AJP - Regu Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 288: R134-R139, 2005. First published September 23, 2004; doi:10.1152/ajpregu.00355.2004
0363-6119/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/1/R134    most recent
00355.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (51)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Taylor, P. D.
Right arrow Articles by Poston, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, P. D.
Right arrow Articles by Poston, L.

CALL FOR PAPERS
Fetal Physiological Programming

Impaired glucose homeostasis and mitochondrial abnormalities in offspring of rats fed a fat-rich diet in pregnancy

Paul D. Taylor,1 Josie McConnell,2 Imran Y. Khan,1 Kathleen Holemans,3 Kevin M. Lawrence,4 Henry Asare-Anane,1 Shanta J. Persaud,1 Peter M. Jones,1 Linda Petrie,2 Mark A. Hanson,5 and Lucilla Poston1

1Division of Reproductive Health, Endocrinology and Development, King's College London, London and 2Rowett Research Institute, Bucksburn, Aberdeen, United Kingdom; 3Obstetrics and Gynecology, Katholieke Universiteit Leuven, Louvain, Belgium; and 4Institute of Child Health, University College London, London and 5Centre for the Developmental Origins of Health and Disease, Princess Anne Hospital, Southampton, United Kingdom

Submitted 1 June 2004 ; accepted in final form 9 September 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We previously reported that prenatal and suckling exposure to a maternal diet rich in animal fat leads to cardiovascular dysfunction in young adult rat offspring with subsequent development of dyslipidemia and hyperglycemia. We have further investigated glucose homeostasis in adult female offspring by euglycemic-hyperinsulinemic clamp and by dynamic assessment of glucose-stimulated insulin secretion in isolated, perifused pancreatic islet cells. Additionally, given the link between reduced mitochondrial DNA (mtDNA) content and the development of type 2 diabetes mellitus, we have measured mtDNA in organs from young adult animals. Sprague-Dawley rats were fed a diet rich in animal fat or normal chow throughout pregnancy and weaning. Infusion of insulin (5 mU·kg–1·min–1) resulted in a higher steady-state plasma insulin concentration in 1-year-old offspring of fat-fed dams (OHF, n = 4) vs. offspring of control dams (OC, n = 4, P < 0.01). Glucose-stimulated insulin secretion in isolated islets from 9-mo-old OHF was significantly reduced compared with OC (n = 4, P < 0.05). Transmission electron micrography showed altered insulin secretory granule morphology in OHF pancreatic {beta}-cells. Kidney mtDNA was reduced in 3-mo-old OHF [16S-to-18S gene ratio: OC (n = 10) 1.05 ± 0.19 vs. OHF (n = 10) 0.66 ± 0.06, P < 0.05]. At 6 mo, gene chip microarray of OHF aorta showed reduced expression of the mitochondrial genome. Prenatal and suckling exposure to a diet rich in animal fat leads to whole body insulin resistance and pancreatic {beta}-cell dysfunction in adulthood, which is preceded by reduced tissue mtDNA content and altered mitochondrial gene expression.

dietary fats; insulin; islet cells; metabolic syndrome


METABOLIC SYNDROME HAS REACHED epidemic proportions among Western populations, with an associated increase in childhood type 2 diabetes (2, 4). Whereas the typical Western diet rich in saturated fat is a known risk factor for metabolic syndrome and cardiovascular disease in adults, converging lines of evidence now suggest that a fat-rich diet during pregnancy may induce features of the metabolic syndrome in the adult offspring independently of adult environmental factors (13, 24, 29). Most recently we described a rat model of developmental programming in which increased maternal dietary intake of animal fat in pregnancy and suckling induces cardiovascular and metabolic abnormalities in adult offspring with shared characteristics of metabolic syndrome in humans, including hypertension, dyslipidemia, and hyperglycemia (21, 22, 34).

In the present study we have attempted to further characterize the abnormalities of glucose homeostasis in adult offspring of dams fed a fat-rich diet (OHF). The two main metabolic predictors of type 2 diabetes mellitus in humans are insulin resistance and impaired insulin secretory capacity. We have assessed whole body insulin resistance in vivo and isolated pancreatic islet cell structure and function. Given the proposed involvement of mitochondrial abnormalities in the development of atherosclerosis and type 2 diabetes (3, 28, 33), we have examined aspects of mitochondrial integrity.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animal husbandry and experimental diets. Animal procedures complied with United Kingdom Home Office regulations. Female Sprague-Dawley rats (n = 20, 120 days old) were fed, for 10 days before mating and throughout pregnancy and lactation, either a standard rat chow [RM3 5% fat (wt/wt)] or a diet rich in animal fat [RM3 supplemented 20% (wt/wt) with lard; Special Diet Services, Witham, Essex, UK; Ref. 22].

Birth weights and litter size were similar in control and OHF. All offspring were weaned onto the standard chow (RM3, postpartum day 21), received food and water ad libitum, and were maintained in a 12:12-h light-dark cycle (21°C). One female per litter was studied in each protocol (n = number of litters).

Whole body insulin sensitivity. Insulin sensitivity was assessed in OHF and control offspring (OC) by euglycemic-hyperinsulinemic clamp (n = 4) and was performed in anesthetized animals at 1 year of age, as described previously (15). Porcine monocomponent insulin (5 mU·kg–1·min–1; Novo Industri, Bagsvaerd, Denmark) was infused in the saphenous vein at a constant rate (20 µl/min). A variable glucose infusion was administered through the same vein 1 min after the insulin infusion started. Blood glucose was measured every 5 min (2300 STAT glucose analyzer; YSI, Yellow Springs, OH), and the glucose infusion rate was adjusted to maintain euglycemia. Steady state was attained after ~30 min and was maintained for an additional 30 min. Three 200-µl blood samples were collected at 5- to 10-min intervals for triplicate determination of steady-state blood glucose and insulin concentration by radioimmunoassay (RIA) (Boehringer Mannheim). Insulin sensitivity index (ISI) was calculated according to Damas et al. (7) [ISI = steady-state glucose infusion rate (mg·kg–1·min–1)/steady-state plasma insulin (µU/ml) x 100].

Pancreatic islet cell structure and function. Islets were isolated from 9-mo-old OHF and OC (n = 4) by collagenase digestion of the pancreas and separated under a light microscope with a fine drawn pipette as previously described (17). Isolated islets were placed in a perifusion chamber at 37°C and perifused with 2–20 mM glucose solutions as described elsewhere (31). Fractions were collected every 2 min, and dynamic insulin secretion was determined by RIA (18). Total islet insulin content in isolated islets was also measured by RIA. Electron micrographs of glutaraldehyde-fixed, osmium-stained pancreata were prepared for assessment of islet cell ultrastructure with standard electron microscopy techniques. Histology of the exocrine pancreas at the light microscope level was investigated with hematoxylin and eosin staining.

Adiposity. At 6 mo of age OHF and OC (n = 10) were killed by a rising concentration of carbon dioxide and adiposity as assessed by the combined wet weight of intra-abdominal fat pads (retroperitoneal and perinephric) and gonadal fat lobes expressed as a percentage of body weight.

Leptin assay. Fasting plasma samples from OHF and age-matched OC (n = 10) were obtained by cardiac puncture after animals were killed by a rising concentration of carbon dioxide (6–12 mo). Plasma leptin was evaluated with a rat leptin enzyme Immunometric assay kit [Assay Designs, Ann Arbor, MI; sensitivity 41.48 pg/ml, intra-assay coefficient of variation (CV) 5.6%, interassay CV 11.2%].

Measurement of mitochondrial DNA copy number. OHF and OC were killed by cervical dislocation at 3 mo (n = 10). Kidney and liver were dissected, snap frozen in liquid nitrogen, and stored at –80°C. Approximately 0.2–0.5 g of tissue was ground in a freezer mill, and total DNA was prepared with the Promega Wizard genomic DNA purification kit (catalog no. A1120; Southampton, UK) and diluted to ~1 mg/ml. Samples were microarrayed from a 96-well plate onto nylon filters with a BioRobotics MicroGrid II TAS microarrayer and then hybridized with radiolabeled probes corresponding to mitochondrial encoded ribosomal 16S gene or nuclear encoded ribosomal 18S gene. After washing to remove nonhybridized probe, the ratio of 16S to 18S was calculated for each sample, to give an estimate of the relative amount of mitochondrial DNA (mtDNA), i.e., the mitochondrial copy number.

Gene chip microarray and RT-PCR. Total RNA was isolated from aorta of OHF and OC at 6 and 12 mo with an RNA isolator TRIzol solution per the manufacturer's protocol (Invitrogen, Paisley, UK). After processing, RNA pellets were resuspended in diethyl pyrocarbonate-treated water at a concentration of 1 µg/µl.

Double-stranded DNA was in vitro transcribed with T7 RNA polymerase in the presence of biotinylated nucleotides (5 h, 37°C). Biotinylated cRNA was fragmented into small (100 base) targets. cRNAs were hybridized to rat genome U34A chips (Affymetrix; 45°C).

Rat gene chips were washed according to the Affymetrix fluidics station protocol. Phycoerythrin linked to streptavidin was used to label the hybridized target. Affymetrix software was used to generate a comparison of the chips.

RT-PCR. Microarray indicated increased expression of aorta mRNA for the mitochondrial voltage-dependent anion channel (VDAC)1, intimately involved in apoptosis, which in vascular endothelial cells has been implicated in atherogenesis (5). RT-PCR for this gene was therefore undertaken with GAPDH as the housekeeping gene. Total RNA from OHF and OC aorta (6 and 12 mo) was treated with RQ1 RNAse-free DNAse (Promega). Extracted RNA was combined with an oligo(dT) (18) primer and added to a first-strand cDNA synthesis reaction containing avian myeloblastosis virus reverse transcriptase (Promega) and incubated (45 min, 42°C). The reaction was terminated by incubation at 94°C (3 min). Primers were used to semiquantitate transcript levels of VDAC1 (forward primer 5' CATATCAACCTGGGCTGTG 3', reverse primer 5' TTGGCTGCTA-TTCCAAAGC 3'; GAPDH forward primer 5' GCATTGCTCTCAATGACAA 3', reverse primer 5' TGTGAGGGAGATGCTCAGTG 3').

Plasma analyses. Plasma glucose was measured by a routine laboratory enzymatic UV test (HK/G6P-DH method; Cobas Fara centrifugal analyzer) and insulin by ELISA (DRG Instruments). Plasma triglyceride and total cholesterol concentrations were measured by enzymatic colorimetric assays (UNIMATE 5 TRIG and UNIMATE 5 CHOL; Roche/BCl, Lewes, Sussex, UK).

Statistical analysis. All statistical comparisons were made by Student's t-test. Glucose-stimulated insulin secretion in OHF and OC was compared by area under the curve. All values are given as means ± SE. Statistical significance was assumed at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Whole body insulin sensitivity. Insulin resistance was markedly increased in OHF compared with OC, as demonstrated by reduced glucose infusion rate and raised plasma steady-state insulin concentrations during the euglycemic clamp, resulting in a lower ISI (Fig. 1, A–C).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1. Whole body insulin sensitivity was assessed by euglycemic-hyperinsulinemic clamp in offspring of fat-fed dams (OHF, n = 4) compared with control offspring [OC (Con), n = 4] at 1 yr. A: steady-state plasma insulin levels after infusion of insulin (5 mU·kg–1·min–1). B: variable glucose infusion rate (GIR) to maintain euglycemia. Solid circles, OC; gray circles, OHF. C: insulin sensitivity index. D: plasma leptin concentration in female OHF (n = 10, 6–12 mo) compared with age-matched OC (n = 10). *P < 0.05, **P < 0.01.

 
Plasma leptin concentration. OHF demonstrated an increase in plasma leptin concentration compared with OC (Fig. 1D).

Plasma glucose, insulin, and lipid profiles. At 6 mo of age, as reported elsewhere (Ref. 20, this issue), OHF demonstrated an increase in both fasting plasma glucose and insulin, although only the hyperinsulinemia reached significance [glucose (mmol/l): OC 12.4 ± 2.4 (n = 7) vs. OHF 18.1 ± 3.6 (n = 6), P = not significant (NS); insulin (ng/ml): OC 0.80 ± 0.12 (n = 7) vs. OHF 1.99 ± 0.55 (n = 6), P < 0.05]. At 12 mo of age, OHF also demonstrated significant hyperglycemia relative to controls [glucose (mmol/l): OC 12.7 ± 2.2 (n = 6) vs. OHF 22.5 ± 1.4 (n = 6), P < 0.01] (22).

Total cholesterol, HDL cholesterol, and triglycerides were not different between groups at 6 mo of age. At 12 mo of age, however, OHF demonstrated significantly raised triglycerides and significantly reduced HDL as previously reported in this cohort [triglycerides (mmol/l): OC 1.65 ± 0.15 (n = 6) vs. OHF 2.51 ± 0.27 (n = 6), P < 0.05; HDL (mmol/l): OC 2.20 ± 0.13 (n = 6) vs. OHF 1.6 ± 0.11 (n = 6), P < 0.01] (22).

Pancreatic islet cell structure and function. Dynamic assessment of islet insulin secretory function in vitro (Fig. 2A) showed no difference in basal insulin release but a significant reduction in 20 mM glucose-stimulated insulin secretion in OHF, in both the first and second phases of insulin release (area under the curve, P < 0.05). Measurement of isolated islet total insulin content showed values to be significantly lower in OHF than in OC (Fig. 2B).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. A: glucose-stimulated insulin secretion in perifused isolated islets from 9-mo-old rats. Open circles, OC (n = 4); solid circles, OHF (n = 4). B: total insulin content in isolated islets from OC and OHF (n = 4). *P < 0.05.

 
Electron micrographs (Fig. 3) showed that pancreatic {beta}-cells in OHF islets had enlarged insulin secretory granules [diameter (nm), mean ± SE: OC 365 ± 9 vs. OHF 463 ± 16, P < 0.0001], more prominent electron-translucent halos, and a greater number of light core secretory granules than mature dense core secretory granules per {beta}-cell compared with OC islets [pale granules (%): OHF 40 vs. OC 14]. Despite the increase in the overall size of the {beta}-cell secretory granule, the core size was unaffected [diameter (nm): OC 140 ± 5 vs. OHF 144 ± 6, n = 50 granules, P = NS]. Granules of {alpha}-cells, which produce glucagon, did not differ between the two populations [diameter (nm): OHF 228 ± 5 vs. OC 230 ± 6, n = 50 granules, P = NS].



View larger version (92K):
[in this window]
[in a new window]
 
Fig. 3. Transmission electron micrographs of glutaraldehyde-fixed, osmium-stained pancreata of rat OC (A) and OHF (B). {alpha}, {alpha}-cell; {beta}, {beta}-cell.

 
Morphology of the exocrine pancreas at the light microscope level with hematoxylin and eosin staining showed no obvious differences in the structure of the islet cells between the adult offspring of dams fed a "high-fat" diet in pregnancy and control offspring (Fig. 4).



View larger version (86K):
[in this window]
[in a new window]
 
Fig. 4. Histology of the exocrine pancreas showing hematoxylin and eosin staining in OC (A) and OHF (B). Hematoxylin stains nuclei and eosin stains cytoplasm and tissue fibers. I, islet cell.

 
Adiposity. We have reported (Ref. 20, this issue) increased fat deposition in these animals. OHF demonstrated a significant increase in abdominal fat deposition as a percentage of body weight at 6 mo compared with controls (OHF 4.44 ± 0.51% vs. OC 2.16 ± 0.50%, n = 10, P < 0.05).

Mitochondrial copy number. Mitochondrial copy number tended to be lower in OHF liver compared with OC liver and was significantly reduced in OHF kidney [OC (n = 10) 1.05 ± 0.19 vs. OHF (n = 10) 0.66 ± 0.06, P < 0.05; Fig. 5, A and B].



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. Mitochondrial copy number in the kidney (A) and liver (B) of 3-mo-old OHF and OC (n = 10) * P < 0.05. C: mitochondrial gene expression by gene chip microarray in aorta from 6-mo-old OC and OHF. Data are expressed as fold change in expression relative to OC. Solid bars, mitochondrial encoded mRNA; open bars, nuclear encoded mRNA. A, X14848cds#12 mitochondrial genome; B, AJ223355 [GenBank] mitochondrial dicarboxylate carrier; C, S79304 [GenBank] cytochrome oxidase subunit I; D, J01435 [GenBank] mitochondrial cytochrome oxidase subunits I, II, and III, ATPase subunit 6; E, U36771 [GenBank] glycerol 3-phosphate acyltransferase; F, Y00497 [GenBank] superoxide dismutase 2, mitochondrial; G, X03894 [GenBank] mitochondrial uncoupling protein of brown adipose tissue; H, U68544 [GenBank] cyclophilin D; I, M35826 [GenBank] mitochondrial NADH-dehydrogenase; J, X15030 [GenBank] CoxVa mitochondrial cytochrome-c oxidase subunit; K, M57728 [GenBank] general mitochondrial matrix-processing protease; L, X54510 [GenBank] coupling factor 6 of mitochondrial ATP synthase complex; M, D12770 [GenBank] mitochondrial adenine nucleotide translocator; N, AF048828 [GenBank] voltage-dependent anion channel (VDAC)1. D: RT-PCR for VDAC1 in aortic tissue taken from 6- and 12-mo-old OHF and OC.

 
Mitochondrial gene expression. Gene chip analysis indicated a greater than fivefold decrease in mRNA expression of the mitochondrial genome. In addition, there was also an increase in mRNA expression of several nuclear encoded genes, including the apoptotic voltage-dependent ion channel VDAC1 (Fig. 5C).

RT-PCR. RT-PCR for VDAC1 in aortic tissue taken from 6- and 12-mo-old OHF and OC showed that VDAC expression was markedly enhanced in OHF at 6 mo and further increased at 12 mo (Fig. 5D).


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We reported previously (21, 22) that in utero and early postnatal exposure to a maternal diet rich in animal fat leads to the development of certain shared characteristics of the human metabolic syndrome in adult rats reared on a balanced diet. The demonstration in female adult offspring of raised plasma concentrations of fasting glucose and triglycerides together with an increase in body weight and fat depot weights was indicative, but not conclusive, of insulin resistance. This study has shown unambiguously that female offspring of dams fed a fat-rich diet demonstrate insulin resistance at 1 yr of age. In addition, isolated pancreatic {beta}-cells from 9-mo-old offspring of dams fed a high-fat diet showed impaired glucose-stimulated insulin release. Thus hyperglycemia, insulin resistance, and insulin secretory deficiency, the principal metabolic predictors of type 2 diabetes mellitus in humans (36), are all present in this model.

This is the first study to demonstrate whole body insulin resistance with a euglycemic clamp technique in a dietary model of fetal programming. A similar study by Park et al. (30) in offspring of protein-restricted dams at 6 mo of age showed no difference in whole body insulin sensitivity index despite impaired {beta}-cell insulin secretion.

Insulin may either directly, or indirectly via its lipogenic action, stimulate adipocyte leptin secretion via a dual hormonal feedback loop between adipose tissue and the endocrine pancreas, the proposed adipoinsular axis (23). Hence, the increased adiposity and hyperinsulinemia are likely contributors to the rise in plasma leptin concentration and suggest the development of leptin resistance at the level of the {beta}-cells. Because leptin also modulates cardiovascular homeostasis via sympathetic activation of the arterial baroreflex (10), the increased concentrations may also contribute to hypertension in this model (22).

Tissue insulin resistance is central to the metabolic syndrome and the development of type 2 diabetes and is manifest by impaired glucose uptake into skeletal muscle and failure to suppress hepatic glucose output. However, ultimately it is the failure of the pancreatic {beta}-cells to maintain glucose homeostasis that leads to hyperglycemia and the development of overt type 2 diabetes mellitus (36). This can be explained in terms of insulin secretory defects and a selective loss of sensitivity to glucose (25). Dynamic assessment of islet insulin secretory function in vitro showed no difference in basal insulin release but a significant reduction in glucose-stimulated (20 mM) insulin secretion in the offspring of dams fed a fat-rich diet, both in the initial and sustained phase of insulin release, indicative of a reduced insulin secretory capacity. The delay in onset of the first phase of glucose-stimulated insulin secretion suggests a reduced sensitivity to glucose.

Altered islet cell structure frequently accompanies altered function, and electron micrographs showed pancreatic {beta}-cells from OHF had enlarged insulin secretory granules, more prominent electron-translucent halos, and a greater number of immature light core secretory granules than mature dense core secretory granules per {beta}-cell compared with OC {beta}-cells. Proinsulin in the pale immature granules is slowly cleaved to insulin, which becomes associated with zinc as the granule matures to form a dense central core of zinc insulin crystal. An increase in the ratio of light to dark granules in {beta}-cells occurs in conditions of increased insulin secretion such as pregnancy (1) or chronic hyperglycemia (8) and is therefore consistent with the chronic stimulatory environment of raised fasting plasma glucose we have reported in 6- and 12-mo-old female offspring (9, 22). Moreover, total insulin content of isolated islets was significantly lower than controls in 9-mo-old OHF, which may suggest declining {beta}-cell mass and/or {beta}-cell exhaustion similar to that of type 2 diabetes in humans.

Both glucotoxicity (12) and lipotoxicity (35) have been implicated in the chronic deterioration of insulin secretion in type 2 diabetes mellitus, and both may contribute to impaired {beta}-cell function in the present study. Conversely, defective adulthood {beta}-cell function or reduced {beta}-cell mass has also been proposed to arise from an acute early programming stimulus in neonatal rats subjected to in utero protein restriction (16).

In a another rat model, in which rat dams were fed a saturated fat-rich diet (18% coconut oil) during pregnancy and weaning, 12-wk-old adult offspring showed a reduction in the population of large pancreatic islet cells, although the functional significance of this observation was not clear (32). In response to a glucose load, the offspring showed an increased insulin response compared with controls, indicative of insulin resistance, although plasma glucose concentrations were actually lower after 30 min.

The chronology of metabolic disturbances in this model may give insight into the etiology of the "metabolic syndrome" phenotype. In female offspring, we have previously shown endothelial dysfunction at 80 days of age (22), and we now report reduced mitochondrial copy number at a similar age; both antedate dyslipidemia, hyperglycemia, hypertension, and obesity, and a fundamental mechanistic role for each may be indicated (21, 22). The onset of overt hyperglycemia at 12 mo but not at 3 mo suggests late pancreatic {beta}-cell failure in the maintenance of glucose homeostasis. Further investigation of the chronology of metabolic disturbances will provide insight into the etiology of metabolic syndrome in this model, but endothelial dysfunction emerges as a fundamental defect. Indeed, peripheral insulin resistance has been proposed to result from endothelial dysfunction in capillaries and arterioles, leading to poor perfusion and reduced glucose uptake in metabolically active insulin-sensitive tissues (6).

The molecular mechanisms underpinning long-term programming of adult disease are likely to be complex and multifactorial. Mitochondria are exquisitely sensitive to environmental changes, and the efficiency and accuracy of mitochondrial replication can be affected by environmental factors (11). Reduction in the level of mitochondrion-specific DNA {gamma}-polymerase has been investigated in clinical and experimental models and has been found to be a predictor of type 2 diabetes (26) and to be altered in the tissues of animals fed a low-protein diet (30).

The early reduction in mtDNA copy number observed in the kidney, if indicative of a global reduction in mtDNA content, would concur with the suggestion that mitochondria play a role in developmental programming. The altered mitochondrial genomic expression in the aorta by microarray is also supportive of this hypothesis. The mitochondrion is intimately involved in glucose sensing by pancreatic {beta}-cells, and defects in this organelle, including reduced mtDNA (19), are associated with impaired glucose-stimulated insulin release (27). Of particular relevance to the current study, Higa and colleagues (14) reported altered mitochondrial morphology in isolated islets from Zucker diabetic fatty (ZDF) rats, associated with lipotoxicity and lipoapoptosis of {beta}-cells. However, in the present study, histology of the islet cells was not different in offspring of high-fat-fed animals, and in contrast to the mitochondrial swelling and cristae disruption reported by Higa and colleagues in untreated obese ZDF rats, no distinct morphological changes were visible in the mitochondria at the ultrastructural level. This suggests that the programmed {beta}-cell changes observed in our studies were not as profound as those seen in overtly diabetic animals where the {beta}-cell mass had decreased markedly. Future studies are planned to specifically address mitochondrial integrity in pancreatic islet {beta}-cells.

This disruption of mitochondrial gene activity in the aorta could compromise mitochondrial function, eventually leading to tissue damage within the vascular wall. Of particular interest was the upregulation of the apoptotic pore gene VDAC1. Chronic inflammation as a consequence of subclinical tissue damage due to aberrant mitochondrial activity may initiate endothelial dysfunction early in the phenotypic development of this model (3).

In conclusion, this animal model of developmental programming produces a female offspring phenotype typical of the metabolic syndrome. In addition to the hypertension, vascular endothelial dysfunction, dyslipidemia, and increased adiposity previously reported (9, 21, 22), we now demonstrate marked changes in insulin resistance and insulin secretory capacity. Pancreatic {beta}-cells from female offspring of dams fed a fat-rich diet in pregnancy demonstrate altered granule morphology and glucose-stimulated insulin secretory deficiency. We hypothesize a global reduction in mitochondrial DNA copy number in early development, eventually leading to mitochondrial dysfunction, tissue damage, and disease.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We gratefully acknowledge the British Heart Foundation (RG 99011), Guys and St. Thomas' Charitable Foundation (R020714), Tommy's, the baby charity, and Scottish Executive Environmental Rural Affairs Department for funding this work. L. Poston is supported by Tommy's, the baby charity.


    ACKNOWLEDGMENTS
 
Present address of J. McConnell: Div. of Reproductive Health, Endocrinology and Development, Kings College London, London SE1 7EH, UK.


    FOOTNOTES
 

Address for reprint requests and other correspondence: P. D. Taylor, Maternal & Fetal Research Unit, GKT Dept. of Women's Health, 10th Floor North Wing, St. Thomas' Hospital, London SE1 7EH, UK (E-mail: paul.taylor{at}kcl.ac.uk)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Aerts L and Assche FA. Ultrastructural changes of the endocrine pancreas in pregnant rats. Diabetologia 11: 285–289, 1975.[CrossRef][Web of Science][Medline]
  2. Alexander CM, Landsman PB, Teutsch SM, and Haffner SM. NCEP-defined metabolic syndrome, diabetes, and prevalence of coronary heart disease among NHANES III participants age 50 years and older. Diabetes 52: 1210–1214, 2003.[Abstract/Free Full Text]
  3. Ballinger SW, Patterson C, Knight-Lozano CA, Burow DL, Conklin CA, Hu Z, Reuf J, Horaist C, Lebovitz R, Hunter GC, McIntyre K, and Runge MS. Mitochondrial integrity and function in atherogenesis. Circulation 106: 544–549, 2002.[Abstract/Free Full Text]
  4. Bonora E, Kiechl S, Willeit J, Oberhollenzer F, Egger G, Bonadonna RC, and Muggeo M. Metabolic syndrome: epidemiology and more extensive phenotypic description. Cross-sectional data from the Bruneck Study. Int J Obes Relat Metab Disord 27: 1283–1289, 2003.[CrossRef][Web of Science][Medline]
  5. Choy JC, Granville DJ, Hunt DW, and McManus BM. Endothelial cell apoptosis: biochemical characteristics and potential implications for atherosclerosis. J Mol Cell Cardiol 33: 1673–1690, 2001.[CrossRef][Web of Science][Medline]
  6. Clark MG, Wallis MG, Barrett EJ, Vincent MA, Richards SM, Clerk LH, and Rattigan S. Blood flow and muscle metabolism: a focus on insulin action. Am J Physiol Endocrinol Metab 284: E241–E258, 2003.[Abstract/Free Full Text]
  7. Damas J, Bourdon V, and Lefebvre PJ. Insulin sensitivity, clearance and release in kininogen-deficient rats. Exp Physiol 84: 549–557, 1999.[Abstract]
  8. Findlay JA, Rookledge KA, Beloff-Chain A, and Lever JD. A combined biochemical and histological study on the islets of Langerhans in the genetically obese hyperglycaemic mouse and the lean mouse, including observations on the effects of streptozotocin treatment. J Endocrinol 56: 571–583, 1973.[Abstract/Free Full Text]
  9. Ghosh P, Bitsanis D, Ghebremeskel K, Crawford MA, and Poston L. Abnormal aortic fatty acid composition and small artery function in offspring of rats fed a high fat diet in pregnancy. J Physiol 533: 815–822, 2001.[Abstract/Free Full Text]
  10. Grassi G. Leptin, sympathetic nervous system, and baroreflex function. Curr Hypertens Rep 6: 236–240, 2004.[Web of Science][Medline]
  11. Graziewicz MA, Day BJ, and Copeland WC. The mitochondrial DNA polymerase as a target of oxidative damage. Nucleic Acids Res 30: 2817–2824, 2002.[Abstract/Free Full Text]
  12. Grill V and Bjorklund A. Dysfunctional insulin secretion in type 2 diabetes: role of metabolic abnormalities. Cell Mol Life Sci 57: 429–440, 2000.[CrossRef][Web of Science][Medline]
  13. Guo F and Jen KL. High-fat feeding during pregnancy and lactation affects offspring metabolism in rats. Physiol Behav 57: 681–686, 1995.[CrossRef][Medline]
  14. Higa M, Zhou YT, Ravazzola M, Baetens D, Orci L, and Unger RH. Troglitazone prevents mitochondrial alterations, beta cell destruction, and diabetes in obese prediabetic rats. Proc Natl Acad Sci USA 96: 11513–11518, 1999.[Abstract/Free Full Text]
  15. Holemans K, Aerts L, and Van Assche FA. Evidence for an insulin resistance in the adult offspring of pregnant streptozotocin-diabetic rats. Diabetologia 34: 81–85, 1991.[CrossRef][Web of Science][Medline]
  16. Holness MJ, Langdown ML, and Sugden MC. Early-life programming of susceptibility to dysregulation of glucose metabolism and the development of Type 2 diabetes mellitus. Biochem J 349: 657–665, 2000.
  17. Jones PM, Mann FM, Persaud SJ, and Wheeler-Jones CP. Mastoparan stimulates insulin secretion from pancreatic beta-cells by effects at a late stage in the secretory pathway. Mol Cell Endocrinol 94: 97–103, 1993.[CrossRef][Web of Science][Medline]
  18. Jones PM, Salmon DM, and Howell SL. Protein phosphorylation in electrically permeabilized islets of Langerhans. Effects of Ca2+, cyclic AMP, a phorbol ester and noradrenaline. Biochem J 254: 397–403, 1988.[Web of Science][Medline]
  19. Kennedy ED, Maechler P, and Wollheim CB. Effects of depletion of mitochondrial DNA in metabolism secretion coupling in INS-1 cells. Diabetes 47: 374–380, 1998.[Abstract]
  20. Khan IY, Dekou V, Douglas G, Jensen R, Hanson M, Poston L, and Taylor PD. A high fat diet during pregnancy or suckling induces cardiovascular dysfunction in adult offspring. Am J Physiol Regul Integr Comp Physiol 288: R127–R133, 2005.[Abstract/Free Full Text]
  21. Khan IY, Dekou V, Hanson M, Poston L, and Taylor PD. Predictive adaptive responses to maternal high fat diet prevent endothelial dysfunction but not hypertension in adult rat offspring. Circulation 110: 1097–1102, 2004.[Abstract/Free Full Text]
  22. Khan IY, Taylor PD, Dekou V, Seed PT, Lakasing L, Graham D, Dominiczak AF, Hanson MA, and Poston L. Gender-linked hypertension in offspring of lard-fed pregnant rats. Hypertension 41: 168–175, 2003.[Abstract/Free Full Text]
  23. Kieffer TJ and Habener JF. The adipoinsular axis: effects of leptin on pancreatic {beta}-cells. Am J Physiol Endocrinol Metab 278: E1–E14, 2000.[Abstract/Free Full Text]
  24. Langley-Evans SC, Clamp AG, Grimble RF, and Jackson AA. Influence of dietary fats upon systolic blood pressure in the rat. Int J Food Sci Nutr 47: 417–425, 1996.[Web of Science][Medline]
  25. Leahy JL, Bonner-Weir S, and Weir GC. Beta-cell dysfunction induced by chronic hyperglycemia. Current ideas on mechanism of impaired glucose-induced insulin secretion. Diabetes Care 15: 442–455, 1992.[Abstract]
  26. Lee HK, Song JH, Shin CS, Park DJ, Park KS, Lee KU, and Koh CS. Decreased mitochondrial DNA content in peripheral blood precedes the development of non-insulin-dependent diabetes mellitus. Diabetes Res Clin Pract 42: 161–167, 1998.[CrossRef][Web of Science][Medline]
  27. Maechler P. Novel regulation of insulin secretion: the role of mitochondria. Curr Opin Investig Drugs 4: 1166–1172, 2003.[Medline]
  28. Maechler P and Wollheim CB. Mitochondrial function in normal and diabetic beta-cells. Nature 414: 807–812, 2001.[CrossRef][Medline]
  29. Napoli C and Palinski W. Maternal hypercholesterolemia during pregnancy influences the later development of atherosclerosis: clinical and pathogenic implications. Eur Heart J 22: 4–9, 2001.[Free Full Text]
  30. Park HK, Jin CJ, Cho YM, Park do J, Shin CS, Park KS, Kim SY, Cho BY, and Lee HK. Changes of mitochondrial DNA content in the male offspring of protein-malnourished rats. Ann NY Acad Sci 1011: 205–216, 2004.[CrossRef][Web of Science][Medline]
  31. Persaud SJ, Jones PM, Sugden D, and Howell SL. The role of protein kinase C in cholinergic stimulation of insulin secretion from rat islets of Langerhans. Biochem J 264: 753–758, 1989.[Web of Science][Medline]
  32. Siemelink M, Verhoef A, Dormans JA, Span PN, and Piersma AH. Dietary fatty acid composition during pregnancy and lactation in the rat programs growth and glucose metabolism in the offspring. Diabetologia 45: 1397–1403, 2002.[CrossRef][Web of Science][Medline]
  33. Song J, Oh JY, Sung YA, Pak YK, Park KS, and Lee HK. Peripheral blood mitochondrial DNA content is related to insulin sensitivity in offspring of type 2 diabetic patients. Diabetes Care 24: 865–869, 2001.[Abstract/Free Full Text]
  34. Taylor PD, Khan IY, Lakasing L, Dekou V, O'Brien-Coker I, Mallet AI, Hanson MA, and Poston L. Uterine artery function in pregnant rats fed a diet supplemented with animal lard. Exp Physiol 88: 389–398, 2003.[Abstract]
  35. Unger RH. Lipid overload and overflow: metabolic trauma and the metabolic syndrome. Trends Endocrinol Metab 14: 398–403, 2003.[CrossRef][Web of Science][Medline]
  36. Weyer C, Bogardus C, Mott DM, and Pratley RE. The natural history of insulin secretory dysfunction and insulin resistance in the pathogenesis of type 2 diabetes mellitus. J Clin Invest 104: 787–794, 1999.[Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
N. Theys, T. Bouckenooghe, M.-T. Ahn, C. Remacle, and B. Reusens
Maternal low-protein diet alters pancreatic islet mitochondrial function in a sex-specific manner in the adult rat
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2009; 297(5): R1516 - R1525.
[Abstract] [Full Text] [PDF]


Home page
Postgrad. Med. J.Home page
K D Bruce and C D Byrne
The metabolic syndrome: common origins of a multifactorial disorder
Postgrad. Med. J., November 1, 2009; 85(1009): 614 - 621.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. C. Page, R. E. Malik, J. A. Ripple, and E. K. Anday
Maternal and postweaning diet interaction alters hypothalamic gene expression and modulates response to a high-fat diet in male offspring
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2009; 297(4): R1049 - R1057.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
P. Shelley, M. S. Martin-Gronert, A. Rowlerson, L. Poston, S. J. R. Heales, I. P. Hargreaves, J. M. McConnell, S. E. Ozanne, and D. S. Fernandez-Twinn
Altered skeletal muscle insulin signaling and mitochondrial complex II-III linked activity in adult offspring of obese mice
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2009; 297(3): R675 - R681.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. Sharkey, H. P. Fainberg, V. Wilson, E. Harvey, D. S. Gardner, M. E. Symonds, and H. Budge
Impact of Early Onset Obesity and Hypertension on the Unfolded Protein Response in Renal Tissues of Juvenile Sheep
Hypertension, June 1, 2009; 53(6): 925 - 931.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. Chechi, J. J. McGuire, and S. K. Cheema
Developmental programming of lipid metabolism and aortic vascular function in C57BL/6 mice: a novel study suggesting an involvement of LDL-receptor
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2009; 296(4): R1029 - R1040.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
L. Gao and G. E. Mann
Vascular NAD(P)H oxidase activation in diabetes: a double-edged sword in redox signalling
Cardiovasc Res, April 1, 2009; 82(1): 9 - 20.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
G. J. Howie, D. M. Sloboda, T. Kamal, and M. H. Vickers
Maternal nutritional history predicts obesity in adult offspring independent of postnatal diet
J. Physiol., February 15, 2009; 587(4): 905 - 915.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
G.-Q. Chang, V. Gaysinskaya, O. Karatayev, and S. F. Leibowitz
Maternal High-Fat Diet and Fetal Programming: Increased Proliferation of Hypothalamic Peptide-Producing Neurons That Increase Risk for Overeating and Obesity
J. Neurosci., November 12, 2008; 28(46): 12107 - 12119.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. A. Armitage, S. Gupta, C. Wood, R. I. Jensen, A.-M. Samuelsson, W. Fuller, M. J. Shattock, L. Poston, and P. D. Taylor
Maternal dietary supplementation with saturated, but not monounsaturated or polyunsaturated fatty acids, leads to tissue-specific inhibition of offspring Na+,K+-ATPase
J. Physiol., October 15, 2008; 586(20): 5013 - 5022.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. Shankar, A. Harrell, X. Liu, J. M. Gilchrist, M. J. J. Ronis, and T. M. Badger
Maternal obesity at conception programs obesity in the offspring
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2008; 294(2): R528 - R538.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A.-M. Samuelsson, P. A. Matthews, M. Argenton, M. R. Christie, J. M. McConnell, E. H.J. M. Jansen, A. H. Piersma, S. E. Ozanne, D. F. Twinn, C. Remacle, et al.
Diet-Induced Obesity in Female Mice Leads to Offspring Hyperphagia, Adiposity, Hypertension, and Insulin Resistance: A Novel Murine Model of Developmental Programming
Hypertension, February 1, 2008; 51(2): 383 - 392.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. Ferezou-Viala, A.-F. Roy, C. Serougne, D. Gripois, M. Parquet, V. Bailleux, A. Gertler, B. Delplanque, J. Djiane, M. Riottot, et al.
Long-term consequences of maternal high-fat feeding on hypothalamic leptin sensitivity and diet-induced obesity in the offspring
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R1056 - R1062.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. Sedova, O. Seda, L. Kazdova, B. Chylikova, P. Hamet, J. Tremblay, V. Kren, and D. Krenova
Sucrose feeding during pregnancy and lactation elicits distinct metabolic response in offspring of an inbred genetic model of metabolic syndrome
Am J Physiol Endocrinol Metab, May 1, 2007; 292(5): E1318 - E1324.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
J. A. Armitage, A. Ishibashi, A. A. Balachandran, R. I. Jensen, L. Poston, and P. D. Taylor
Placental-Perinatal: Programmed aortic dysfunction and reduced Na+,K+-ATPase activity present in first generation offspring of lard-fed rats does not persist to the second generation
Exp Physiol, May 1, 2007; 92(3): 583 - 589.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
P. D. Taylor and L. Poston
Developmental programming of obesity in mammals
Exp Physiol, March 1, 2007; 92(2): 287 - 298.
[Abstract] [Full Text] [PDF]


Home page
LupusHome page
D I. Phillips
External influences on the fetus and their long-term consequences
Lupus, November 1, 2006; 15(11): 794 - 800.
[Abstract] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Srinivasan, S. D. Katewa, A. Palaniyappan, J. D. Pandya, and M. S. Patel
Maternal high-fat diet consumption results in fetal malprogramming predisposing to the onset of metabolic syndrome-like phenotype in adulthood
Am J Physiol Endocrinol Metab, October 1, 2006; 291(4): E792 - E799.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
B. E Levin
Metabolic imprinting: critical impact of the perinatal environment on the regulation of energy homeostasis
Phil Trans R Soc B, July 29, 2006; 361(1471): 1107 - 1121.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
P. B. Persson
From clinical insights to new therapies
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2006; 290(1): R124 - R125.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. Schwartz and J. L. Morrison
Impact and mechanisms of fetal physiological programming
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2005; 288(1): R11 - R15.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
I. Y. Khan, V. Dekou, G. Douglas, R. Jensen, M. A. Hanson, L. Poston, and P. D. Taylor
A high-fat diet during rat pregnancy or suckling induces cardiovascular dysfunction in adult offspring
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2005; 288(1): R127 - R133.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/1/R134    most recent
00355.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (51)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Taylor, P. D.
Right arrow Articles by Poston, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, P. D.
Right arrow Articles by Poston, L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.