|
|
||||||||
WATER AND ELECTROLYTE HOMEOSTASIS
Department of Food Science and Human Nutrition, University of Illinois, Urbana, Illinois
Submitted 18 June 2004 ; accepted in final form 23 August 2004
| ABSTRACT |
|---|
|
|
|---|
50% less BHMT activity in the liver and kidney, and steady-state protein levels decreased
30% in both organs. Pancreatic BHMT activity and protein levels were unaffected by the high salt treatment. The complex mechanisms involved in the downregulation of hepatic and renal BHMT expression in guinea pigs drinking salt water remain to be clarified, but the physiological significance of this downregulation may be to expedite the transport and accumulation of betaine into the kidney medulla under conditions of high extracellular osmolarity. choline; hypernatremia; osmolyte; tonicity
There are two known metabolic roles for Bet: methyl donor and osmoprotectant. As a methyl donor for the BHMT-catalyzed reaction, Bet has a role in sulfur amino acid homeostasis. The methylation of homocysteine is physiologically important because Met is an essential dietary amino acid and is needed for protein synthesis and S-adenosylmethionine biosynthesis. The regeneration of Met from homocysteine (referred to as remethylation) precludes homocysteine from participating in the transsulfuration pathway, essentially sparing Met from catabolism. It is believed that the oxidation of Bet can be quantitatively important in human one-carbon metabolism. Elevating Bet consumption is an effective plasma homocysteine-lowering treatment for homocystinuria (29, 30), and supplementing choline in the diet of humans reduces the de novo synthesis of one-carbon units from other precursors (18, 19), presumably serine and glycine. A physiological role for BHMT as an enzyme that spares Met from catabolism is supported by our research in rats that showed that BHMT gene expression is dramatically upregulated during Met deficiency (20).
Besides being a methyl donor, Bet is also one of the major organic osmolytes that accumulates in a variety of cells under conditions of hypertonicity (13), the most investigated being the kidney medulla. Several mechanisms are available to the medulla to accumulate this compound. It has been shown that the expression of the
-aminobutyrate-Bet transporter of medullary cells dramatically increases under conditions of hyperosmolarity (32). This suggests that the ability of the medulla to oxidize choline to Bet is not sufficient to meet the need for Bet as an osmolyte under these conditions, even if Bet synthesis in liver and/or kidney increases with renal hypertonicity. In fact, a study in which rats were injected with [14C]choline into the renal artery indicated that the majority of Bet accumulated in the medulla is synthesized in the cortex, which is then transported to the medulla by the tubular and/or vascular route (17). This work is supported by the observation that in hypernatraemic rats the activity of renal choline dehydrogenase activity increases, with induction levels observed in the cortical region that are higher than in the inner medulla (12). Rats do not express BHMT in the kidney, and in humans and pigs the expression of BHMT is strictly localized to the proximal tubules (6). These facts eliminate the possibility that Bet catabolism in the medulla is a mechanism to regulate Bet concentrations in this region of the kidney. In addition, Bet has been shown to rapidly efflux out of medullary cells when hyperosmotic conditions are replaced with hypoosmotic conditions (2). In summary, changes in the rate of Bet synthesis, transport, and efflux have all been proposed to have a role in the regulation of Bet concentrations in the medulla, but the extent each factor plays could vary across species and the degree of osmotic pressure in the medulla.
We thought that an elaboration of the regulatory mechanisms to enhance the ability of the renal medulla to accumulate Bet during hyperosmotic conditions might downregulate BHMT activity so as to decrease its use as a methyl donor, thus making it more available for transport. As a first approach to test this hypothesis, we investigated the effect of high salt consumption on BHMT expression. We chose to use the GP as an animal model because, like humans, it expresses BHMT in the kidney, an organ that has a central role in osmotic balance.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Immunohistochemistry. One male GP (chow fed) was euthanized by decapitation, and its liver, small intestine, kidneys, lungs, pancreas, and spleen were excised, fixed in 10% buffered formalin (12 h), and then stored in 70% ethanol until embedded in paraffin, sectioned into 3-mm slices, and mounted onto glass slides. We stained slices for BHMT using the peroxidase avidin-biotin system previously described (6). Diaminobenzidine served as the peroxidase substrate, and all samples were counterstained with hematoxylin.
Animal protocol. Ten male GPs were housed individually in shoebox cages and exposed to standard lighting (12:12-h light-dark) and temperature (23°C) conditions. They had free access to tap water and standard chow during a 5-day acclimation period, after which the animals weighed an average of 401 g and were randomized into two treatment groups (n = 5). The experimental treatments were free access to either tap water (control) or NaCl (500 mM)-containing tap water, similar to hyperosmotic protocols used for rats (1, 22). Water consumption was recorded daily. The chow intake of the control GPs was limited to the average amount consumed by the treatment group. Treatment lasted 72 h, at which time the animals were euthanized by decapitation and their livers, kidneys, and pancreas were excised, flash-frozen in liquid nitrogen, and stored at 80°C until analyzed. The animal procedures used in this study were approved by the Institutional Animal Care and Use Committee of the University of Illinois (Urbana-Champaign, IL).
cDNA cloning of GP BHMT. We isolated total liver RNA using the TRIzol reagent per the manufacturer's instructions and stored it in Formazol at 80°C. First-strand cDNA synthesis was performed by using total RNA, oligo(dT) primer, and Superscript II RNase H-reverse transcriptase according to the manufacturer's instructions. The liver cDNA library was then stored at 20°C.
The following oligonucleotide primers were designed from the cDNA sequence of human liver BHMT: 5'-TTTGTCTTTGCACTGGAGAAG-3' (sense) and 5'-CAAAGAGCTCTTTCAGCTGCTGC-3' (antisense). These primers were used to amplify a major portion of the open reading frame of GP BHMT by PCR, using the liver cDNA, prepared as described above, as template. A single PCR product of 1.1 kb was observed on an agarose gel and ligated into pCR-XL-TOPO and transformed into One Shot Top10 competent cells. Both strands of the resulting plasmid insert of pCR-XL-gpBHMT were sequenced.
Relative quantification of GP BHMT and actin mRNA by TaqMan real-time PCR.
We performed isolation of total GP liver and kidney cortex RNA using the Perfect RNA eukaryotic kit per the manufacturer's instructions. Synthesis of cDNA was performed as described above. Primers and dual-labeled probe combinations were designed using PrimerExpress software (version 2.0, ABI). The following oligonucleotide primers for PCR amplification of BHMT were synthesized: 5'-GGCAACTACGTGGCAGAGAAG-3' (sense) and 5'-CCTGCCGGGCAATGTC-3' (antisense). The following primers for
-actin PCR amplification were synthesized: 5'-TGTGGATCGGCGGCTCTA-3' (sense) and 5'-GGGCCCGACTCATCGTACT-3' (antisense). For real-time cDNA amplification, the following 5'-6-FAM/3' TAMRA probes for BHMT and
-actin were used: 5'-/56-FAM/TATCTGGGCAAAAAGTCAACGAAGCTGC/36-TAMTph/-3' (BHMT) and 5'-/56-FAM/CCTGGCCTCACTCTCCACCTTCCA/36-TAMTph/-3' (
-actin). Real-time PCR was performed in duplicate on an ABI Prism 7700 sequence detection system. The relative abundance of amplified cDNA was calculated as 2
Ct, where
Ct (change in cycle threshold) equals Ct of BHMT target Ct of
-actin loading control. Results are expressed as mean relative BHMT mRNA/
-actin mRNA values.
Enzyme assays.
GP livers and pancreas were sectioned on dry ice, weighed, and homogenized in 5 vol of buffer containing 30 mM Tris (pH 7.9), 2 mM EDTA, and 5 mM
-mercaptoethanol using a glass and Teflon homogenizer. Renal cortical tissue was separated from medullary tissue and homogenized as described above. Homogenates were centrifuged for 1 h at 16,000 g (4°C). The supernatants were assayed for total protein and BHMT activity as described previously (9).
Choline dehydrogenase activity was assayed with the use of a modified protocol (14). In summary, we homogenized frozen tissue in 3 vol of buffer containing 10 mM Tris (pH 7.9), 250 mM sucrose, 1 mM EDTA, and 5 mM
-mercaptoethanol using a glass and Teflon homogenizer. The homogenates were centrifuged for 10 min at 1,000 g (4°C), and the recovered supernatants were again centrifuged for 15 min at 3,500 g (4°C) to produce a pellet containing heavy mitochondria. We used the Bradford method to determine total mitochondrial protein concentration. Choline dehydrogenase activities were measured with 0.1 mg of mitochondrial protein in buffer containing 3.5 mM Tris (pH 7.9), 350 nM EDTA, 350 nM
-mercaptoethanol, 500 µM [methyl-14C]choline (0.2 µCi), 0.3% (m/v) phenazine methosulfate, and 350 µM CaCl2 (50 µl final volume). The mixtures were incubated for 15 min at 37°C, and then the reactions were stopped by transferring the tubes to ice water. The product, Bet aldehyde, was converted to Bet by adding 20 µl of 1 N NaOH and 15 µl of 30% hydrogen peroxide and allowing the mixture to stand for 1 h at room temperature. Water was then added to a final volume of 500 µl, and the reaction mixtures were loaded onto minicolumns containing 1 ml of Dowex 50W-40X (H+) resin. The resin was washed three times with 833 µl of ice-cold water. All flow-through fractions were collected (3 ml); to this eluant, we added 17 ml of Scintisafe scintillation fluid. The degradations per minute were then measured by scintillation counting. Blanks contained all of the reaction components except enzyme, and their counts were subtracted from sample values. All samples were assayed in triplicate. Specific activity (U/mg) was expressed as nanomoles Bet produced per hour per milligram of mitochondrial protein.
Western analysis for BHMT. Tissues were homogenized, and protein concentrations were determined as described above. Extracts containing 0.5 µg of liver protein or 25 µg of kidney protein were subjected to SDS-PAGE and transferred to a nitrocellulose membrane using a semi-dry transfer system. Separated protein was probed for BHMT as previously described (6). BHMT protein was visualized with chemiluminescence, and the optical densities of the bands were quantified with Image Station 440 from Eastman Kodak (Rochester, NY). The results for each group are expressed as the mean optical density. Results for the salt-treated animals are expressed relative to those for the control animals, whose average value was defined as 100%.
Statistical methods. Data were analyzed by a Student's t-test using the Simple Interactive Statistical Analysis online software (SISA: http://home.clara.net/sisa/t-test.htm). Results are expressed as means ± SE. Mean values were considered significantly different at P < 0.05.
| RESULTS |
|---|
|
|
|---|
|
Cloning and sequencing of GP liver BHMT. A near full-length open reading frame encoding a GP BHMT cDNA was sequenced.1 There is 83% nucleotide and 91% amino acid identity across the 1,198-nucleotide alignment of GP and human BHMT. All of the residues known to be essential for human BHMT activity [Gly 214 (3); Cys 217, 299, and 300 (4); and Tyr 77 (5, 10)] are conserved in the GP sequence. In addition, those residues shown to facilitate substrate and/or product binding to human BHMT are conserved in the GP enzyme, namely, Trp 44 (5), Glu 159 (5, 10), Tyr 160 (5, 11), and His 338 (27).
Effect of high salt intake on steady-state levels of BHMT mRNA.
Steady-state BHMT mRNA levels in liver and kidney cortex were measured with TaqMan real-time PCR. When corrected for
-actin mRNA, both liver and kidney cortex BHMT mRNA were dramatically lower in GPs consuming salt water compared with those consuming tap water (Fig. 2). Compared with the tap water-consuming control animals, steady-state mRNA levels decreased 93% in liver and 68% in kidney cortex with high salt intake.
|
|
30% compared with the control group (Fig. 3). | DISCUSSION |
|---|
|
|
|---|
In this report, we show that BHMT expression in GPs is affected by salt consumption. Compared with animals consuming tap water, those consuming salt water had a dramatic reduction in steady-state levels of BHMT mRNA in liver and kidney cortex, as well as significant reductions in the level of BHMT activity and protein content in both organs. The much larger decrease in mRNA compared with protein content suggests that the BHMT protein has a considerably longer half-life than the BHMT mRNA under these conditions.
Whether the reduction in liver and kidney BHMT mRNA was due to decreased transcription and/or increased degradation was not investigated. It is known that some genes involved in osmotic regulation are affected at the level of transcription. For example, the 5'-flanking regions of the
-aminobutyrate-Bet transporter, aldose reductase and myo-inositol transporter 1 genes, have been shown to contain a transcription factor binding sequence called the tonicity responsive regulatory element (TonE) (2, 13). When the TonE binding protein binds to this sequence, transcription increases. Whether a functional TonE sequence regulates BHMT expression is unknown, but if it does it would be the first example of this system decreasing transcription. It may also be that BHMT transcription is regulated by hormones, e.g., antidiuretic hormone, in response to changes in fluid and solute intake. These possibilities warrant further investigation.
The larger reduction in BHMT activity compared with BHMT protein levels in the salt-loaded animals compared with controls could represent a change in the catalytic efficiency of the enzyme. To date, the only known soluble effectors of mammalian BHMT are its products, dimethylglycine and Met, although it is possible that a heretofore unknown effector is differentially influencing BHMT activity in salt-treated vs. control GPs. To determine whether a soluble effector was influencing BHMT differently in the two treatment groups, we mixed equal volumes of individual liver or kidney extracts prepared from GPs from the control (water) or high salt treatment groups and assayed for BHMT activity. We observed that the BHMT-specific activities of the mixed samples were equal to the arithmetic mean of the specific activities obtained from the individual extracts assayed alone. This observation indicates that the differences observed in BHMT activity between the experimental groups and the observation that activity levels decreased to a larger degree than the levels of immunodetectable protein in the salt-loaded GPs were not due to any soluble effector present in one extract and not the other. The possibility that the catalytic efficiency of BHMT is affected by some unknown covalent modification(s) or some other more complex mode of regulation was not tested and warrants further investigation. For example, hypertonicity has been shown to activate phosphorylation events (13). There are no reports indicating that the catalytic efficiency of BHMT is regulated by phosphorylation, but this possibility cannot be eliminated at this time. Furthermore, there is one report that used Western analysis to detect BHMT following two-dimensional electrophoresis of protein extract made from monkey lenses, which suggested that BHMT is subject to posttranslational modification (23). This report did not characterize the modification(s) to BHMT or whether the modified form(s) differed in terms of its catalytic efficiency.
In addition to kidney and liver expression, BHMT is also expressed at high levels in the acinar cells of the GP pancreas (Fig. 1B). We are not aware of any report that has assayed for BHMT activity and/or protein in human pancreas, but no BHMT mRNA could be detected by Northern analysis using a commercially prepared blot containing human pancreatic mRNA. It is known that sheep express very high levels of BHMT activity in the pancreas (31) but that rats and pigs have no measurable activity in this organ (6, 8). Hence, like kidney BHMT expression, pancreatic expression is species dependent. Despite the large reductions of BHMT expression in the liver and kidney cortex of salt-loaded GPs, there was no change in the BHMT activity measured in the pancreas. The lack of change in activity may be due to the absence of the necessary osmotic response factors for BHMT in the pancreas, or perhaps the pancreas is not subject to changes in tonicity due to high salt intake.
The level of liver and kidney choline dehydrogenase activity was also measured in this study. Choline dehydrogenase catalyzes the first and committed reaction of two enzymatic steps required to convert choline to Bet, but no change in activity was observed in the salt-loaded GPs compared with the control group. This is in contrast to a report that indicated that hypertonicity induces a 50% increase in choline dehydrogenase activity in rat kidney cortex (12). However, we cannot directly compare our results with those obtained in the aforementioned study because we did not measure blood osmolality. Furthermore, no statement can be made as to whether the flux from choline to Bet changes in GP liver and/or kidney in response to changes in salt intake because enzyme activity levels only measure reaction capacity. Similarly, it is not possible to know whether the reduction of BHMT expression measured in the salt-loaded GPs causes any change in flux through the BHMT-catalyzed reaction relative to the control animals.
The regulation of BHMT activity by osmolarity has precedence in lower organisms. It has been reported that the halophytic cyanobacteria, A. halophytica, accumulates Bet as a mechanism to survive in high salt media and that it regulates intracellular Bet concentrations by altering BHMT activity (15). In this organism, BHMT activity is low when cells are grown in high salt media, but it is rapidly elevated when the salt is removed from the media. The induction of BHMT activity is followed by a rapid reduction of intracellular Bet. It was not determined whether changes in BHMT activity in this organism were due to changes in transcription, translation, or catalytic efficiency. However, in a separate study, it was reported that the BHMT protein from A. halophytica is sensitive to salt concentrations (28). When the purified enzyme is assayed in the presence of increasing levels of NaCl, it progressively loses activity such that when 200 mM NaCl is reached it has lost all activity (8). It was not reported whether this is specific effect of one of the monovalent ions or whether it is a general effect of ionic strength. However, it is known that concentrations of sodium and chloride in A. halophytica can vary from 80180 mM (24) and 35150 mM (16), respectively, depending on culture conditions. Regardless of whether such large changes can occur in mammalian tissues, BHMT activity in crude GP liver extracts or the activity of the pure human liver enzyme is not sensitive to salt concentration. Addition of up to 500 mM NaCl or KCl to these BHMT solutions has no affect on enzyme activity. This points to a key difference in the way A. halophytica and mammals use BHMT for osmoregulation.
In summary, this report shows that the expression of liver and kidney BHMT is downregulated in salt-loaded GPs. All of the mechanistic features involved in this downregulation have yet to be determined, but we propose that the physiological significance of this downregulation might be to decrease the use of Bet as a methyl donor, making it more readily available for transport and accumulation in the kidney medulla as a means to combat high extracellular osmolarity. Confirmation of this hypothesis awaits in vivo measurements of Bet oxidation under varying osmotic conditions.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
Portions of these data were presented at the national meeting of the Federation of American Societies for Experimental Biology in Washington, DC, 2004.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 The nucleotide sequence reported in this paper has been deposited to the GenBank/EBI Data Bank with accession number AY398694. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Schafer, L. Hoffmann, K. Heldt, M. R. Lornejad-Schafer, G. Brauers, T. Gehrmann, T. A. Garrow, D. Haussinger, E. Mayatepek, B. C. Schwahn, et al. Osmotic regulation of betaine homocysteine-S-methyltransferase expression in H4IIE rat hepatoma cells Am J Physiol Gastrointest Liver Physiol, April 1, 2007; 292(4): G1089 - G1098. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Collinsova, J. Strakova, J. Jiracek, and T. A. Garrow Inhibition of Betaine-Homocysteine S-Methyltransferase Causes Hyperhomocysteinemia in Mice J. Nutr., June 1, 2006; 136(6): 1493 - 1497. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |