, 56), as seen for instance in human Cushing's syndrome (5, 40). Beyond systemic glucocorticoids, the removal of which prevents or reverses many forms of obesity (7, 42), the importance of 11
HSD1-mediated local amplification of glucocorticoid action in adipose tissue is being increasingly recognized (44). This is vividly illustrated by the development of visceral obesity and the metabolic syndrome in mice overexpressing adipose 11
HSD1 (32) and by the lack thereof in response to high-fat feeding in mice with 11
HSD1 gene invalidation (26, 36, 37). Of note is the fact that, in contrast with PPAR
agonism, glucocorticoids upregulate 11
HSD1 expression in WAT (22, 45, 49). Finally, in addition to glucocorticoid-PPAR
interactions at the level of 11
HSD1, glucocorticoids are well known to be required for adipocyte differentiation in vitro and may conceivably impact PPAR
-mediated modulation of adipose cellularity in vivo.
Whereas the metabolic consequences of excess glucocorticoids are well established, the contribution of alterations in the glucocorticoid status by PPAR
agonists to the beneficial metabolic effects of these compounds is unknown. To gain insight into this issue, the present study was conducted to evaluate the importance of glucocorticoid modulation in PPAR
action by assessing in rats the impact of the PPAR
agonist rosiglitazone (RSG) in the absence of glucocorticoids, achieved through adrenalectomy (ADX). The end points included indexes of adipose tissue accretion and cellularity, as well as insulin sensitivity and lipemia, which are major metabolic targets of PPAR
agonism. The hypothesis to be tested was that, because PPAR
agonism normally reduces the impact of glucocorticoids in adipose tissue, the absence of glucocorticoids diminishes the influence of PPAR
agonism on adipose tissue morphology/function and consequently on whole body metabolic variables. Brown adipose tissue (BAT) was also studied because in rodents it is a major target of PPAR
agonism, which transforms BAT into a major site of lipid accumulation (8, 24, 28, 46). Because of the reciprocal modulatory interactions between PPAR
and glucocorticoid signaling on 11
HSD1 and the key influence of the enzyme on local Cort action in adipose tissue, the above determinations were complemented by assessment of treatment effects on 11
HSD1 expression levels. Glucocorticoids greatly affect whole body energy balance through favoring food intake and reducing energy expenditure (12, 50). To dissociate the consequences of glucocorticoid removal per se from those due to its reducing action on food intake and energy deposition, additional groups of intact rats were pair fed (PF) to the ADX animals.
| MATERIALS AND METHODS |
|---|
|
|
|---|
agonist RSG (purchased as Avandia at a local pharmacy, 30 mg·kg1·day1) for the 2-wk treatment period. The amount of food provided to the PF groups was adjusted every other day to food intake of the corresponding ADX group. The amount of RSG was adjusted twice weekly to the average food consumption of each group so as to provide the same amount per unit body weight to all groups. On the day before last, both control and RSG-treated PF groups were fed at 2200 to minimize the duration of fasting before death. On the last day, food was removed at 0730, and rats were killed at the beginning of the afternoon. Because of the food intake adjustment period, food intake and weight gain were calculated from day 4 to day 14. Serum and tissue sampling. Rats were killed by decapitation, and blood was collected from the neck wound and centrifuged (1,500 g, 15 min at 4°C), and the separated serum was stored at 80°C until later biochemical measurements. Inguinal (IWAT) and retroperitoneal white adipose tissues (RWAT), taken as representative of subcutaneous (SF) and visceral fat (VF), respectively, as well as interscapular brown adipose tissue (BAT), were excised, weighed, and prepared for further analysis as described below. A sample of liver was immediately frozen and stored at 80°C for later quantification of triacylglycerol content in lipid extracts (19).
Serum/tissue determinations. Serum glucose concentrations were measured by the glucose oxidase method with the Beckman glucose analyzer. Insulin and Cort were determined by RIA using reagent kits from Linco Research (St. Charles, MO) with rat insulin and Cort as standards, respectively. An index of fasting insulin resistance, consisting of the product of fasting serum glucose and insulin, was calculated according to the homeostasis model assessment of insulin resistance (HOMA-IR) described by Matthews et al. (33). Triacylglycerol concentrations in serum and liver lipid extracts were measured by an enzymatic method using a reagent kit from Roche Diagnostics (Montreal, Quebec, Canada) that allows correction for free glycerol.
Adipocyte morphology by light microscopy and DNA content. IWAT, RWAT, and BAT samples were fixed in 0.1 mmol/l PBS (pH 7.3) containing 4% paraformaldehyde and embedded in paraffin. Thin sections were mounted on glass slides and dyed with hematoxylin/eosin. Digital images of tissue slices were captured using an Olympus BX60 microscope equipped with a Sony RT Slider Spot Camera (Camsen Group, Markham, ON, Canada) at a magnification of 10x (IWAT and RWAT) or 40x (BAT). Total DNA content of RWAT and BAT samples was determined with the DNeasy Tissue Purification kit from Qiagen (Mississauga, ON, Canada) according to manufacturer's instructions.
Adipose tissue RNA isolation and analysis of 11
HSD1 mRNA.
Total RNA was prepared from IWAT, RWAT, and BAT using the Trizol RNA extraction method. RNA concentration was estimated from absorbance at 260 nm, and RNA was reverse transcribed using the Expand reverse transcriptase (Roche Diagnostics, Laval, QC, Canada). The expression level of mRNA was quantitated using quantitative fluorescent real-time PCR (Corbett Research, New South Wales, Australia). Amplification and detection of target mRNA were performed with Platinum Taq polymerase and the intercalating dye SybrGreen I. The primers, designed using the Vector NTI program and synthesized by Invitrogen (Burlington, ON, Canada), were the following: for 11
HSD1, 5'-primer (5'-3') AATGGGAGCCCATGTGGTATTG; 3'-primer (5'-3') GCACAGAGTGGATATCATCGTGG; for L273431 (L27), 5'-primer (5'-3') CTGCTCGCTGTCGAAATG; 3'-primer (5'-3') CCTTGCGTTTCAGTGCTG. The levels of 11
HSD1 mRNA were normalized to the amount of L27 mRNA (a gene not affected by treatments) detected in each sample, and results are expressed as 11
HSD1/L27 mRNA.
Statistical analysis. Data are presented as means ± SE and were analyzed by a three x two factorial ANOVA. For convenience, the ADX and PF interventions and their control (intact, ad libitum fed) were grouped into a factor termed Cort status, and the main and interactive effects of the Cort status, with three levels (intact, ADX, intact PF), and drug treatment, with two levels (control, RSG), were analyzed. Some variables were log transformed before analysis to ensure homogeneity of variance. Pairwise differences between individual group means were analyzed by Fisher's protected least significant difference test. Differences were considered statistically significant at P < 0.05.
| RESULTS |
|---|
|
|
|---|
|
|
agonists. Figure 2B shows that ADX, but not PF, decreased total DNA in RWAT compared with the intact group in both control and RSG-treated cohorts. RSG increased RWAT DNA in all groups, but the magnitude of the increase was smaller in ADX than in intact and PF groups. In absolute terms, the RSG-induced increase in RWAT DNA was approximately threefold larger in intact than in ADX animals. PF rats were statistically indistinguishable from intact rats and different from the ADX groups. Regarding BAT, its microscopic appearance was not notably altered by ADX or PF in untreated rats (Fig. 2C, left), confirming the weight data. RSG treatment (Fig. 2C, right) was associated with the appearance of larger lipid droplets, an effect that was somewhat dampened in ADX and PF rats. Observation at higher magnitudes (not shown) indicated that in intact rats some lipid droplets had begun to coalesce, leading to the appearance of monolocular fat cells. BAT DNA (Fig. 2D) displayed responses to treatment conditions that resembled those in RWAT, except that the RSG-induced DNA increase in PF rats was less pronounced than in the latter.
|
agonism exert divergent actions on 11
HSD1 expression, we next determined whether the Cort status and RSG interacted on its modulation. Expression levels of the enzyme were quite variable in animals not treated with RSG, but there was a tendency for ADX to reduce 11
HSD1 expression in both WAT depots (Table 2), which nearly reached significance in RWAT (P = 0.07). Such reduction was absent in PF rats, suggesting an effect of Cort independent of that on food intake. RSG robustly reduced the expression of 11
HSD1 independently of the Cort status in both WAT depots. In BAT, 11
HSD1 mRNA was not affected by the Cort status, but RSG exerted a significant global decreasing effect that was statistically independent of the Cort status.
|
agonism (Fig. 3). The Cort status exerted a slight but significant (P < 0.03) global effect on fasting serum glucose (not shown), which was entirely explained by a reduction in glycemia in PF rats treated with RSG (PF RSG 7.3 ± 0.2 vs. PF control 8.0 ± 0.2 mM, P < 0.05). RSG did not affect fasting glycemia in intact and ADX groups. Both ADX and PF decreased fasting insulin by
30% (Fig. 3A). RSG decreased insulinemia in all groups to approximately one-half of the levels found in untreated rats. The hypoinsulinemic effect of ADX or PF and that of RSG were fully additive. These treatment effects were reflected in the HOMA-IR index (Fig. 3B), which is inversely proportional to insulin sensitivity. Both ADX and PF decreased serum triacylglycerol concentrations (Fig. 3C). RSG treatment also decreased triacylglycerolemia in all groups, although less so in PF animals. As in the case of insulinemia, the effects of ADX or PF and those of RSG tended to be additive. The same pattern of response was found for liver triacylglycerol concentration (data not shown), the main source of fasting circulating triacylglycerols, for which treatment additivity was robust.
|
| DISCUSSION |
|---|
|
|
|---|
agonist on adipose tissue accretion and cellularity, lipemia, and indexes of insulin sensitivity in rats deprived of Cort, with control for food intake. The findings indicate that effects of PPAR
agonism on adipose tissue such as cell proliferation and weight accretion are dampened but partially preserved in the absence of Cort and that its beneficial global metabolic actions are maintained, such effects being therefore independent of PPAR
-mediated modulation of glucocorticoids.
As expected (1, 30, 50), ADX reduced food intake by
15%. In contrast, RSG brought about a 10% increase in food intake of intact rats, consistent with earlier reports (8, 28). This hyperphagic effect of RSG was completely lost in ADX and PF animals. In fact, RSG tended to paradoxically decrease food intake in ADX rats and did so significantly in PF animals, which did not ingest all of the restricted amount of food provided. Although the mechanisms by which PPAR
agonism impacts food intake have not been systematically addressed to date, its orexigenic effect has been tentatively attributed to the downregulation of adipose tissue leptin expression (53, 58). However, ADX, PF, and PPAR
agonism have all been reported to reduce circulating leptin levels (1, 6, 15, 16, 21, 27, 47), which is not congruent with the divergent effect of RSG on food intake of intact vs. ADX and PF rats. The present findings instead suggest the possibility that RSG may exert direct or indirect central effects on ingestive behavior that appear to be dependent on food availability.
The ADX- and PF-induced changes in energy balance had the expected consequences on fat accretion in rats not treated with RSG. Whereas ADX decreased fat deposition in both IWAT and RWAT, particularly in the latter, PF did not influence final depot weights. This is because of the divergent impact of ADX and PF on sympathetically activated thermogenesis, which results in fat loss in ADX and fat sparing in PF animals (17).
RSG exerted robust effects on fat deposition that were highly depot specific and strongly dependent on the Cort status. In intact animals, the largest relative weight increase induced by RSG occurred in BAT (6-fold), followed by IWAT (
50%), whereas RWAT weight remained unaffected. These findings and our previous study (28) suggest that PPAR
agonists favor fat accumulation mostly in BAT and subcutaneous WAT depots in the rat, rather than in visceral fat. In humans, PPAR
agonism also favors subcutaneous fat accretion and has been reported to decrease visceral fat mass (34, 35). Interestingly, fat accumulation in rodent BAT occurs in the face of a nonfunctional induction of uncoupling protein 1 expression, and the organ becomes a lipid-storing, rather than a thermogenic, tissue (46). Except for a slight decrease in ADX rats, food efficiency was not notably affected by RSG, indirectly suggesting a lack of effect on thermogenesis in the present conditions. Instead, lipid uptake and retention possibly constitute major means of BAT lipid accretion in view of the fact that fat accumulation is clearly present as early as 24 h after exposure to a PPAR
agonist (M. Laplante and Y. Deshaies, unpublished observations). The depot specificity of action of RSG was even more marked in ADX and PF animals. Indeed, whereas RSG no longer favored IWAT accretion in the latter groups, the drug actually reduced RWAT accretion, but partially maintained its weight-increasing action in BAT. This may explain the RSG-induced reduction in RWAT of these rats by virtue of a preferential substrate uptake and deposition by BAT under conditions of low energy availability. Therefore, an adequate supply of dietary energy is needed for PPAR
agonism to increase fat deposition in WAT, but such ability is retained in BAT under energy restriction, independently of the presence or absence of Cort. Finally, it should be noted that the effects of RSG on fat accretion in the various depots are fully restored in ADX rats receiving exogenous Cort (Berthiaume and Deshaies, unpublished observations).
Regarding adipose tissue cellularity, ADX is thought to bring about a decrease mostly in cell size rather than number (18), at least over the short time periods over which ADX is usually studied, whereas food restriction, obviously depending on severity and duration, has been reported to reduce mainly adipocyte size but also fat cell proliferation to some extent, at least in the WAT depots examined here (20). In rats not treated with RSG of the present study, the total DNA content of RWAT was only slightly reduced in ADX, and not at all in PF animals; no effect of the Cort status was observed in BAT. As expected (4, 41), RSG favored adipose cell proliferation in intact animals, as witnessed by the higher cell density per unit area in treated vs. untreated rats observed microscopically and confirmed by the higher DNA content of RWAT (3-fold) and BAT (6-fold). Although IWAT DNA was not determined here, PPAR
agonists are well known to induce cell proliferation also in subcutaneous fat (14, 39). Importantly, RSG retained its ability to induce cell proliferation in the absence of Cort. However, the DNA data indicate that the magnitude of the stimulation of cell proliferation elicited by RSG was clearly dampened in ADX rats. RSG increased DNA content in PF rats somewhat more than in ADX animals, particularly in RWAT, suggesting a facilitative role for Cort in PPAR
-mediated cell proliferation. The fact that in vitro Cort limits adipocyte proliferation, favoring differentiation instead (51), suggests the involvement of an alternate, Cort-controlled factor, which remains to be identified.
Because glucocorticoids and PPAR
agonism exert divergent actions on the expression of the 11
HSD1 gene, and given the importance of the enzyme in modulating glucocorticoid abundance in WAT, it was of particular interest to determine whether these pathways interacted on 11
HSD1 expression. The direct, food intake-independent upregulation of 11
HSD1 expression by Cort (22, 45, 49) tended to be confirmed in both WAT depots, as was its downregulation by RSG (4), which proved to be efficient independently of the Cort status. This provides novel evidence that under normal conditions the stimulatory action of Cort on 11
HSD1 expression does not counteract the strong downregulatory effect of PPAR
agonism. In BAT, the Cort status did not affect 11
HSD1 expression and the inhibitory effect of RSG was relatively less potent than in WAT, indicating that the gene may be under tissue-specific modulation. The precise impact of 11
HSD1 inhibition by PPAR
agonists on adipose lipid metabolism remains to be further characterized.
Although PPAR
actions on insulin sensitivity that are not mediated by those exerted on adipose tissue clearly cannot be excluded (25, 54), ample evidence supports the notion that PPAR
agonists improve insulin sensitivity mainly through adipose tissue remodeling, increased capacity for lipid uptake/retention, and altered adipocytokine secretion pattern (2, 3, 14, 41, 48, 57). Hence, in the A-ZIP/F-1 mouse model of lipoatrophy, PPAR
agonism remains able to improve skeletal muscle insulin sensitivity, albeit at the expense of a severe deterioration of that of the liver (25), such that whole body insulin action is no longer ameliorated (10). In line with this concept, it is not unreasonable to interpret the additive RSG-induced improvement in indexes of insulin sensitivity over that of ADX being due to the partial maintenance of the effects of RSG on adipose tissue metabolism. Regarding triacylglycerolemia, the mechanisms underlying its reduction by PPAR
agonists in rodent models (13, 23, 28) remain unclear but may involve actions at the level of both liver very low density lipoprotein-triacylglycerol secretion (9) and triacylglycerol hydrolysis by adipose tissue lipoprotein lipase (28). The present findings clearly demonstrate that PPAR
agonism has the capacity to bring about a reduction in triacylglycerolemia beyond that elicited by glucocorticoid removal.
In summary, the RSG-induced increase in IWAT weight seen in intact animals was lost in ADX and food-restricted rats, but that in BAT was partially retained. RSG also retained its ability to induce WAT and BAT proliferation in the absence of glucocorticoids, albeit with lesser absolute potency than in intact rats, indicating that in vivo, Cort per se or an alternate factor controlled by Cort facilitates PPAR
-induced adipocyte proliferation. Inasmuch as the beneficial metabolic effects of RSG are due to its modulation of adipose tissue metabolism, the partial preservation of RSG-induced WAT and BAT proliferation and BAT lipid-retaining capability in ADX and PF animals was associated with a robust expression of the insulin-sensitizing and hypolipidemic actions of RSG, which were fully additive to those of ADX, and therefore independent from PPAR
modulation of glucocorticoids.
Perspectives
PPAR
and glucocorticoids are transcriptional factors that play important roles in adipose tissue metabolism. Both PPAR
agonism and glucocorticoids (in the low physiological range) favor adipogenesis and anabolic lipid metabolism. Remarkably, however, despite these similarities, the stimulation of the PPAR
pathway leads to a vast improvement in the metabolic profile at the whole body level, whereas the opposite occurs when glucocorticoids are in excess. Such extreme differences undoubtedly derive from many causative factors. The depot specificity of action of PPAR
agonism (mostly subcutaneous WAT, and BAT in rodents) and glucocorticoids (mostly visceral WAT), specific actions of PPAR
agonism on pathways of lipid retention that glucocorticoids do not share or even antagonize (e.g., adipose phosphoenolpyruvate carboxykinase, which favors fatty acid reesterification), as well as the interactions between the two pathways (e.g., PPAR
-mediated inhibition of 11
HSD1), may all be part of such divergent actions. That the metabolic effects of RSG persist in ADX animals should not be interpreted as meaning that a reduction in local glucocorticoids through 11
HSD1 downregulation does not partake in the mechanisms of action of PPAR
agonism on adipose tissue metabolism, such involvement perhaps being more apparent in the presence of normal energy intake. The present study, however, clearly demonstrates that the potency of PPAR
agonism to improve the metabolic profile extends over and beyond, and is therefore partly independent from, the beneficial metabolic effects of a reduction in glucocorticoids.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
ligands inhibit adipocyte 11
-hydroxysteroid dehydrogenase type 1 expression and activity. J Biol Chem 276: 1262912635, 2001.
-Hydroxysteroid dehydrogenase is an exclusive 11
-reductase in primary cultures of rat hepatocytes: effect of physicochemical and hormonal manipulations. Endocrinology 136: 47544761, 1995.[Abstract]
agonists. Diabetes 51: 24122419, 2002.
and
mediate in vivo regulation of uncoupling protein (UCP-1, UCP-2, UCP-3) gene expression. Endocrinology 139: 49204927, 1998.
-Hydroxysteroid dehydrogenase type 1 knockout mice show attenuated glucocorticoid-inducible responses and resist hyperglycemia on obesity or stress. Proc Natl Acad Sci USA 94: 1492414929, 1997.
activation mediates adipose depot-specific effects on gene expression and lipoprotein lipase activity: mechanisms for modulation of postprandial lipemia and differential adipose accretion. Diabetes 52: 291299, 2003.
-hydroxysteroid dehydrogenase type 1 null mice. J Biol Chem 276: 4129341300, 2001.
-hydroxysteroid dehydrogenase type 1-deficient mice. Diabetes 53: 931938, 2004.
and glucose homeostasis. Annu Rev Nutr 22: 167197, 2002.[CrossRef][ISI][Medline]
-hydroxysteroid dehydrogenase in adipose tissue. Recent Prog Horm Res 59: 359393, 2004.
-Hydroxysteroid dehydrogenase type 1a tissue-specific amplifier of glucocorticoid action. Endocrinology 142: 13711376, 2001.
agonism increases the capacity for sympathetically-mediated thermogenesis in lean and ob/ob mice. Endocrinology 10.1210/en.20040321, 2004.
: adipogenic regulator and thiazolidinedione receptor. Diabetes 47: 507514, 1998.[Abstract]
-Hydroxysteroid dehydrogenase. Vitam Horm 57: 249324, 1999.[ISI][Medline]
-hydroxysteroid dehydrogenase expression in adipose tissue. Horm Metab Res 34: 746751, 2002.[CrossRef][ISI][Medline]
activation has coordinate effects on gene expression in multiple insulin-sensitive tissues. Endocrinology 142: 12691277, 2001.
and metabolic disease. Annu Rev Biochem 70: 341367, 2001.[CrossRef][ISI][Medline]
(PPAR
) deficiency and PPAR
agonist improve insulin resistance. J Biol Chem 276: 4124541254, 2001.This article has been cited by other articles:
![]() |
G. J. Hausman, S. P. Poulos, T. D. Pringle, and M. J. Azain The influence of thiazolidinediones on adipogenesis in vitro and in vivo: Potential modifiers of intramuscular adipose tissue deposition in meat animals J Anim Sci, April 1, 2008; 86(14_suppl): E236 - E243. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Roberge, A. C. Carpentier, M.-F. Langlois, J.-P. Baillargeon, J.-L. Ardilouze, P. Maheux, and N. Gallo-Payet Adrenocortical dysregulation as a major player in insulin resistance and onset of obesity Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1465 - E1478. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Laplante, W. T. Festuccia, G. Soucy, Y. Gelinas, J. Lalonde, and Y. Deshaies Involvement of adipose tissues in the early hypolipidemic action of PPAR{gamma} agonism in the rat Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2007; 292(4): R1408 - R1417. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nakano, Y. Inada, H. Masuzaki, T. Tanaka, S. Yasue, T. Ishii, N. Arai, K. Ebihara, K. Hosoda, K. Maruyama, et al. Bezafibrate regulates the expression and enzyme activity of 11beta-hydroxysteroid dehydrogenase type 1 in murine adipose tissue and 3T3-L1 adipocytes Am J Physiol Endocrinol Metab, April 1, 2007; 292(4): E1213 - E1222. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. B. Persson From clinical insights to new therapies Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2006; 290(1): R124 - R125. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||