AJP - Regu AJP: Endocrinology and Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 288: R1038-R1045, 2005. First published November 24, 2004; doi:10.1152/ajpregu.00701.2004
0363-6119/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/4/R1038    most recent
00701.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ke, X.
Right arrow Articles by Lane, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ke, X.
Right arrow Articles by Lane, R. H.

DEVELOPMENTAL PHYSIOLOGY AND PREGNANCY

Nonresponsiveness of cerebral p53-MDM2 functional circuit in newborn rat pups rendered IUGR via uteroplacental insufficiency

Xingrao Ke, Robert A. McKnight, Zheng-ming Wang, Xing Yu, Laiyi Wang, Christopher W. Callaway, Kurt H. Albertine, and Robert H. Lane

Division of Neonatology, Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, Utah

Submitted 13 October 2004 ; accepted in final form 19 November 2004


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Severe uteroplacental insufficiency causes cerebral apoptosis in the fetus. Moderate uteroplacental insufficiency causes intrauterine growth retardation (IUGR) and increases the risk of postnatal neurological morbidity. In the rat, uteroplacental insufficiency and IUGR affect cerebral gene expression of Bcl-2 and predispose the newborn IUGR rat toward cerebral apoptosis when challenged with perinatal hypoxia. Expression of Bcl-2, as well as the proapoptotic protein Bax, is regulated by p53. p53 also induces MDM2 transcription, which functions to limit further p53-induced apoptosis. The predisposition of the IUGR fetus toward cerebral apoptosis suggests that the p53-MDM2 "functional" circuit may be perturbed in the newborn IUGR rat brain. We hypothesized that MDM2 cerebral expression does not increase in response to increased p53 expression or increased levels of phospho-p53 (Ser15), an activated form of p53. To prove this hypothesis, we induced IUGR through bilateral uterine ligation of the pregnant rat. Uteroplacental insufficiency significantly increased p53 mRNA, total p53 protein, and phospho-p53 (Ser15) protein levels in the brain at term. Increased expression of phospho-p53 (Ser15) and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling-positive cells were localized to the CA1 region of the hippocampus, the subcortical and periventricular white matter, and the amygdala of the IUGR rat brain. In contrast, uteroplacental insufficiency decreased cerebral MDM2 mRNA and phospho-MDM2 (Ser166) protein levels in the IUGR rat pups. We conclude that the cerebral MDM2 response to increased p53 expression is not present in the newborn IUGR rat pup, and we speculate that this contributes to the predisposition of the IUGR fetus toward perinatal and long-term neurodevelopmental morbidities.

apoptosis; hippocampus; white matter; amygdala; intrauterine growth retardation


UTEROPLACENTAL INSUFFICIENCY causes intrauterine growth retardation (IUGR) and increases the risk of perinatal and long-term neurological morbidities (35, 57, 79, 92, 94). These morbidities range from abnormal behavioral assessments to cerebral palsy and often occur without evidence of gross neurological damage. Most IUGR infants who demonstrate abnormal neurodevelopmental outcomes do not display overt neurological symptomatology in the perinatal period. Apoptosis is a potentially "silent" molecular mechanism through which a selective loss of cerebral cells could occur. Moreover, we previously demonstrated (54) that rat pups rendered IUGR through uteroplacental insufficiency are predisposed toward increased apoptosis after suffering a perinatal insult.

Apoptosis is an important and active mechanism of normal human and rodent fetal brain development (11, 67). A key regulator of apoptosis is p53, which acts as both a transcription factor and an active component of the apoptosis cascade (33, 39, 75). p53 plays a pivotal role in the cellular response to stress, in part based on posttranslational phosphorylation at multiple serine sites within its NH2- and COOH-terminal ends (65, 80). Posttranslational modifications such as phosphorylation of the COOH-terminal Ser390 (Ser392 in human, Ser389 in mouse) enhance p53 DNA binding, whereas phosphorylation of the NH2-terminal Ser15 (Ser15 in human, Ser18 in mouse) increases p53 stability and apoptotic activity (37, 41, 76).

Stability of the p53 gene product is normally regulated by MDM2, which blocks the interaction of p53 with transcriptional coactivators and promotes proteasome degradation of p53 (4, 32, 91). p53 binding to an internal promoter activates MDM2 transcription (7, 40). This negative-feedback loop, termed the "p53 functional circuit," serves to tightly control p53 activity (39). Because of the predisposition toward apoptosis in both IUGR humans and rats, we hypothesized that uteroplacental insufficiency disrupts this circuit in the IUGR fetal rat brain.

To test this hypothesis, we induced IUGR with a rat model of uteroplacental insufficiency. Uteroplacental insufficiency is associated with the hypertensive disorders of pregnancy, which are the most common medical complications of pregnancy and lead to serious perinatal mortality and morbidity (95). The human IUGR fetus endures in utero hypoxia, acidosis, hypoglycemia, altered levels of growth factors, and hypoinsulinemia (2022). Similarly in the rat, when induced via bilateral uterine artery ligation of the pregnant dam, IUGR induces an identical response in the late-gestation fetus (68, 70, 85). In this well-characterized and widely published rat model of asymmetric growth retardation, IUGR pups are 20–25% lighter than sham-operated control animals, and birth weights are normally distributed within and among litters (9, 45, 46, 4850, 52, 69, 70, 78). Using this IUGR model, we quantified the effects of uteroplacental insufficiency on fetal cerebral p53 mRNA and protein levels, as well as phospho-p53 (Ser15) and phospho-p53 (Ser390) protein levels. MDM2 mRNA and protein levels were measured to determine the IUGR response to p53 gene expression and posttranslational modifications. Immunohistochemistry was then used to localize p53 expression.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals. All procedures were approved by the University of Utah Chancellor's Animal Research Committee and are in accordance with the American Physiological Society's guiding principles (3). These surgical methods were described previously (43, 4655, 72, 78, 82). On day 19 of gestation, the pregnant rats were anesthetized with intraperitoneal xylazine (8 mg/kg) and ketamine (40 mg/kg), and both uterine arteries were ligated (IUGR group; n = 6 litters). Term gestation in the rat is 21.5 days. Sham surgery was performed on control animals that underwent identical anesthetic and surgical procedures except for the uterine artery ligation (control group; n = 6 litters). Day 0 pups were delivered by cesarean section (n = 6 litters each for control and IUGR) at term, 2.5 days after the bilateral uterine artery ligation. Brains were quickly removed and either processed for histological preparation or frozen.

Cloning of rat MDM2 cDNA. Total RNA was isolated from Sprague-Dawley rat brain. cDNA was synthesized with random primers and the Superscript III first-strand synthesis system for RT-PCR (Invitrogen, Carlsbad, CA). The cDNA was then amplified with mouse MDM2-specific primers: forward 5' atgtgcaataccaacatg and reverse 5' actaaatttctgtagatcat. A 323-bp PCR product was cloned into pCR2.1, sequenced, and found to be 96% homologous to the mouse sequence.

RNA isolation. Total RNA was extracted from day 0 brains with a RNeasy Mini Kit (Qiagen, Valencia, CA), treated with DNase3 (Ambion, Austin, TX), and quantified with ultraviolet absorbance. RNA integrity was confirmed by gel electrophoresis.

Real-time PCR. Brain mRNA levels of MDM2 and p53 were measured by real-time RT-PCR as previously described (58). Probe and primers were designed with Primer Express software (Applied Biosystems, Foster City, CA). Probes were labeled with N-(3-fluoranthyl)maleimide reporter dye and 6-carboxytetramethylrhodamine quencher dye. The sequences for MDM2 were forward 5' tctgtgtctaccgagggtgct, reverse 5' tttggtctaaccagagtctcttgttc, and probe 5' caggcacctcacagattccagcgtc. The primers and probe for p53 were forward 5' cccaccatgagcgttgct, reverse 5' ccacccggataagatgttgg, and probe 5' aggagcgacgaccaggccgtcaccatca. cDNA was synthesized from 2 µg of DNase-treated total RNA as described above. Reporter dye emission was detected by an automated sequence detector combined with ABI Prism 7700 Sequence Detection System software (Applied Biosystem). An algorithm normalizes the reporter signal (Rn) to a passive reference and multiplies the standard deviation of the background Rn in the first cycles by a default factor of 10 to determine threshold cycle (CT). CT has a linear relation with the logarithm of the initial template copy number (34). Rat GAPDH was used as an internal control to correct for differences in cDNA loading. Relative quantification of PCR products are then based on value differences between the target and GAPDH control with the comparative CT method (64). Cycle parameters were 50°C for 2 min, 95°C for 10 min, and then 40 cycles of 95°C for 15 s and 60°C for 1 min. Samples were run in triplicate.

Immunoblotting and antibodies. Whole brains were homogenized in ice-cold lysis buffer (150 mM NaCl, 50 mM Tris pH 7.4, 1 mM EDTA, 0.25% Na-deoxycholate, 1% Igepal CA-630) with complete mini EDTA protein inhibitors (Roche, Mannheim, Germany) and 0.1 M PMSF and centrifuged at 10,000 g at 4°C for 15 min. The supernatants were collected and stored at –80°C until use. Protein concentrations were determined by the bicinchoninic acid method (Pierce, Rockford, IL). Proteins were separated by 10% SDS-PAGE ready gels (Bio-Red) and transferred to nitrocellulose membranes in standard transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol). After blocking the membranes with 5% milk in Tris-buffered saline (TBS) for 1 h, bound proteins were exposed to antibodies against p53, phospho-p53 (Ser15) (Cell Signaling Technology), phospho-p53 (Ser390) (ABR Affinity BioReagents), human MDM2 (SMP14; Santa Cruz Biotechnology), and phospho-MDM2 (Ser166) (Cell Signaling Technology) overnight at 4°C. After extensive washing in TBS with 0.1% Tween 20 (TBST), a 1/2,000 dilution of horse anti-mouse or goat anti-rabbit horseradish peroxidase secondary antibody (Cell Signaling Technology) was applied and incubated for 1 h at room temperature. After extensive washing in TBST, blots were detected with Western Lightning enhanced chemiluminescence (PerkinElmer Life Sciences, Boston, MA) with Biomax film (Amersham, Little Chalfont, UK) and quantified by densitometry or by quantification on a Kodak Image Station 2000R (Eastman Kodak/SIS, Rochester, NY).

Immunohistochemistry analysis for phospho-p53 Ser15 localization. Coronal sections of formalin-fixed brains were deparaffinized and rehydrated in a graded series of ethanol and distilled H2O (dH2O) with a final wash in PBS. Immunohistochemistry was performed as previously described (2). The slides were then subjected to an antigen retrieval procedure in which the slides were put in a slide tray with high-pH target retrieval solution (DakoCytomation, Carpinteria, CA) in a microwave oven and heated at high power for 165 s and at low power for 8 min, after which they were cooled to room temperature and washed with tap water. Sections were then incubated in a 3% H2O2 solution for 30 min at room temperature (20–22°C) to quench endogenous peroxidase activity. After being rinsed with tap water, sections were washed in PBS for 10 min and incubated in a blocking buffer (2% normal goat serum, 2% bovine serum albumin, 0.8% Triton X-100, 0.2% nonfat dry milk in PBS) at room temperature for 1 h. Sections were treated with phospho-p53 (Ser15) rabbit polyclonal antibody at 1:100 dilution in blocking buffer overnight at 4°C in a humidified chamber. The next day, sections were washed in PBS containing 0.2% Tween 20 (PBST) three times and were exposed to biotinylated goat anti-rabbit immunoglobulins for 1 h. After exposure to a TSA Biotin System (PerkinElmer Life Sciences), slides were washed in PBST for 15 min, stained with diaminobenzidine (DAB; Sigma, St. Louis, MO), counterstained with hematoxylin (Sigma), dehydrated, and coverslipped with Cytoseal 60 (Stephens Scientific, Kalamazoo, MI).

Terminal deoxynucleotidyl transferase dUTP nick-end label assay. Coronal sections of brain were deparaffinized and rehydrated in a graded series of ethanol. Slides were then rinsed in dH2O, washed in PBS, and incubated for 15 min at room temperature with 20 µg/ml of proteinase K (Sigma-Aldrich). Slides were rinsed in dH2O, washed twice in PBS, and then incubated in 2% H2O2, to quench endogenous peroxidase activity. After a wash in dH2O, sections were incubated with terminal deoxynucleotidyl transferase (TdT) and biotinylated dUTP (Trevigen, Gaithersburg, MD) for 60 min at 37°C in a humidified chamber. The reaction was stopped with a stop/wash buffer, followed by a wash in PBS and incubation in PBS with avidin DH and biotinylated horseradish peroxidase H (Vectastain Elite ABC kit, Vector Laboratories, Burlingame, CA) for 20 min. After two PBS washes, the chromagen DAB (0.07 mg/ml) (Sigma) and urea H2O2 (1.6 mg/ml) in dH2O were added for 8 min, turning labeled DNA fragments brown. Sections were washed in dH2O, counterstained with methyl green, dipped in dH2O, 85%-95%-100% ethanol, Hemo-De (Fisher Scientific, Pittsburgh, PA), and coverslipped. Positive control sections were made by exposing sections to a DNase I solution before the TdT step, and negative control sections were made by substituting dH2O for TdT. Both controls were included each time sections were stained.

Statistics. All data presented are expressed as mean ± SE percentage of control. ANOVA (Fisher's protected least significant difference) and the Student's unpaired t-test determined statistical significance. We accepted P < 0.05 for statistical significance.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cerebral p53 gene expression. mRNA and protein levels of p53 were measured with real-time RT-PCR and Western blotting, respectively. GAPDH was used as an internal control. Uteroplacental insufficiency and subsequent IUGR increased cerebral p53 mRNA and protein levels to 152 ± 18% and 138 ± 13% of control values, respectively (P < 0.05) (Fig. 1).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 1. Quantification of real-time RT-PCR and Western blots of p53 species, as well as representative Western blots from day 0 control (Con) and intrauterine growth retardation (IUGR) brain. Protein was quantified with NIH Image software. Results are expressed as mean ± SE % relative to sham-operated controls (n = 6 litters). *P < 0.05, **P < 0.01.

 
Cerebral phospho-p53 (Ser15 and Ser390) levels. Protein levels of phospho-p53 (Ser15 and Ser390) were quantified by Western blotting with GAPDH as an internal control. Uteroplacental insufficiency and subsequent IUGR significantly increased cerebral phosphor-p53 (Ser15) levels to 175 ± 6% of control values (P < 0.01; Fig. 1). In contrast, uteroplacental insufficiency did not significantly affect phosphor-p53 (Ser390) levels in IUGR brains (80 ± 16%; Fig. 1).

Phosphor-p53 (Ser15) immunohistochemistry and TdT-mediated dUTP nick-end labeling. Immunochemistry of whole brain sections was used to localize expression of phospho-p53 (Ser15). Phospho-p53 (Ser15) expression appeared greater in the IUGR group compared with the control group (Fig. 2) in hippocampus, amygdala, and white matter, similar to the Western blot findings presented above. Similarly, DNA fragmentation associated with apoptosis and detected by the TdT-mediated dUTP nick-end labeling (TUNEL) assay was also localized to hippocampus, amygdala, and white matter, with the appearance of fewer TUNEL-positive cells in the controls compared with the IUGR group (Fig. 3).



View larger version (148K):
[in this window]
[in a new window]
 
Fig. 2. Phospho-p53 (Ser15)-positive cells are visible in regions of hippocampal CA1 [A (control) and D (IUGR)], amygdala [B (control) and E (IUGR)], and white matter [C (control) and F (IUGR)] in tissue collected at day 0. IUGR tissue has more phospho-p53 (Ser15)-positive cells (brown staining) compared with control. Arrows denote representative positive cells.

 


View larger version (144K):
[in this window]
[in a new window]
 
Fig. 3. Terminal deoxynucleotidyl transferase-mediated nick-end labeling (TUNEL) in the regions of hippocampal CA1 [A (control) and D (IUGR)], amygdala [B (control) and E (IUGR)], and white matter [C (control) and F (IUGR)] in tissue collected at day 0. IUGR has more TUNEL-positive cells (arrows) compared with control. Arrows denote representative positive cells.

 
MDM2 partial cDNA clone. The rat MDM2 partial cDNA cloned here was 96% (E value 3e–147) homologous to the mouse and corresponded to base pairs 254–576 of the murine sequence (accession no. NM010786.2) (Fig. 4A). The rat MDM2 partial sequence cloned in this study also exactly matched the GenBank entry "Rattus norvegicus similar to mdm2 gene product" (accession no. XM235169.2). This sequence was then used to design a probe and primers for real-time PCR to measure MDM2 mRNA levels.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 4. A: rat MDM2 partial cDNA sequence starting at the ATG. Sequences marked in bold are from mouse sequence used to design the RT-PCR primers. B: quantification of real time RT-PCR and Western blots of MDM2 species, as well as representative Western blots from day 0 control and IUGR brain. Protein was quantified with NIH Image software. Results are expressed as mean ± SE % relative to sham-operated controls (defined as 100%) (n = 6 litters). *P < 0.05, **P < 0.01.

 
Cerebral MDM2 gene expression. Uteroplacental insufficiency significantly decreased cerebral MDM2 mRNA to 64 ± 8% of control values (P < 0.05), as measured by real-time RT-PCR (Fig. 4B). IUGR similarly decreased phospho-MDM2 (Ser166) protein levels to 66 ± 4% of control values (P < 0.01), whereas total MDM2 protein levels were not significantly affected.


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
IUGR complicates up to 6% of all pregnancies (25). Both humans and rats rendered IUGR by uteroplacental insufficiency are vulnerable to perinatal hypoxia and neurodevelopmental morbidity (54, 86, 89, 90). In IUGR rats, increased cerebral apoptosis characterizes this vulnerability (54). Apoptosis contributes to the subsequent pathogenesis of cerebral ischemia in juvenile and adult animals, and the relative contribution of apoptosis toward cerebral cell death increases with the immaturity of the animals studied (17, 73, 77, 88, 96). This is particularly true for the CA1 region of the hippocampus (28). Adult animals respond to various stresses with the increased cerebral expression of p53 and a subsequent MDM2 response. For example, traumatic brain injury induces apoptosis in association with increased expression of p53 and MDM2 over the course of 1–2 days in adult male Sprague-Dawley rats (56). Similarly, adult male Sprague-Dawley rats respond to chronic administration of morphine by increasing MDM2 mRNA levels in the hippocampus, amygdala, and cortex; moreover, middle cerebral artery occlusion also induces MDM2 expression in spontaneously hypertensive male Sprague-Dawley rats (38, 83). The findings of the present study demonstrate that fetal IUGR rat brain fails to respond to the transient insult of uteroplacental insufficiency and increased p53 expression by increasing MDM2 gene expression. This dysfunctional p53-MDM2 negative-feedback loop suggests a molecular mechanism for the predisposition of immature animals toward cerebral apoptosis vs. older animals and the subsequent neurological morbidity.

The initial step in the p53-MDM2 negative-feedback loop or "functional circuit" is activation of MDM2 transcription by binding of the p53 protein to an internal MDM2 promoter (P2), located near the 3' end of intron 1 (6, 40). RNA from the MDM2 P2 promoter is more efficiently translated than RNA from the P1 promoter (44). Posttranslation modification of the MDM2 protein by phosphorylation at Ser166 increases MDM2 function by increasing nuclear entry (63, 97). The nuclear MDM2 protein functions as a E3 ubiquitin ligase that binds to the NH2 terminus of p53, which inhibits p53 transcription factor activity and ubiquinates the COOH terminus of p53. Ubiquination of p53 subsequently leads to export from the nucleus and degradation of p53 (24, 31, 66). This process is mitigated by p53 phosphorylation on Ser15, which decreases binding affinity between p53 and MDM2 (74, 76, 93).

Phosphorylation of Ser15 on p53 appears to initiate stress-induced activation of p53 (19). IUGR-induced phosphorylation at Ser15, but not Ser390, supports this previous observation and suggests that phosphorylation of Ser15 on p53 is a specific response to the intrauterine milieu associated with uteroplacental insufficiency. The present study is among the first to document a specific posttranslational modification to p53 to a perinatal insult.

Phospho-p53 (Ser15) affects multiple cellular processes that are relevant to the developing brain. Phospho-p53 (Ser15) inhibits cell cycle progression by causing arrest at the G1 phase (15). p53, which functions as a transcription factor for many genes including p21CIP/WAF and the apoptosis-related proteins Bcl-2 and Bax, requires p53 Ser15 phosphorylation for activation (8, 13, 42, 71). Moreover, mutation of Ser15 to Ala renders p53 ineffectual at both blocking cell cycle progression and initiating apoptosis, and the expression of phosphor-53 (Ser15) correlates directly with the amount of apoptosis (23, 84).

p53 also perpetuates the apoptosis cascade by direct interaction with mitochondria and activation of Bax, a proapoptotic protein (14, 62). As a result, because perinatal hypoxia increases Bax expression in the IUGR rat brain, the presence of increased p53 levels in IUGR brain potentially lowers the cerebral apoptosis threshold and thereby leaves the newborn IUGR animal particularly vulnerable to a second insult independent of transcription (54).

Many of the initial insults that characterize this model of uteroplacental insufficiency and IUGR potentially increase p53 expression, including acidosis, hypoglycemia, decreased levels of key growth factors such as IGF-I, and moderate hypoxia (26, 36, 68, 81). The component of hypoxia, which is missing from purely nutritional models of IUGR, adds significant physiological relevance to our model of IUGR because it mimics the human condition of uteroplacental insufficiency (20, 22). Hypoxia-induced neuronal apoptosis is a p53-dependent process; furthermore, hypoxia mediates the phosphorylation of p53 at Ser15 and may contribute to failure of the IUGR MDM2 response (5, 30, 98). In colorectal carcinoma cell lines infected with human papillomavirus, hypoxia decreases expression of MDM2 (1).

Hypoxia is a common characteristic of other animal models of early brain injury. An important model that has provided a great deal of insight into the pathogenesis of hypoxic-ischemic injury involves ligation of one common carotid artery followed by systemic hypoxia (87). Similar to the present study, the "Vannucci" model localizes injury to the hippocampus and white matter, as well as the cerebral cortex, when performed in either the rat or the rabbit (16, 87). Furthermore, simply exposing newborn rats to 20 min of 100% nitrogen induces neuronal loss in the CA1 region of the hippocampus in association with increased expression of p53 and TUNEL-positive staining (29). It is interesting that adult rats from this latter study were repeatedly slower than controls in various behavioral tests, demonstrating a loss of functional skills in correlation with increased central nervous system apoptosis.

Because of the practical difficulties associated with studies involving prenatal insults, few studies exist that focus on the specific cerebral molecular responses during this time period. Fetal developmental biology is unique because of the interactive physiology and biochemistry among mother, placenta, and fetus; furthermore, the fetal brain is phenotypically different from the postnatal brain, which has been exposed to the hormones and environmental stresses associated with parturition and ex utero life. In the guinea pig, reduction of placental blood flow in the second half of gestation decreases hippocampal volume, reduces the total number of CA1 pyramidal neurons, and causes ventriculomegaly (18, 59, 60). In the rat, clamping of the uterine artery on day 17 of gestation decreases fetal hippocampal weight, hippocampal DNA, and hippocampal incorporation of thymidine into DNA on day 1 of postnatal life (12). Although both of these studies provided the groundwork for the present study, neither investigated the molecular basis for their findings.

Caution is necessary, of course, when attempting to apply data from animal models to human pathophysiology. The fetal rat is physiologically immature relative to the human, and the insult imposed on the fetal rat in our model of uteroplacental insufficiency is severe and specific. In contrast, the timing and impact of uteroplacental insufficiency experienced by humans range across a continuum. It is worth noting, however, that IUGR and white matter damage are often associated findings at necropsy and that in monochorionic twins, the sibling who suffers periventricular leukomalacia (white matter injury) is more likely to be IUGR and characterized by reversed end-diastolic umbilical artery flow (27). Furthermore, apoptosis often characterizes the histopathology associated with periventricular leukomalacia in premature infants (10). Interestingly, Maneru et al. (61) found that teenagers with a history of perinatal asphyxia suffer from decreased hippocampal volume on voxel-based morphometry, as well as reduced long-term verbal memory.

In summary, this study finds that the rat fetus responds to the insult of uteroplacental insufficiency by upregulating p53 gene expression and phospho-p53 (Ser15) without a corresponding increase in MDM2 expression. These are novel findings that emphasize that immature animals in utero respond differently from more mature ex utero animals. Furthermore, the IUGR-induced changes in p53 expression localize in the CA1 region of the hippocampus and white matter, similar to what is found in other animal models and humans suffering perinatal insults.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This research was supported by National Institute of Child Health and Human Development Grants R01-HD-41075 (R. H. Lane) and National Heart, Lung, and Blood Institute Grants R01-HL-62875 (K. H. Albertine) and by the March of Dimes (R. H. Lane).


    FOOTNOTES
 

Address for reprint requests and other correspondence: R. H. Lane, Div. of Neonatology, Dept. of Pediatrics, Univ. of Utah School of Medicine, 30 North 1900 East, Rm. 2A100, Salt Lake City, UT 84132-2202 (E-mail: robert.lane{at}hsc.utah.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Alarcon R, Koumenis C, Geyer RK, Maki CG, and Giaccia AJ. Hypoxia induces p53 accumulation through MDM2 down-regulation and inhibition of E6-mediated degradation. Cancer Res 59: 6046–6051, 1999.[Abstract/Free Full Text]
  2. Albertine KH, Soulier MF, Wang Z, Ishizaka A, Hashimoto S, Zimmerman GA, Matthay MA, and Ware LB. Fas and fas ligand are up-regulated in pulmonary edema fluid and lung tissue of patients with acute lung injury and the acute respiratory distress syndrome. Am J Pathol 161: 1783–1796, 2002.[Abstract/Free Full Text]
  3. American Physiological Society. Guiding principles for research involving animals and human beings. Am J Physiol Regul Integr Comp Physiol 283: R281–R283, 2002.[Free Full Text]
  4. Balint EE and Vousden KH. Activation and activities of the p53 tumour suppressor protein. Br J Cancer 85: 1813–1823, 2001.[CrossRef][Web of Science][Medline]
  5. Banasiak KJ and Haddad GG. Hypoxia-induced apoptosis: effect of hypoxic severity and role of p53 in neuronal cell death. Brain Res 797: 295–304, 1998.[CrossRef][Web of Science][Medline]
  6. Barak Y, Gottlieb E, Juven-Gershon T, and Oren M. Regulation of mdm2 expression by p53: alternative promoters produce transcripts with nonidentical translation potential. Genes Dev 8: 1739–1749, 1994.[Abstract/Free Full Text]
  7. Barak Y, Juven T, Haffner R, and Oren M. mdm2 expression is induced by wild type p53 activity. EMBO J 12: 461–468, 1993.[Web of Science][Medline]
  8. Bean LJ and Stark GR. Phosphorylation of serines 15 and 37 is necessary for efficient accumulation of p53 following irradiation with UV. Oncogene 20: 1076–1084, 2001.[CrossRef][Web of Science][Medline]
  9. Bussey ME, Finley S, LaBarbera A, and Ogata ES. Hypoglycemia in the newborn growth-retarded rat: delayed phosphoenolpyruvate carboxykinase induction despite increased glucagon availability. Pediatr Res 19: 363–367, 1985.[Web of Science][Medline]
  10. Chamnanvanakij S, Margraf LR, Burns D, and Perlman JM. Apoptosis and white matter injury in preterm infants. Pediatr Dev Pathol 5: 184–189, 2002.[Web of Science][Medline]
  11. Chan WY, Lorke DE, Tiu SC, and Yew DT. Proliferation and apoptosis in the developing human neocortex. Anat Rec 267: 261–276, 2002.[CrossRef][Medline]
  12. Chanez C, Privat A, Flexor MA, and Drian MJ. Effect of intrauterine growth retardation on developmental changes in DNA and [14C]thymidine metabolism in different regions of rat brain: histological and biochemical correlations. Brain Res 353: 283–292, 1985.[Medline]
  13. Chen K, Albano A, Ho A, and Keaney JF Jr. Activation of p53 by oxidative stress involves platelet-derived growth factor-{beta} receptor-mediated ataxia telangiectasia mutated (ATM) kinase activation. J Biol Chem 278: 39527–39533, 2003.[Abstract/Free Full Text]
  14. Chipuk JE, Kuwana T, Bouchier-Hayes L, Droin NM, Newmeyer DD, Schuler M, and Green DR. Direct activation of Bax by p53 mediates mitochondrial membrane permeabilization and apoptosis. Science 303: 1010–1014, 2004.[Abstract/Free Full Text]
  15. Ciciarello M, Mangiacasale R, Casenghi M, Zaira Limongi M, D'Angelo M, Soddu S, Lavia P, and Cundari E. p53 displacement from centrosomes and p53-mediated G1 arrest following transient inhibition of the mitotic spindle. J Biol Chem 276: 19205–19213, 2001.[Abstract/Free Full Text]
  16. D'Arceuil H, Rhine W, de Crespigny A, Yenari M, Tait JF, Strauss WH, Engelhorn T, Kastrup A, Moseley M, and Blankenberg FG. 99mTc annexin V imaging of neonatal hypoxic brain injury. Stroke 31: 2692–2700, 2000.[Abstract/Free Full Text]
  17. Dell'Anna E, Chen Y, Engidawork E, Andersson K, Lubec G, Luthman J, and Herrera-Marschitz M. Delayed neuronal death following perinatal asphyxia in rat. Exp Brain Res 115: 105–115, 1997.[CrossRef][Web of Science][Medline]
  18. Dieni S and Rees S. Dendritic morphology is altered in hippocampal neurons following prenatal compromise. J Neurobiol 55: 41–52, 2003.[CrossRef][Web of Science][Medline]
  19. Dumaz N and Meek DW. Serine15 phosphorylation stimulates p53 transactivation but does not directly influence interaction with HDM2. EMBO J 18: 7002–7010, 1999.[CrossRef][Web of Science][Medline]
  20. Economides DL and Nicolaides KH. Blood glucose and oxygen tension levels in small-for-gestational-age fetuses. Am J Obstet Gynecol 160: 385–389, 1989.[Web of Science][Medline]
  21. Economides DL, Nicolaides KH, and Campbell S. Metabolic and endocrine findings in appropriate and small for gestational age fetuses. J Perinat Med 19: 97–105, 1991.[Web of Science][Medline]
  22. Economides DL, Nicolaides KH, Gahl WA, Bernardini I, Bottoms S, and Evans M. Cordocentesis in the diagnosis of intrauterine starvation. Am J Obstet Gynecol 161: 1004–1008, 1989.[Web of Science][Medline]
  23. Fiscella M, Ullrich SJ, Zambrano N, Shields MT, Lin D, Lees-Miller SP, Anderson CW, Mercer WE, and Appella E. Mutation of the serine 15 phosphorylation site of human p53 reduces the ability of p53 to inhibit cell cycle progression. Oncogene 8: 1519–1528, 1993.[Web of Science][Medline]
  24. Fuchs SY, Adler V, Buschmann T, Wu X, and Ronai Z. Mdm2 association with p53 targets its ubiquitination. Oncogene 17: 2543–2547, 1998.[CrossRef][Web of Science][Medline]
  25. Gagnon R. Placental insufficiency and its consequences. Eur J Obstet Gynecol Reprod Biol 110, Suppl 1: S99–S107, 2003.[CrossRef][Web of Science][Medline]
  26. Ghatnekar GS, Barnes JA, Dow JL, and Smoak IW. Hypoglycemia induced changes in cell death and cell proliferation in the organogenesis stage embryonic mouse heart. Birth Defects Res A Clin Mol Teratol 70: 121–131, 2004.[CrossRef][Web of Science][Medline]
  27. Gratacos E, Carreras E, Becker J, Lewi L, Enriquez G, Perapoch J, Higueras T, Cabero L, and Deprest J. Prevalence of neurological damage in monochorionic twins with selective intrauterine growth restriction and intermittent absent or reversed end-diastolic umbilical artery flow. Ultrasound Obstet Gynecol 24: 159–163, 2004.[CrossRef][Web of Science][Medline]
  28. Grojean S, Pourie G, Vert P, and Daval JL. Differential neuronal fates in the CA1 hippocampus after hypoxia in newborn and 7-day-old rats: effects of pre-treatment with MK-801. Hippocampus 13: 970–977, 2003.[CrossRef][Web of Science][Medline]
  29. Grojean S, Schroeder H, Pourie G, Charriaut-Marlangue C, Koziel V, Desor D, Vert P, and Daval JL. Histopathological alterations and functional brain deficits after transient hypoxia in the newborn rat pup: a long term follow-up. Neurobiol Dis 14: 265–278, 2003.[CrossRef][Web of Science][Medline]
  30. Hammond EM, Dorie MJ, and Giaccia AJ. ATR/ATM targets are phosphorylated by ATR in response to hypoxia and ATM in response to reoxygenation. J Biol Chem 278: 12207–12213, 2003.[Abstract/Free Full Text]
  31. Haupt Y, Maya R, Kazaz A, and Oren M. Mdm2 promotes the rapid degradation of p53. Nature 387: 296–299, 1997.[CrossRef][Medline]
  32. Haupt Y, Robles AI, Prives C, and Rotter V. Deconstruction of p53 functions and regulation. Oncogene 21: 8223–8231, 2002.[CrossRef][Medline]
  33. Herr I and Debatin KM. Cellular stress response and apoptosis in cancer therapy. Blood 98: 2603–2614, 2001.[Abstract/Free Full Text]
  34. Higuchi R, Fockler C, Dollinger G, and Watson R. Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Biotechnology (NY) 11: 1026–1030, 1993.
  35. Holst K, Andersen E, Philip J, and Henningsen I. Antenatal and perinatal conditions correlated to handicap among 4-year-old children. Am J Perinatol 6: 258–267, 1989.[Web of Science][Medline]
  36. Honma H, Gross L, and Windebank AJ. Hypoxia-induced apoptosis of dorsal root ganglion neurons is associated with DNA damage recognition and cell cycle disruption in rats. Neurosci Lett 354: 95–98, 2004.[CrossRef][Web of Science][Medline]
  37. Hupp TR, Meek DW, Midgley CA, and Lane DP. Regulation of the specific DNA binding function of p53. Cell 71: 875–886, 1992.[CrossRef][Web of Science][Medline]
  38. Jiang Y, Yang W, Zhou Y, and Ma L. Up-regulation of murine double minute clone 2 (MDM2) gene expression in rat brain after morphine, heroin, and cocaine administrations. Neurosci Lett 352: 216–220, 2003.[CrossRef][Web of Science][Medline]
  39. Jin S and Levine AJ. The p53 functional circuit. J Cell Sci 114: 4139–4140, 2001.[Free Full Text]
  40. Juven T, Barak Y, Zauberman A, George DL, and Oren M. Wild type p53 can mediate sequence-specific transactivation of an internal promoter within the mdm2 gene. Oncogene 8: 3411–3416, 1993.[Web of Science][Medline]
  41. Keller DM, Zeng X, Wang Y, Zhang QH, Kapoor M, Shu H, Goodman R, Lozano G, Zhao Y, and Lu H. A DNA damage-induced p53 serine 392 kinase complex contains CK2, hSpt16, and SSRP1. Mol Cell 7: 283–292, 2001.[CrossRef][Web of Science][Medline]
  42. Kim SJ, Hwang SG, Shin DY, Kang SS, and Chun JS. p38 Kinase regulates nitric oxide-induced apoptosis of articular chondrocytes by accumulating p53 via NF{kappa}B-dependent transcription and stabilization by serine 15 phosphorylation. J Biol Chem 277: 33501–33508, 2002.[Abstract/Free Full Text]
  43. Kloesz JL, Serdikoff CM, Maclennan NK, Adibi SA, and Lane RH. Uteroplacental insufficiency alters liver and skeletal muscle branched-chain amino acid metabolism in intrauterine growth-restricted fetal rats. Pediatr Res 50: 604–610, 2001.[Web of Science][Medline]
  44. Landers JE, Cassel SL, and George DL. Translational enhancement of mdm2 oncogene expression in human tumor cells containing a stabilized wild-type p53 protein. Cancer Res 57: 3562–3568, 1997.[Abstract/Free Full Text]
  45. Lane RH, Chandorkar AK, Flozak AS, and Simmons RA. Intrauterine growth retardation alters mitochondrial gene expression and function in fetal and juvenile rat skeletal muscle. Pediatr Res 43: 563–570, 1998.[Web of Science][Medline]
  46. Lane RH, Crawford SE, Flozak AS, and Simmons RA. Localization and quantification of glucose transporters in liver of growth-retarded fetal and neonatal rats. Am J Physiol Endocrinol Metab 276: E135–E142, 1999.[Abstract/Free Full Text]
  47. Lane RH, Dvorak B, MacLennan NK, Dvorakova K, Halpern MD, Pham TD, and Philipps AF. IGF alters jejunal glucose transporter expression and serum glucose levels in immature rats. Am J Physiol Regul Integr Comp Physiol 283: R1450–R1460, 2002.[Abstract/Free Full Text]
  48. Lane RH, Flozak AS, Ogata ES, Bell GI, and Simmons RA. Altered hepatic gene expression of enzymes involved in energy metabolism in the growth-retarded fetal rat. Pediatr Res 39: 390–394, 1996.[Web of Science][Medline]
  49. Lane RH, Kelley DE, Gruetzmacher EM, and Devaskar SU. Uteroplacental insufficiency alters hepatic fatty acid-metabolizing enzymes in juvenile and adult rats. Am J Physiol Regul Integr Comp Physiol 280: R183–R190, 2001.[Abstract/Free Full Text]
  50. Lane RH, Kelley DE, Ritov VH, Tsirka AE, and Gruetzmacher EM. Altered expression and function of mitochondrial {beta}-oxidation enzymes in juvenile intrauterine-growth-retarded rat skeletal muscle. Pediatr Res 50: 83–90, 2001.[Web of Science][Medline]
  51. Lane RH, MacLennan NK, Daood MJ, Hsu JL, Janke SM, Pham TD, Puri AR, and Watchko JF. IUGR alters postnatal rat skeletal muscle peroxisome proliferator-activated receptor-{gamma} coactivator-1 gene expression in a fiber specific manner. Pediatr Res 53: 994–1000, 2003.[CrossRef][Web of Science][Medline]
  52. Lane RH, MacLennan NK, Hsu JL, Janke SM, and Pham TD. Increased hepatic peroxisome proliferator-activated receptor-{gamma} coactivator-1 gene expression in a rat model of intrauterine growth retardation and subsequent insulin resistance. Endocrinology 143: 2486–2490, 2002.[Abstract/Free Full Text]
  53. Lane RH, MacLennan NK, Shi T, Fang CT, Chiu CT, and Horvath S. IUGR affects postnatal hepatic gene expression of enzymes involved in sterol synthesis in 21-day-old rats (Abstract). Pediatr Res 53: 149A, 2003.
  54. Lane RH, Ramirez RJ, Tsirka AE, Kloesz JL, McLaughlin MK, Gruetzmacher EM, and Devaskar SU. Uteroplacental insufficiency lowers the threshold towards hypoxia-induced cerebral apoptosis in growth-retarded fetal rats. Brain Res 895: 186–193, 2001.[CrossRef][Web of Science][Medline]
  55. Lane RH, Tsirka AE, and Gruetzmacher EM. Uteroplacental insufficiency alters cerebral mitochondrial gene expression and DNA in fetal and juvenile rats. Pediatr Res 47: 792–797, 2000.[Web of Science][Medline]
  56. Lee JS, Han YM, Yoo do S, Choi SJ, Choi BH, Kim JH, Kim YH, Huh PW, Ko YJ, Rha HK, Cho KS, and Kim DS. A molecular basis for the efficacy of magnesium treatment following traumatic brain injury in rats. J Neurotrauma 21: 549–561, 2004.[CrossRef][Web of Science][Medline]
  57. Low JA, Handley-Derry MH, Burke SO, Peters RD, Pater EA, Killen HL, and Derrick EJ. Association of intrauterine fetal growth retardation and learning deficits at age 9 to 11 years. Am J Obstet Gynecol 167: 1499–1505, 1992.[Web of Science][Medline]
  58. MacLennan NK, James SJ, Melnyk S, Piroozi A, Jernigan S, Hsu JL, Janke SM, Pham TD, and Lane RH. Uteroplacental insufficiency alters DNA methylation, one-carbon metabolism, and histone acetylation in IUGR rats. Physiol Genomics 18: 43–50, 2004.[Abstract/Free Full Text]
  59. Mallard C, Loeliger M, Copolov D, and Rees S. Reduced number of neurons in the hippocampus and the cerebellum in the postnatal guinea-pig following intrauterine growth-restriction. Neuroscience 100: 327–333, 2000.[CrossRef][Web of Science][Medline]
  60. Mallard EC, Rehn A, Rees S, Tolcos M, and Copolov D. Ventriculomegaly and reduced hippocampal volume following intrauterine growth-restriction: implications for the aetiology of schizophrenia. Schizophr Res 40: 11–21, 1999.[CrossRef][Web of Science][Medline]
  61. Maneru C, Serra-Grabulosa JM, Junque C, Salgado-Pineda P, Bargallo N, Olondo M, Botet-Mussons F, Tallada M, and Mercader JM. Residual hippocampal atrophy in asphyxiated term neonates. J Neuroimaging 13: 68–74, 2003.[CrossRef][Medline]
  62. Marchenko ND, Zaika A, and Moll UM. Death signal-induced localization of p53 protein to mitochondria. A potential role in apoptotic signaling. J Biol Chem 275: 16202–16212, 2000.[Abstract/Free Full Text]
  63. Mayo LD and Donner DB. A phosphatidylinositol 3-kinase/Akt pathway promotes translocation of Mdm2 from the cytoplasm to the nucleus. Proc Natl Acad Sci USA 98: 11598–11603, 2001.[Abstract/Free Full Text]
  64. Menon RK, Shaufl A, Yu JH, Stephan DA, and Friday RP. Identification and characterization of a novel transcript of the murine growth hormone receptor gene exhibiting development- and tissue-specific expression. Mol Cell Endocrinol 172: 135–146, 2001.[CrossRef][Web of Science][Medline]
  65. Milczarek GJ, Martinez J, and Bowden GT. p53 Phosphorylation: biochemical and functional consequences. Life Sci 60: 1–11, 1997.[CrossRef][Web of Science][Medline]
  66. Momand J, Zambetti GP, Olson DC, George D, and Levine AJ. The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation. Cell 69: 1237–1245, 1992.[CrossRef][Web of Science][Medline]
  67. Novack DV and Korsmeyer SJ. Bcl-2 protein expression during murine development. Am J Pathol 145: 61–73, 1994.[Abstract]
  68. Ogata ES, Bussey ME, and Finley S. Altered gas exchange, limited glucose and branched chain amino acids, and hypoinsulinism retard fetal growth in the rat. Metabolism 35: 970–977, 1986.[CrossRef][Web of Science][Medline]
  69. Ogata ES, Bussey ME, LaBarbera A, and Finley S. Altered growth, hypoglycemia, hypoalaninemia, and ketonemia in the young rat: postnatal consequences of intrauterine growth retardation. Pediatr Res 19: 32–37, 1985.[Web of Science][Medline]
  70. Ogata ES, Swanson SL, Collins JW Jr, and Finley SL. Intrauterine growth retardation: altered hepatic energy and redox states in the fetal rat. Pediatr Res 27: 56–63, 1990.[Web of Science][Medline]
  71. Parra M, Jardi M, Koziczak M, Nagamine Y, and Munoz-Canoves P. p53 Phosphorylation at serine 15 is required for transcriptional induction of the plasminogen activator inhibitor-1 (PAI-1) gene by the alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine. J Biol Chem 276: 36303–36310, 2001.[Abstract/Free Full Text]
  72. Pham TD, MacLennan NK, Chiu CT, Laksana GS, Hsu JL, and Lane RH. Uteroplacental insufficiency increases apoptosis and alters p53 gene methylation in the full-term IUGR rat kidney. Am J Physiol Regul Integr Comp Physiol 285: R962–R970, 2003.[Abstract/Free Full Text]
  73. Pulera MR, Adams LM, Liu H, Santos DG, Nishimura RN, Yang F, Cole GM, and Wasterlain CG. Apoptosis in a neonatal rat model of cerebral hypoxia-ischemia. Stroke 29: 2622–2630, 1998.[Abstract/Free Full Text]
  74. Schneiderhan N, Budde A, Zhang Y, and Brune B. Nitric oxide induces phosphorylation of p53 and impairs nuclear export. Oncogene 22: 2857–2868, 2003.[CrossRef][Web of Science][Medline]
  75. Schuler M and Green DR. Mechanisms of p53-dependent apoptosis. Biochem Soc Trans 29: 684–688, 2001.[CrossRef][Web of Science][Medline]
  76. Shieh SY, Ikeda M, Taya Y, and Prives C. DNA damage-induced phosphorylation of p53 alleviates inhibition by MDM2. Cell 91: 325–334, 1997.[CrossRef][Web of Science][Medline]
  77. Sidhu RS, Tuor UI, and Del Bigio MR. Nuclear condensation and fragmentation following cerebral hypoxia-ischemia occurs more frequently in immature than older rats. Neurosci Lett 223: 129–132, 1997.[CrossRef][Web of Science][Medline]
  78. Simmons RA, Templeton LJ, and Gertz SJ. Intrauterine growth retardation leads to the development of type 2 diabetes in the rat. Diabetes 50: 2279–2286, 2001.[Abstract/Free Full Text]
  79. Spinillo A, Capuzzo E, Egbe TO, Fazzi E, Colonna L, and Nicola S. Pregnancies complicated by idiopathic intrauterine growth retardation. Severity of growth failure, neonatal morbidity and two-year infant neurodevelopmental outcome. J Reprod Med 40: 209–215, 1995.[Web of Science][Medline]
  80. Steegenga WT, van der Eb AJ, and Jochemsen AG. How phosphorylation regulates the activity of p53. J Mol Biol 263: 103–113, 1996.[CrossRef][Web of Science][Medline]
  81. Tagami M, Yamagata K, Ikeda K, Fujino H, Nara Y, Nakagawa K, Kubota A, Numano F, and Yamori Y. Genetic vulnerability of cortical neurons isolated from stroke-prone spontaneously hypertensive rats in hypoxia and oxygen reperfusion. Hypertens Res 22: 23–29, 1999.[Web of Science][Medline]
  82. Tsirka AE, Gruetzmacher EM, Kelley DE, Ritov VH, Devaskar SU, and Lane RH. Myocardial gene expression of glucose transporter 1 and glucose transporter 4 in response to uteroplacental insufficiency in the rat. J Endocrinol 169: 373–380, 2001.[Abstract]
  83. Tu Y, Hou ST, Huang Z, Robertson GS, and MacManus JP. Increased Mdm2 expression in rat brain after transient middle cerebral artery occlusion. J Cereb Blood Flow Metab 18: 658–669, 1998.[CrossRef][Web of Science][Medline]
  84. Unger T, Sionov RV, Moallem E, Yee CL, Howley PM, Oren M, and Haupt Y. Mutations in serines 15 and 20 of human p53 impair its apoptotic activity. Oncogene 18: 3205–3212, 1999.[CrossRef][Web of Science][Medline]
  85. Unterman TG, Simmons RA, Glick RP, and Ogata ES. Circulating levels of insulin, insulin-like growth factor-I (IGF-I), IGF-II, and IGF-binding proteins in the small for gestational age fetal rat. Endocrinology 132: 327–336, 1993.[Abstract/Free Full Text]
  86. Valcamonico A, Danti L, Frusca T, Soregaroli M, Zucca S, Abrami F, and Tiberti A. Absent end-diastolic velocity in umbilical artery: risk of neonatal morbidity and brain damage. Am J Obstet Gynecol 170: 796–801, 1994.[Web of Science][Medline]
  87. Vannucci RC, Connor JR, Mauger DT, Palmer C, Smith MB, Towfighi J, and Vannucci SJ. Rat model of perinatal hypoxic-ischemic brain damage. J Neurosci Res 55: 158–163, 1999.[CrossRef][Web of Science][Medline]
  88. Vexler ZS, Roberts TP, Bollen AW, Derugin N, and Arieff AI. Transient cerebral ischemia. Association of apoptosis induction with hypoperfusion. J Clin Invest 99: 1453–1459, 1997.[Web of Science][Medline]
  89. Villar J, de Onis M, Kestler E, Bolanos F, Cerezo R, and Bernedes H. The differential neonatal morbidity of the intrauterine growth retardation syndrome. Am J Obstet Gynecol 163: 151–157, 1990.[Web of Science][Medline]
  90. Vossbeck S, de Camargo OK, Grab D, Bode H, and Pohlandt F. Neonatal and neurodevelopmental outcome in infants born before 30 weeks of gestation with absent or reversed end-diastolic flow velocities in the umbilical artery. Eur J Pediatr 160: 128–134, 2001.[CrossRef][Web of Science][Medline]
  91. Wadgaonkar R and Collins T. Murine double minute (MDM2) blocks p53-coactivator interaction, a new mechanism for inhibition of p53-dependent gene expression. J Biol Chem 274: 13760–13767, 1999.[Abstract/Free Full Text]
  92. Walther FJ. Growth and development of term disproportionate small-for-gestational age infants at the age of 7 years. Early Hum Dev 18: 1–11, 1988.[CrossRef][Web of Science][Medline]
  93. Wang X, Zalcenstein A, and Oren M. Nitric oxide promotes p53 nuclear retention and sensitizes neuroblastoma cells to apoptosis by ionizing radiation. Cell Death Differ 10: 468–476, 2003.[CrossRef][Web of Science][Medline]
  94. Williams MC and O'Brien WF. Low weight/length ratio to assess risk of cerebral palsy and perinatal mortality in twins. Am J Perinatol 15: 225–228, 1998.[Web of Science][Medline]
  95. Witlin AG and Sibai BM. Hypertension in pregnancy: current concepts of preeclampsia. Annu Rev Med 48: 115–127, 1997.[CrossRef][Web of Science][Medline]
  96. Yue X, Mehmet H, Penrice J, Cooper C, Cady E, Wyatt JS, Reynolds EO, Edwards AD, and Squier MV. Apoptosis and necrosis in the newborn piglet brain following transient cerebral hypoxia-ischaemia. Neuropathol Appl Neurobiol 23: 16–25, 1997.[CrossRef][Web of Science][Medline]
  97. Zhou BP, Liao Y, Xia W, Zou Y, Spohn B, and Hung MC. HER-2/neu induces p53 ubiquitination via Akt-mediated MDM2 phosphorylation. Nat Cell Biol 3: 973–982, 2001.[CrossRef][Web of Science][Medline]
  98. Zhu Y, Mao XO, Sun Y, Xia Z, and Greenberg DA. p38 Mitogen-activated protein kinase mediates hypoxic regulation of Mdm2 and p53 in neurons. J Biol Chem 277: 22909–22914, 2002.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. E. Schober, R. A. McKnight, X. Yu, C. W. Callaway, X. Ke, and R. H. Lane
Intrauterine growth restriction due to uteroplacental insufficiency decreased white matter and altered NMDAR subunit composition in juvenile rat hippocampi
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2009; 296(3): R681 - R692.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
B. Reyburn, M. Li, D. B. Metcalfe, N. J. Kroll, J. Alvord, A. Wint, M. J. Dahl, J. Sun, L. Dong, Z.-m. Wang, et al.
Nasal Ventilation Alters Mesenchymal Cell Turnover and Improves Alveolarization in Preterm Lambs
Am. J. Respir. Crit. Care Med., August 15, 2008; 178(4): 407 - 418.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. A. O'Brien, V. Barnes, L. Zhao, R. A. McKnight, X. Yu, C. W. Callaway, L. Wang, J. C. Sun, M. J. Dahl, A. Wint, et al.
Uteroplacental insufficiency decreases p53 serine-15 phosphorylation in term IUGR rat lungs
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2007; 293(1): R314 - R322.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Baserga, M. A. Hale, X. Ke, Z. M. Wang, X. Yu, C. W. Callaway, R. A. McKnight, and R. H. Lane
Uteroplacental insufficiency increases p53 phosphorylation without triggering the p53-MDM2 functional circuit response in the IUGR rat kidney
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2006; 291(2): R412 - R418.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
X. Ke, Q. Lei, S. J. James, S. L. Kelleher, S. Melnyk, S. Jernigan, X. Yu, L. Wang, C. W. Callaway, G. Gill, et al.
Uteroplacental insufficiency affects epigenetic determinants of chromatin structure in brains of neonatal and juvenile IUGR rats
Physiol Genomics, March 13, 2006; 25(1): 16 - 28.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/4/R1038    most recent
00701.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ke, X.
Right arrow Articles by Lane, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ke, X.
Right arrow Articles by Lane, R. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.