AJP - Regu Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 290: R963-R972, 2006. First published December 8, 2005; doi:10.1152/ajpregu.00684.2005
0363-6119/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/4/R963    most recent
00684.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lang, C. H.
Right arrow Articles by Frost, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lang, C. H.
Right arrow Articles by Frost, R. A.

INFLAMMATION AND CYTOKINES

Sepsis and inflammatory insults downregulate IGFBP-5, but not IGFBP-4, in skeletal muscle via a TNF-dependent mechanism

Charles H. Lang,1,2 Brian J. Krawiec,1 Danuta Huber,1 Jennifer M. McCoy,1 and Robert A. Frost1

1Departments of Cellular and Molecular Physiology, and 2Surgery, Pennsylvania State University College of Medicine, Hershey, Pennsylvania

Submitted 21 September 2005 ; accepted in final form 3 December 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The purpose of the present study was to determine whether catabolic stimuli that induce muscle atrophy alter the muscle mRNA abundance of insulin-like growth factor binding protein (IGFBP)-4 and -5, and if so determine the physiological mechanism for such a change. Catabolic insults produced by endotoxin (LPS) and sepsis decreased IGFBP-5 mRNA time- and dose-dependently in gastrocnemius muscle. This reduction did not result from muscle disuse because hindlimb immobilization increased IGFBP-5. Continuous infusion of a nonlethal dose of tumor necrosis factor-{alpha} (TNF-{alpha}) decreased IGFBP-5 mRNA 70%, whereas pretreatment of septic rats with a neutralizing TNF binding protein completely prevented the reduction in muscle IGFBP-5. The addition of LPS or TNF-{alpha} to cultured C2C12 myoblasts also decreased IGFBP-5 expression. Although exogenously administered growth hormone (GH) increased IGFBP-5 mRNA 2-fold in muscle from control rats, muscle from septic animals was GH resistant and no such elevation was detected. In contrast, exogenous administration of IGF-I as part of a binary complex composed of IGF-I/IGFBP-3 produced comparable increases in IGFBP-5 mRNA in both control and septic muscle. Concomitant determinations of IGF-I mRNA content revealed a positive linear relationship between IGF-I and IGFBP-5 mRNA in the same muscle in response to LPS, sepsis, TNF-{alpha}, and GH treatment. Although dexamethasone decreased muscle IGFBP-5, pretreatment of rats with the glucocorticoid receptor antagonist RU486 did not prevent the sepsis-induced decrease in IGFBP-5 mRNA. In contrast, muscle IGFBP-4 mRNA abundance was not significantly altered by LPS, sepsis, or hindlimb immobilization. In summary, these data demonstrate that various inflammatory insults decrease muscle IGFBP-5 mRNA, without altering IGFBP-4, by a TNF-dependent glucocorticoid-independent mechanism. Finally, IGF-I appears to be a dominant positive regulator of IGFBP-5 gene expression in muscle under both normal and catabolic conditions.

endotoxin; insulin-like growth factor binding protein-3/insulin-like growth factor-I binary complex; glucocorticoids; rats


IN CONTRAST TO MANY PEPTIDE hormones, the majority of insulin-like growth factor (IGF)-I present in body fluids is bound to one of six structurally related high-affinity binding proteins [e.g., insulin growth factor binding proteins (IGFBPs)]. These proteins can modulate bioavailability either positively or negatively and, in some instances, have IGF-independent effects (44). The synthesis and secretion of individual IGFBPs is exquisitely regulated in a tissue- and hormone-specific manner. As a result of the dramatic and often sustained increase in insulin, corticosteroids, and inflammatory cytokines, catabolic injury leads to marked alterations in the concentration of several IGFBPs in the blood and various tissues (16, 36). In this regard, the large majority of available data pertains to the marked increase in IGFBP-1 and the frequent decrease in IGFBP-3 that characterizes the catabolic response. In contrast, the stress-induced changes in the other IGFBPs have remained largely uncharacterized.

IGFBP-5 is the most conserved gene of the IGFBP family and is the predominant IGFBP synthesized by differentiated skeletal muscle (23, 29). Numerous studies implicate changes in IGFBP-5 as a potentially important regulator of proliferation and differentiation in several cell types, including myoblasts (12, 30), although the stimulatory or inhibitory nature of its actions is, in part, dependent upon the cell type, culture conditions, and/or the end point determined (49). Importantly, in vivo overexpression of IGFBP-5 in mice leads to a dose-dependent decrease in whole body growth and a disproportionate reduction in skeletal muscle mass (46). Such a response is consistent with the ability of IGFBP-5 to inhibit IGF-I bioactivity (12, 30, 31, 50). However, the importance of a change in the endogenous IGFBP-5 concentration within the physiological range on muscle mass remains to be assessed. Conditions resulting in muscle atrophy (e.g., unloading or denervation) have been reported to increase IGFBP-5 mRNA (1, 4, 5), whereas conditions that produce muscle hypertrophy decrease IGFBP-5 mRNA in muscle (1, 2, 25). In contrast, the inflammatory cytokines IL-1 and IL-6, whose overexpression leads to muscle wasting, increase IGFBP-5 mRNA expression in bone cells (15, 53). Furthermore, catabolic insults dramatically alter the circulating concentration and/or tissue responsiveness to various hormones, such as IGF-I, glucocorticoids, and growth hormone (GH), that might be expected to regulate IGFBP-5 expression (49). Therefore, on the basis of the paucity of existing information, our current studies investigated how the actions of these various potential mediators are integrated in vivo to regulate IGFBP-5 mRNA in a physiologically important tissue—skeletal muscle—under basal conditions and in response to catabolic stress. Moreover, because IGFBP-5 and IGFBP-4 have contrasting effects under some experimental conditions (1, 5, 59), we also determined whether the IGFBP-4 mRNA content of skeletal muscle was altered by these same catabolic insults.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animal preparation and experimental protocols. Adult specific pathogen-free male Sprague-Dawley rats (325–350 g; Charles River Breeding Laboratories, Cambridge, MA) were housed at a constant temperature, exposed to a 12:12-h light-dark cycle, and maintained on standard rodent chow and water ad libitum for at least 1 wk before experiments were performed. All experiments were reviewed and approved by the Animal Care and Use Committee at the Pennsylvania State University College of Medicine and adhered to the National Institutes of Health guidelines for the care and use of experimental animals.

The following animal protocols were used: For protocol 1, Escherichia coli LPS (026:B6, Sigma Aldrich, St. Louis, MO) or an equal volume of saline [0.5 ml/100 g body wt (BW)] was injected intraperitoneally at doses ranging between 10 and 1,000 µg/kg BW), and the gastrocnemius muscle was sampled at various times thereafter (34). For protocol 2, rats were anesthetized with an intramuscular injection of ketamine and xylazine (90 and 9 mg/kg, respectively) for the in vivo infusion of TNF-{alpha}, and sterile surgery was performed to implant a catheter in the jugular vein. This catheter was passed through a tightly coiled stainless steel spring and fixed to a freely rotating swivel (Instech, Plymouth, PA). Recombinant human TNF-{alpha} (Amgen, Thousand Oaks, CA) was diluted in 0.1% human serum albumin and infused intravenously for the next 24 h at a rate of 5 mg·kg–1·h–1 (0.35 ml/h) (13, 37). Time-matched control animals were infused with an equal volume of vehicle. For protocol 3, we investigated disuse muscle atrophy in rats that were anesthetized with pentobarbital sodium and one hindlimb immobilized in a fiberglass cast (33). Briefly, the left hindlimb was shaved and wrapped in a protective layer of cast padding (Specialist brand; Johnson and Johnson, Raynham, MA). Multiple layers of fiberglass casting tape (3 M VetCast Plus veterinary casting tape; 3M, St. Paul, MN) were then applied and allowed to harden. The foot was positioned in plantar-flexion to induce maximal atrophy of the gastrocnemius. After casting, rats were resuscitated with 10 ml of 0.9% sterile saline administered subcutaneously. Previous studies indicate that the muscle from the contralateral noncasted limb is an appropriate control (33). In protocol 4, for the induction of sepsis, rats were anesthetized with pentobarbital sodium (50–60 mg/kg), and a midline laparotomy was performed (27, 35). The cecum was ligated at its base and punctured twice with a 20-gauge needle. The cecum was then returned to the peritoneal cavity and the muscle and skin layers were closed. Rats were resuscitated with 10 ml of 0.9% sterile saline administered subcutaneously. Nonseptic control animals were subjected to a midline laparotomy with intestinal manipulation and then resuscitated with the same volume of saline. In some studies, control and septic rats were treated with either TNF-binding protein (TNFBP), an antagonist of TNF{alpha} action (1 mg/kg; Amgen, Boulder, CO), or an equivalent volume (1 ml/rat) of vehicle. The dose and timing of this synthetic TNF antagonist are based on data demonstrating its ability to prevent the sepsis-induced loss of muscle mass and GH resistance (58). In additional studies, control and septic rats were treated with recombinant human GH (500 µg/kg Serostim; Sorono Laboratories, Norwell, MA) or an equal volume (250 µl) of vehicle at time 0 and 12 h. This protocol has been demonstrated to increase the plasma IGF-I concentration of control rats 12 h after the final injection (27). In a separate study, control and septic rats were treated twice daily (0900 and 1800; 5 µg/g BW) with recombinant human binary complex (Insmed, San José, CA) injected via a tail vein. The dose and time of the binary complex administration were selected on the basis of previous studies by our laboratory, indicating this agent is capable of preventing decreases in muscle protein synthesis (54). For protocol 5, to determine whether an elevation in the plasma glucocorticoid concentration could alter muscle IGFBP-5 mRNA in control animals, a separate group of rats was injected subcutaneously with dexamethasone (100 µg/100 g BW; Sigma) or with an equal volume (0.5 ml/rat) of vehicle. This dose of dexamethasone decreases muscle protein synthesis and induces muscle wasting (47). Gastrocnemius was sampled at 4 h and 24 h after injection of dexamethasone. Additionally, to assess the importance of endogenously produced glucocorticoids, control and septic rats were injected subcutaneously with the glucocorticoid receptor antagonist RU486 (Mifepristone; 20 mg/kg BW; Sigma) or an equal volume (0.3 ml) of vehicle 2 h before induction of peritonitis. RU486 is an antiprogestin with antiglucocorticoid properties. RU486 has a high affinity for cytosolic type II glucocorticoid receptors in various target tissues and exhibits little agonist activity (40). The dose of RU486 used in the present study has been shown to attenuate glucocorticoid-induced increases in catabolism and ameliorate endotoxin- or cytokine-induced changes in the IGF system and muscle protein balance (14, 39, 60).

Data for each of the catabolic insults was compared with data from appropriate time-matched control animals that were pair-fed to match the food consumption of the catabolic group.

In vitro studies. The C2C12 mouse myoblast cell line used for all studies was purchased from American Type Culture Collection (Manassas, VA). Cells were grown in 100-mm dishes (Becton Dickinson, Franklin Lakes, NJ) and cultured in MEM containing 10% bovine calf serum (BCS), penicillin (100 U/ml), streptomycin (100 µg/ml), and amphotericin (25 µg/ml; all from Sigma), as previously described (17, 1921). Cells were grown to confluence and treated with either LPS (1 µg/ml in BCS), TNF-{alpha} (40 ng/ml in serum-free MEM) or the synthetic glucocorticoid dexamethasone (10 µM in serum-free MEM), and cells were collected at various times thereafter. Most studies used C2C12 cells at the myoblast stage, but in selected experiments cells were switched to medium containing 2% serum and allowed to differentiate into multinucleated myotubes (21).

Analytical procedures. Total RNA was isolated from rat tissues and cells using TRI Reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer's protocol. Samples of total RNA (25 µg) were run under denaturing conditions in 1.1% agarose/6% formaldehyde gels using 1x HEPES running buffer. Northern blotting occurred via capillary transfer to Nytran SuPerCharge membranes (Schleicher & Schuell, Keene, NH). A rat oligonucleotide for IGFBP-5 (5'GCAGCGCTCAGTGTAGACGCCACACGACTGTCCCTCCGCC 3') was synthesized (IDT, Coralville, IA) and radioactively labeled using TdT (Promega, Madison, WI). For normalization of RNA loading, an 18S oligonucleotide was labeled by the same method. Northern blots were hybridized using ULTRAhyb (Ambion, Austin, TX). All membranes were initially washed twice in 2x SSC/0.1% SDS for 5 min at 42°C and once in 0.2x SSC/0.1% SDS for 15 min at 42°C. All probes, except 18S, were additionally washed with 0.2x SSC/0.1% SDS for 10 min at 48°C. Finally, membranes were exposed to a PhosphorImager screen (Molecular Dynamics, Sunnyvale, CA), and the resultant data were quantified using Molecular Dynamics's ImageQuant software.

In select studies, the muscle IGF-I and IGFBP-4 mRNA content was also determined by Northern blot analysis. A 800 bp cDNA from rat IGF-I (Peter Rotwein, St. Louis, MO) and a 444 bp cDNA from rat IGFBP-4 (Shunichi Shimasaki, San Diego, CA) were labeled using a Random Primed DNA Labeling Kit (Roche Molecular Biochemicals, Indianapolis, IN), and processed and analyzed as described above for IGFBP-5.

TNF mRNA was determined by RiboQuant Multi-probe RNase Protection Assay (BD PharMingen). Riboprobes were hybridized with 20 µg total RNA per the manufacturer's protocol, and protected RNAs were separated by electrophoresis on vertical 5% acrylamide gels. Each gel was dried and exposed to a PhosphorImager screen as outlined above. Data were analyzed using ImageQuant software and normalized to L32 mRNA.

The concentration of total IGF-I in plasma was determined by RIA after samples were extracted using a modified acid-ethanol (0.25 N HCl, 87.5% ethanol) procedure with cryoprecipitation (13, 14, 35, 37). The plasma concentration of rat TNF-{alpha} was measured using a solid-phase sandwich enzyme linked-immunosorbent assay (Biosource International, Camarillo, CA).

Statistical analysis. The sample size for each condition is indicated in the figure captions, and experimental data are summarized as means ± SE. In studies with two groups, data were analyzed using a two-tailed pooled Student's t-test. Statistical evaluation of the data from studies with three or more groups was performed using ANOVA followed by Student-Neuman-Keuls test to determine treatment effect (Instat, San Diego, CA). Differences between the groups were considered significant when P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
LPS- and sepsis-induced changes in gastrocnemius IGFBP-5 and IGFBP-4 mRNA. The intraperitoneal injection of LPS (100 µg/kg BW) produced a relatively sustained decrease in the IGFBP-5 mRNA content of gastrocnemius muscle (Fig. 1A). Expression was significantly reduced by 40–45% between 4–12 h post-LPS, compared with time-matched control values. When muscle was examined at the 8-h time point, the LPS-induced decrease in IGFBP-5 was shown to be dose-dependent and appeared maximally depressed at 100 µg/kg (Fig. 1, B and C). We and others have previously reported that C2C12 myocytes are responsive to LPS and cytokines (6, 1921, 52). Therefore, to determine whether LPS might directly effect muscle IGFBP-5 mRNA abundance, C2C12 myoblasts were incubated for various periods of time with LPS. As illustrated in Fig. 1D, cultured C2C12 myoblasts also responded to LPS with a significant reduction in IGFBP-5 mRNA by 6 h and that the effect is sustained between 24 and 48 h. In vitro addition of LPS also decreased IGFBP-5 mRNA content in C2C12 cells that had been differentiated to a point at which they formed multinucleated myotubes, and this decrease was comparable to that seen in myoblasts (data not shown).


Figure 1
View larger version (42K):
[in this window]
[in a new window]
 
Fig. 1. Time- and dose-responsiveness of insulin-like growth factor binding protein (IGFBP)-5 mRNA to endotoxin (LPS) in muscle. A: time course of changes in IGFBP-5 mRNA in gastrocnemius muscle isolated from rats injected with 100 µg/kg of Escherichia coli LPS. Values are expressed as means ± SE; n = 5 or 6 rats per group. B: LPS dose-dependent decrease in gastrocnemius IGFBP-5 mRNA abundance. In this study, muscle was sampled 8 h after in vivo injection of LPS. Values are expressed as means ± SE; n = 6–8 rats per group. *P < 0.05, compared with time-matched control value. C: representative Northern blot analysis of IGFBP-5 and IGFBP-4 mRNA in gastrocnemius muscle from rats treated with different doses of LPS. D: represents LPS-induced changes in IGFBP-5 mRNA content in C2C12 myoblasts. Myocytes were cultured in MEM in the absence and presence of either LPS (1 µg/ml) and cells collected at various times thereafter. Values are means ± SE; n = 3 wells of cells repeated 3 or 4 separate times. *P < 0.05, compared with time-matched control values. For all data, IGFBP-5 mRNA abundance was expressed in arbitrary units (AUs) as determined by densitometry and normalized to 18S mRNA.

 
The same muscle samples used to generate the data presented in Fig. 1 were reprobed to assess concomitant changes in IGFBP-4. However, when compared with time-matched control values, no statistically significant change in IGFBP-4 mRNA was detected at any time point examined after injection of LPS (Fig. 1C and data not shown). Additional analyses of other components of the IGF system (e.g., plasma and tissue content of IGF-I and selected IGFBPs) are not included in the current study but have been previously reported by our laboratory (16).

It is recognized that LPS may not faithfully reproduce some of the metabolic changes produced by polymicrobial infection (9). Therefore, we also measured the IGFBP-5 mRNA content in gastrocnemius from rats at various times after induction of peritonitis by cecal ligation and puncture (CLP; Fig. 2). Muscle IGFBP-5 was significantly decreased at 8 h (25%) and remained lower than time-matched control values between 12 and 24 h (45–50%). In contrast, Northern blot analysis of muscle IGFBP-4 abundance revealed no significant difference between control and septic rats (data not shown). As a positive control, 24 h after induction of sepsis, IGFBP-4 mRNA content was elevated more than twofold in liver (control = 1.00 ± 0.09 AU/18S vs. septic 2.33 ± 0.31 AU/18S; P < 0.05).


Figure 2
View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2. Effect of polymicrobial sepsis on muscle IGFBP-5 mRNA content. Data are from the gastrocnemius collected at various times after induction of sepsis by cecal ligation and puncture (CLP). IGFBP-5 mRNA abundance is expressed in AUs determined by densitometry and normalized to 18S mRNA. All values are means ± SE; n = 7 or 8 rats per group. *P < 0.05, compared with time-matched control value.

 
Regulatory role of TNF-{alpha} on IGFBP-5 mRNA. The inflammatory cytokine TNF-{alpha} mediates many of the metabolic and immunological changes produced by LPS and sepsis (26). The CLP model of sepsis used in the current study increased the plasma TNF-{alpha} concentration, peaking at 4 h and returning toward basal levels by 24 h (Fig. 3A). However, even at this latter time point, TNF-{alpha} concentrations were elevated compared with control values that were consistently below the limit of detection for the assay (<15 pg/ml). Sepsis also increased the TNF-{alpha} mRNA content in skeletal muscle Fig. 3B). Again, the response peaked at the 4 h time point, but the average TNF-{alpha} mRNA content of muscle sampled at 12–24 h after induction of sepsis was still significantly elevated 3.5-fold, compared with time-matched control samples (Control = 1.00 ± 0.11 AU/L32 vs. Septic = 3.55 ± 0.44 AU/L32). Conversely, the plasma concentration of total IGF-I and muscle IGF-I mRNA content was gradually reduced by sepsis (Fig. 3, C and D, respectively). At the 24-h time point, the plasma IGF-I concentration was reduced by 36%, and the muscle IGF-I mRNA content decreased 60% (Control = 1.00 ± 0.09 AU/18S vs. Septic = 0.38 ± 0.12 AU/18S).


Figure 3
View larger version (35K):
[in this window]
[in a new window]
 
Fig. 3. Effect of sepsis on plasma and muscle tumor necrosis factor-{alpha} (TNF-{alpha}) and insulin-like growth factor-I (IGF-I). Sepsis was induced by CLP, and rats were killed at the indicated time points for collection of blood and gastrocnemius. Both line graphs represent means ± SE, where n = 7 or 8 rats per group. *P < 0.05 compared with time-matched control values. A: plasma TNF-{alpha} concentration, as determined by ELISA, in control and septic rats. For control rats, the values were consistently below the limit of assay detection (<15 pg/ml). B: representative autoradiograph from a nuclease protection assay for TNF-{alpha} mRNA in gastrocnemius from three rats per time point. Although only three animals per group are shown, muscle from all rats was analyzed and quantified, and mean values are presented in the text. C: plasma total IGF-I concentration, as determined by RIA, for control and septic rats. D: representative Northern blot of muscle IGF-I mRNA from three control animals (24-h time point), as well as three septic rats at 2, 4, 8, 12, and 24 h postinfection. Three major IGF-I transcripts were visualized for both control and septic rats; one band at 7.5 kb, a second band at 1.7 kb, and a third broad band between 0.9 and 1.2 kb. However, because of its abundance, only the 7.5-kb band is shown and quantified. In general, the two smaller IGF-I transcripts responded similarly to the 7.5-kb band (data not shown). Ribosomal 18S RNA indicated that the amount of RNA loaded was similar for each lane. Muscles from all rats were analyzed and quantified, and where appropriate, the mean values are presented in the text.

 
On the basis of the above-mentioned data, indicating the continued presence of TNF-{alpha} in the blood and muscle throughout the septic insult, it was hypothesized that overexpression of this inflammatory cytokine mediated the sepsis-induced decrease in muscle IGFBP-5. To assess the ability of TNF-{alpha} per se to alter muscle IGFBP-5 mRNA, a separate group of rats was continuously infused with TNF-{alpha}. This infusion protocol elevates the circulating TNF-{alpha} concentration to levels comparable to those detected in septic rats (13). At the conclusion of the 24-h infusion, IGFBP-5 mRNA was decreased 70% (Fig. 4, top). Alterations in other components of the IGF system in response to this same TNF-{alpha} infusion protocol have been previously reported (13, 37). In addition, in vitro addition of TNF-{alpha} to C2C12 myoblasts (Fig. 4, middle) showed a time-dependent decrease in IGFBP-5 mRNA between 8 and 24 h, suggesting this cytokine could directly regulate expression of IGFBP-5. TNF-{alpha} also decreased IGFBP-5 mRNA in differentiated C2C12 myotubes (data not shown). Collectively, these data indicate that TNF-{alpha} is capable of producing changes in IGFBP-5 that are qualitatively similar to those seen in response to LPS and sepsis. However, they do not indicate that the endogenous overproduction of this cytokine is responsible for the decline observed under a specific inflammatory condition. To address this issue, rats were pretreated with TNFBP, which neutralizes endogenously produced TNF-{alpha}. Twenty-four hours after induction of sepsis, muscle IGFBP-5 mRNA content was reduced 55%, and this change was completely prevented in septic rats administered TNFBP (Fig. 4, bottom). TNFBP did not influence basal IGFBP-5 expression in muscle from control rats.


Figure 4
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 4. Role of TNF-{alpha} in regulating muscle IGFBP-5 mRNA content. Top: data from gastrocnemius of rats infused for 24 h with TNF-{alpha} or vehicle; values are expressed as means ± SE; n = 6–8 rats per group. *P < 0.05, compared with time-matched control value. Middle: TNF-{alpha}-induced changes in IGFBP-5 mRNA content in C2C12 myoblasts. Myocytes were cultured in the absence and presence of either TNF-{alpha} (40 ng/ml) and cells collected at various times thereafter. Values are means ± SE; n = 3 wells of cells repeated 3–4 separate times. *P < 0.05, compared with time-matched control values. Bottom: rats were injected with TNF-{alpha}-binding protein (TNFBP) 30 min before induction of sepsis by CLP or sham surgery (e.g., control); values are expressed as means ± SE; n = 7 or 8 rats per group. Values with different letters are significantly different (P < 0.05) from each other. For all data, IGFBP-5 mRNA abundance was expressed in AUs determined by densitometry and normalized to 18S mRNA.

 
Discordant regulation of IGFBP-5 mRNA by disuse atrophy. Sepsis, LPS, and cytokine excess would all be expected to decrease locomotive activity of animals. Hence, some or all of the aforementioned changes in muscle IGFBP-5 may be due to muscle disuse. To examine this possibility, rats had one hindlimb casted so as to induce a disuse atrophy, while the muscle of the contralateral leg acted as an internal control (33). In marked contrast to our observations in other catabolic states, disuse atrophy increased IGFBP-5 mRNA in gastrocnemius on both day 1 and day 3 of casting (Fig. 5). Previous studies have reported a statistically significant reduction in muscle weight of 8% and 19%, respectively, at these two time points, but no change in the muscle mRNA content for either IGF-I or TNF (33).


Figure 5
View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5. Hindlimb immobilization increases muscle IGFBP-5 mRNA content. Unilateral hindlimb casting was performed to induce disuse atrophy of the gastrocnemius. Muscle from the contralateral leg was used as the control. Muscle was sampled at either 1 or 3 days postcasting. Values are expressed as means ± SE; n = 8 or 9 rats per group. *P < 0.05, compared with time-matched contralateral control values. For all data, IGFBP-5 mRNA abundance was expressed in AUs determined by densitometry and normalized to 18S mRNA.

 
Hormonal regulation of muscle IGFBP-5. IGF-I increases IGFBP-5 mRNA under a variety of mostly in vitro experimental conditions (11, 12, 45), and data presented in Fig. 3 show that the sepsis-induced decrease in IGFBP-5 mRNA is temporally associated with a reduction in both the circulating concentration of IGF-I and tissue IGF-I mRNA content. Therefore, in vivo experimental protocols were used that either increased IGF-I indirectly (e.g., GH administration) or directly (e.g., injection of binary complex). Data presented in Fig. 6A illustrate that IGFBP-5 mRNA in gastrocnemius from control rats was upregulated twofold by GH. No such increase was observed in response to GH in septic rats, and, therefore, the IGFBP-5 mRNA content was not different between vehicle- and GH-treated septic rats. We have previously reported that using this experimental paradigm, GH increases the plasma IGF-I concentration in control rats, but not in septic animals (27). To determine whether muscle of septic rats was responsive to the effects of IGF-I per se, control and septic rats were administered a binary complex containing equimolar amounts of IGFBP-3 and IGF-I to prolong the anabolic effects of IGF-I (54). Under these conditions, IGF-I/IGFBP-3 increased IGFBP-5 mRNA approximately twofold in gastrocnemius from control rats. The incremental response in muscle IGFBP-5 of septic rats was comparable to that seen in control animals (Fig. 6B).


Figure 6
View larger version (25K):
[in this window]
[in a new window]
 
Fig. 6. Sepsis selectively impairs the ability of growth hormone (GH) but not IGF-I to increase IGFBP-5 mRNA in muscle. A: data from control (nonseptic) and septic rats administered recombinant human GH. B: data from control and septic rats administered IGF-I as an equimolar complex with IGFBP-3. Gastrocnemius was collected 24 h after induction of sepsis by CLP. Values are means ± SE; n = 8 or 9 rats per group. Values with different letters are significantly different (P < 0.05) from each other. For all data, IGFBP-5 mRNA abundance was expressed in AUs determined by densitometry and normalized to 18S mRNA.

 
The catabolic insults of LPS and sepsis produce a rapid and sustained elevation in the circulating concentration of glucocorticoids (13, 39), and glucocorticoids have been generally reported to reduce IGFBP-5 mRNA under in vitro conditions (8, 49). To examine the role of glucocorticoids, initial in vitro studies were performed by treating C2C12 myocytes with dexamethasone. As illustrated in Fig. 7A, exposure of cells to this synthetic glucocorticoid for 24 h decreased IGFBP-5 mRNA by 30–35% in either myoblasts or myotubes. Similarly, when administered in vivo, dexamethasone also decreased IGFBP-5 in gastrocnemius at the 24-h (but not the 4-h) time point (Fig. 7B). In corollary studies, we pretreated rats with the glucocorticoid receptor antagonist RU486 to determine whether an elevation in endogenous corticosterone was responsible for the sepsis-induced downregulation of muscle IGFBP-5. Despite the known effectiveness of the dose of RU486 administered (39, 60), this drug did not alter either constitutive expression of IGFBP-5in gastrocnemius from control rats or the decreased IGFBP-5 mRNA produced by sepsis (Fig. 7C).


Figure 7
View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7. Glucocorticoid regulation of muscle IGFBP-5 mRNA. A: C2C12 myoblasts or myotubes were cultured in MEM in the absence and presence of dexamethasone (Dex; 10 µM), and cells collected 24 h thereafter. Values are expressed as means ± SE; n = 3. *P < 0.05, compared with time-matched control values. B: Dex (100 µg/100 g body wt) was injected subcutaneously, and gastrocnemius muscle was sampled either 4 or 24 h thereafter. This dose of Dex is known to produce muscle wasting (47). C: Gastrocnemius was collected 24 h after induction of sepsis by CLP where RU486 was administered 2 h before induction of peritonitis. For B and C, values are means ± SE; n = 8–10 rats per group. Values with different letters are significantly different (P < 0.05) from each other. For all data, IGFBP-5 mRNA abundance was expressed in AUs determined by densitometry and normalized to 18S mRNA.

 
Sepsis-induced changes in IGF-I mRNA. The IGF-I mRNA content of gastrocnemius muscle was also determined in tissues removed from animals after induction of sepsis or administration of LPS or TNF-{alpha}, as well as their time-matched controls. In general, the changes in muscle IGF-I mRNA paralleled the changes in IGFBP-5 mRNA described above (data not shown). As illustrated in Fig. 8A, there was a strong positive linear correlation between IGFBP-5 and IGF-I mRNA content in muscle in response to the administration of LPS or TNF-{alpha}, and this relationship was also evident in muscle obtained from control and septic rats under basal conditions, as well as in rats treated with TNFBP or GH (Fig. 8B).


Figure 8
View larger version (22K):
[in this window]
[in a new window]
 
Fig. 8. Linear relationship between IGFBP-5 and IGF-I mRNA content in skeletal muscle in response to inflammatory insults. A: effect of LPS and TNF-{alpha}. Equation for the line based on least squares linear analysis of data is y = 0.898x + 0.0616; P < 0.05. B: effect of growth hormone (GH) and TNFBP treatment on control and septic rats; equation for the line is y = .891x + 0.960; P < 0.05).

 
Effect of sepsis on IGFBP-5 mRNA in soleus and cardiac muscle. The erosion of lean body mass produced by the catabolic insults of LPS and sepsis is primarily restricted to muscles with a predominance of fast-twitch fibers (e.g., gastrocnemius) while slow-twitch muscles (e.g., soleus) are relatively spared (55). In contrast to the sepsis-induced decrease in IGFBP-5 and IGF-I mRNA seen in gastrocnemius, sepsis did not significantly alter either IGFBP-5 or IGF-I mRNA expression in soleus muscle, compared with control values (data not shown). Similarly, sepsis also did not alter IGFBP-5 or IGF-I mRNA content in cardiac muscle (data not shown).


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Inflammation and catabolic injury markedly alter various components of the IGF system (16, 36). In general, a marked reduction in the circulating and tissue concentration of IGF-I and a sustained elevation in IGFBP-1 are the most notable and consistent changes observed. In contrast, there is a paucity of information pertaining to stress-induced changes in IGFBP-4 and IGFBP-5. Alterations in these two particular IGFBPs, which are endogenously produced by fully differentiated skeletal muscle, have been postulated to modulate numerous aspects of metabolism because of their ability to modulate IGF-I availability and bioactivity. In addition, IGFBP-5 appears to influence cell function, in part, via IGF-independent mechanisms (49, 59). As a consequence, inflammation-induced changes in IGFBP-4 and IGFBP-5 within muscle might be expected to impact protein balance in this tissue via an autocrine/paracrine manner, thereby, contributing to the wasting syndrome that typically accompanies these insults.

Our results demonstrate that E. coli LPS produces a time- and dose-dependent decrease in muscle IGFBP-5. This decline was clearly evident at 4 h and sustained for at least the next 8 h in response to a single bolus injection of LPS. It is recognized that LPS may not adequately reproduce all of the sequella of the septic syndrome because of its rapid clearance from the circulation and the massive overproduction of inflammatory cytokines (9). Therefore, other more chronic models of inflammation were also investigated. In this regard, the temporal progression of the decrease in IGFBP-5 was delayed in response to sepsis but was qualitatively comparable to that seen after LPS. However, the sepsis-induced reduction in muscle IGFBP-5 was sustained for at least 24 h (the last time point assessed in this model). Furthermore, we have detected a persistent reduction in muscle IGFBP-5 for at least 3 day after a nonlethal thermal injury (unpublished observation). In these different models, we can exclude nutritional differences as a mechanism for the drop in muscle IGFBP-5 mRNA because all control rats were pair-fed to match the food consumption of animals in the various catabolic groups. Such a conclusion is consistent with data showing that IGFPB-5 is not regulated acutely (at 10 h) by nutrition in human muscle (48).

The LPS- and sepsis-induced decrease in muscle IGFBP-5 is in marked contrast to the increased IGFBP-5 produced by other conditions, such as hindlimb suspension, denervation, or aging-induced sarcopenia (1, 4, 5, 51), that exhibit muscle atrophy. In the current study, we confirmed that muscle unloading, produced by unilateral hindlimb casting, increases IGFBP-5 mRNA abundance in the gastrocnemius. Collectively, these data indicate that 1) neither a decrease nor an increase in IGFBP-5 is a sine quinone for muscle wasting; and 2) the inflammation-induced changes in IGFBP-5 reported herein do not result from generalized muscle disuse.

Our subsequent studies aimed to better define the physiological mechanism by which inflammatory insults decrease muscle IGFBP-5 mRNA. Endotoxin and sepsis elevate blood and tissue inflammatory cytokines—such as IL-1, IL-6, and TNF-{alpha} (10)—that regulate various aspects of muscle metabolism (3, 22, 36, 37). However, whereas TNF-{alpha} has been shown to decrease IGFBP-5 secretion from C2 myocytes (41), IL-1 and IL-6 have been reported to increase IGFBP-5 in cultured chondrocytes and osteoblasts (15, 53). There are no published data pertaining to the effect of these cytokines on muscle IGFBP-5 under in vivo conditions; therefore, we initially infused naïve rats with a nonlethal dose of TNF-{alpha} known to impair protein synthesis (37). Our data demonstrate that TNF-{alpha} dramatically decreases muscle IGFBP-5 mRNA bÿ 70%, suggesting an important regulatory role for this cytokine on the transcript abundance of IGFBP-5. Moreover, sepsis induced by CLP produced relatively sustained increases in TNF-{alpha} in blood and muscle per se. Although these data implicate TNF-{alpha} as a putative mediator for the decreased IGFBP-5, they do not indicate whether this factor actually regulates IGFBP-5 gene expression in response to inflammation. To address this caveat, septic rats were treated with TNFBP, which neutralizes endogenously produced TNF-{alpha}. Treatment with TNFBP prevented the sepsis-induced decline in muscle IGFBP-5 but did not influence the basal content in control rats. These results suggest that whereas constitutive production of TNF-{alpha} by muscle does not regulate basal IGFBP-5 mRNA expression, the overproduction of TNF-{alpha} (either systemically or locally) is largely responsible for the sepsis-induced decrease in this IGFBP.

TNF secretion in response to sepsis and LPS is generally considered an early index of the inflammatory condition that results in the release of other cytokines (e.g., IL-6), as well as counterregulatory hormones, such as catecholamines and glucocorticoids. Hence, the current studies using TNFBP do not address whether TNF-{alpha} is the primary or secondary stimulus for the reduction in muscle IGFBP-5. However, results from our in vitro studies demonstrate that TNF-{alpha} (as well as LPS) inhibits IGFBP-5 mRNA in cultured C2C12 myocytes in a dose- and time-dependent manner. Treatment of C2C12 cells with comparable doses of TNF-{alpha} impairs both basal and IGF-I-stimulated protein synthesis (6), and this biological response appears dependent on increased intracellular ceramide (52). Whether such a mechanism is operational in the regulation of IGFBP-5 synthesis was not investigated but is anticipated.

The synthetic glucocorticoid dexamethasone has been generally reported to decrease IGFBP-5 synthesis and secretion by several cell types under in vitro conditions (47). However, we are not aware of a previous report in which dexamethasone has been shown to alter the in vivo tissue expression of this binding protein. Our results indicate that exogenous administration of dexamethasone under either in vivo or in vitro conditions was capable of decreasing muscle IGFBP-5 mRNA, albeit this reduction appeared quantitatively smaller than that produced by other catabolic stimuli. In contrast, pretreatment with RU486 was unable to prevent the sepsis-induced decrease in muscle IGFBP-5. Finally, we have reported previously that TNFBP does not ameliorate the sepsis-induced increase in corticosterone (39). Hence, these data indicate that although exogenous glucocorticoids have the potential to decrease IGFBP-5 mRNA, the contribution of an endogenous elevation in this hormonal regulator to the sepsis-induced changes in muscle IGFBP-5 mRNA appears nominal.

Increasing the concentration of IGF-I leads to proportional changes in IGFBP-5 mRNA in cultured myocytes (45). The ability of IGF-I to stimulate IGFBP-5 gene expression is regulated by signaling through the IGF-1 receptor and subsequent phosphorylation of downstream signal transduction pathways (49). However, the specific importance of the phosphatidylinositol-3 kinase and the p42/44 MAPK canonical pathways in mediating IGF-I induced increases in IGFBP-5 is variable and may reflect species or cell-type differences (11, 12, 32, 45, 49, 56). Therefore, it is possible that the inflammation-induced decrease in IGFBP-5 results from a reduction in IGF-I within the muscle or circulation. All of these inflammatory conditions have been reported to be associated with reduced IGF-I (16, 18, 36). Two lines of evidence from the current investigation support such a relationship. First, there is a significant positive linear correlation between the IGFBP-5 mRNA and IGF-I mRNA content in the same muscle obtained from LPS- and TNF-{alpha}-treated, as well as septic, rats. Moreover, whereas the exogenous administration of GH increased the mRNA content of both IGFBP-5 and IGF-I in muscle from control rats, septic animals exhibited a GH resistance that was manifested by the lack of an increase in both IGFBP-5 and IGF-I. We have previously reported that GH administration to septic rats does not increase the plasma IGF-I concentration (27). Secondly, exogenous administration of IGF-I as part of a IGF-I/IGFBP-3 binary complex produced a comparable increment in IGFBP-5 mRNA in muscle from both control and septic rats. The ability of IGF-I to effectively increase IGFBP-5 is consistent with our previous results indicating that sepsis and LPS do not impair IGF-I signaling via the PI3K/Akt/mTOR pathway in skeletal muscle and that IGF-I is capable of stimulating muscle protein synthesis in these animals (35, 54). These conclusions are in agreement with the results of previous studies in which IGF-I infused locally to muscle increased IGFBP-5 and induced hypertrophy (24) or in which anabolic agents were administered, resulting in concomitant increases in muscle IGF-I, IGFBP-5, and mass (2).

The physiological ramifications of the inflammation-induced fall in muscle IGFBP-5 were not the focus of the present study and remain to be determined. The literature contains conflicting data related to the effect of IGFBP-5 on cell function. These differential effects appear related to cell type, culture, and experimental conditions, whether the binding protein is exogenously added or endogenously produced, and/or the end point assessed (28, 32, 49, 57). In addition, IGFBP-5 also has IGF-independent actions in cultured myocytes (7). Therefore, it is not possible at this time to generalize whether the observed sepsis-induced alterations in this binding protein might be expected to impair or enhance the protein metabolic response in skeletal muscle.

In summary, our results demonstrate that inflammatory insults, exemplified by LPS, sepsis, and exogenous administration of TNF-{alpha}, lead to an apparently selective reduction in IGFBP-5 mRNA in predominantly fast-twitch skeletal muscle and that this change was not anticipated based on results from other animal models of muscle atrophy. For sepsis, the decreased IGFBP-5 appears dependent upon the overexpression of TNF-{alpha} and independent of the elevation in glucocorticoids. Finally, IGF-I appears to be a dominant positive regulator of IGFBP-5 gene expression in muscle because even in the presence of elevated TNF-{alpha}, it is capable of increasing the IGFBP-5 mRNA content.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported in part by National Institutes of Health (NIH) Grant GM-38032. B. J. Krawiec was supported by the NIH Predoctoral Training Grant T32-GM-08619.


    FOOTNOTES
 

Address for reprint requests and other correspondence: C. H. Lang, Dept. of Cellular and Molecular Physiology, H166, Penn State College of Medicine, 500 Univ. Dr., Hershey, PA 17033 (clang{at}psu.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Awede B, Thissen JP, Gailly P, and Lebacq J. Regulation of IGF-I, IGFBP-4 and IGFBP-5 gene expression by loading in mouse skeletal muscle. FEBS Lett 461: 263–267, 1999.[CrossRef][Web of Science][Medline]
  2. Awede BL, Thissen JP, and Lebacq J. Role of IGF-I and IGFBPs in the changes of mass and phenotype induced in rat soleus muscle by clenbuterol. Am J Physiol Endocrinol Metab 282: E31–E37, 2002.[Abstract/Free Full Text]
  3. Ballmer PE, McNurlan MA, Southorn BG, Grant I, and Garlick PJ. Effects of human recombinant interleukin-1beta on protein synthesis in rat tissues compared with a classical acute-phase reaction induced by turpentine. Biochem J 279: 683–688, 1991.
  4. Bayol S, Loughna PT, and Brownson C. Phenotypic expression of IGF binding protein transcripts in muscle, in vitro and in vivo. Biochem Biophys Res Commun 273: 282–286, 2000.[CrossRef][Web of Science][Medline]
  5. Bickel CS, Slade JM, Haddad F, Adams GR, and Dudley GA. Acute molecular responses of skeletal muscle to resistance exercise in able-bodied and spinal cord-injured subjects. J Appl Physiol 94: 2255–2262, 2003.[Abstract/Free Full Text]
  6. Broussard SR, McCusker RH, Novakofski JE, Strle K, Shen WH, Johnson RW, Freund GG, Dantzer R, and Kelley KW. Cytokine-hormone interactions: tumor necrosis factor impairs biologic activity and downstream activation signals of the insulin-like growth factor I receptor in myoblasts. Endocrinology 144: 2988–2996, 2003.[Abstract/Free Full Text]
  7. Cobb LJ, Salih DAM, Gonzalez I, Tripathi G, Carter EJ, Lovett F, Holding C, and Pell JM. Partitioning of IGFBP-5 actions in myogenesis: IGF-independent anti-apoptotic function. J Cell Sci 117: 1737–1746, 2004.[Abstract/Free Full Text]
  8. Conover CA, Clarkson JT, and Bale LK. Effect of glucocorticoid on insulin-like growth factor (IGF) regulation of IGF-binding protein expression in fibroblasts. Endocrinology 138: 1403–1410, 1995.
  9. Deitch EA. Animal models of sepsis and shock: a review and lessons learned. Shock 9: 1–11, 1998.[Web of Science][Medline]
  10. Dinarello CA. Proinflammatory cytokines. Chest 118: 503–508, 2000.[Abstract/Free Full Text]
  11. Duan C, Liimatta MB, and Bottum OL. Insulin-like growth factor (IGF)-I regulates IGF-binding protein-5 gene expression through the phosphatidylinositol 3-kinase, protein kinase B/Akt, and p70 S6 kinase signaling pathway. J Biol Chem 274: 37147–37153, 1999.[Abstract/Free Full Text]
  12. Ewton DZ, Coolican SA, Mohan S, Chernausek DS, and Florini JR. Modulation of insulin-like growth factor actions in L6A1 myoblasts by insulin-like growth factor binding protein (IGFBP)-4 and IGFBP-5: a dual role for IGFBP-5. J Cell Physiol 177: 47–57, 1998.[CrossRef][Web of Science][Medline]
  13. Fan J, Char D, Bagby GJ, Gelato MC, and Lang CH. Regulation of insulin-like growth factor-I (IGF-I) and IGF binding proteins by tumor necrosis factor. Am J Physiol Regul Integr Comp Physiol 269: R1204–R1212, 1995.[Abstract/Free Full Text]
  14. Fan J, Wojnar MM, Theodorakis M, and Lang CH. Regulation of insulin-like growth factor (IGF)-I mRNA and peptide, and IGF binding proteins by IL-1. Am J Physiol Regul Integr Comp Physiol 270: R621–R629, 1996.[Abstract/Free Full Text]
  15. Franchimont N, Durant D, and Canalis E. Interleukin-6 and its soluble receptor regulate the expression of insulin-like growth factorbinding protein-5 in osteoblast cultures. Endocrinology 138: 3380–3386, 1997.[Abstract/Free Full Text]
  16. Frost RA and Lang CH. Growth factors in critical illness: regulation and therapeutic aspects. Curr Opin Clin Nutr Metab Care 1: 195–204, 1998.[CrossRef][Medline]
  17. Frost RA and Lang CH. Differential effect of IGF-I and IGFBP-1 on protein metabolism in skeletal muscle cells. Endocrinology 140: 3962–3970, 1999.[Abstract/Free Full Text]
  18. Frost RA and Lang CH. Skeletal muscle cytokines; regulation by pathogen-associated molecules and catabolic hormones. Curr Opin Clin Nutr Metab Care 8: 255–263, 2005.[Web of Science][Medline]
  19. Frost RA, Nystrom GJ, and Lang CH. Lipopolysaccharide and proinflammatory cytokines stimulate interleukin-6 expression in C2C12 myoblasts: role of the jun NH2-terminal kinase. Am J Physiol Regul Integr Comp Physiol 285: R1153–R1164, 2003.[Abstract/Free Full Text]
  20. Frost RA, Nystrom GJ, and Lang CH. Tumor necrosis factor decreases insulin-like growth factor-I messenger ribonucleic acid expression in C2C12 myoblasts via a Jun N-terminal kinase pathway. Endocrinology 144: 1770–1779, 2003.[Abstract/Free Full Text]
  21. Frost RA, Nystrom GJ, and Lang CH. Lipopolysaccharide stimulates nitric oxide synthase-2 expression in murine skeletal muscle and C2C12 myoblasts via toll-like receptor-4 and c-Jun NH2-terminal kinase pathways. Am J Physiol Cell Physiol 287: C1605–C1615, 2004.[Abstract/Free Full Text]
  22. Goodman MN. Interleukin-6 induces skeletal muscle protein breakdown in rats. Proc Soc Exp Biol Med 205: 182–185, 1994.[CrossRef][Medline]
  23. Gosteli-Peter MA, Winterhalter KH, Schmid C, Froesch ER, and Zapf J. Expression and regulation of insulin-like growth factor I (IGF-I) and IGF-binding protein messenger ribonucleic acid levels in tissues of hypophysectomised rats infused with IGF-I and growth hormone. Endocrinology 135: 2558–2567, 1994.[Abstract]
  24. Haddad F and Adams GR. Inhibition of MAP/ERK kinase prevents IGF-I-induced hypertrophy in rat muscles. J Appl Physiol 96: 203–210, 2004.[Abstract/Free Full Text]
  25. Haddad F and Adams GR. Acute cellular and molecular responses to resistance exercise. J Appl Physiol 93: 394–403, 2002.[Abstract/Free Full Text]
  26. Hehlgans T and Pfeffer K. The intriguing biology of the tumour necrosis factor/tumour necrosis factor receptor superfamily: players, rules and the games. Immunology 115: 1–20, 2005.[CrossRef][Web of Science][Medline]
  27. Hong-Brown LQ, Brown CR, Cooney RN, and Lang CH. Sepsis-induced muscle growth hormone resistance; differential response for STAT5 phosphorylation and IGF-I mRNA expression. Am J Physiol Endocrinol Metab 285: E63–E72, 2003.[Abstract/Free Full Text]
  28. Hsieh T, Gordon RE, Clemmons DR, Busby WH, and Duan C. Regulation of vascular smooth muscle cell responses to insulin-like growth factor (IGF)-I by local IGF-binding proteins. J Biol Chem 278: 42886–42892, 2003.[Abstract/Free Full Text]
  29. James PL, Jones SB, Busby WH, Clemmons DR, and Rotwein P. A highly conserved insulin-like growth factor-binding protein (IGFBP)-5 is expressed during myoblast differentiation. J Biol Chem 268: 22305–22312, 1993.[Abstract/Free Full Text]
  30. James PL, Stewart CE, and Rotwein P. Insulin-like growth factor binding protein (IGFBP)-5 modulates muscle differentiation through an insulin-like growth factor-dependent mechanism. J Cell Biol 133: 683–693, 1996.[Abstract/Free Full Text]
  31. Jones JI and Clemmons DR. Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev 16: 3–34, 1995.[Abstract/Free Full Text]
  32. Kiepe D, Ciarmatori S, Hoeflich A, Wolf E, and Tonshoff B. Insulin-like growth factor (IGF)-I stimulates cell proliferation and induces IGF binding protein (IGFBP)-3 and IGFBP-5 gene expression in cultured growth plate chondrocytes via distinct signaling pathways. Endocrinology 146: 3096–3104, 2005.[Abstract/Free Full Text]
  33. Krawiec BJ, Frost RA, Vary TC, Jefferson LS, and Lang CH. Hindlimb casting decreases skeletal muscle mass in part by proteasome-dependent proteolysis but independent of protein synthesis. Am J Physiol Endocrinol Metab 289: E969–E980, 2005.[Abstract/Free Full Text]
  34. Lang CH and Frost RA. Endotoxin disrupts the leucine signaling pathway involving phosphorylation of mTOR, 4E-BP1 and S6K1 in skeletal muscle. J Cell Physiol 203: 144–155, 2005.[CrossRef][Web of Science][Medline]
  35. Lang CH and Frost RA. Differential effect of sepsis on ability of leucine and IGF-I to stimulate muscle translation initiation. Am J Physiol Endocrinol Metab 287: E721–E730, 2004.[Abstract/Free Full Text]
  36. Lang CH and Frost RA. Role of growth hormone, insulin-like growth factor-I, and insulin-like growth factor binding proteins in the catabolic response to injury and infection. Curr Opin Clin Nutr Metab Care 5: 271–279, 2002.[CrossRef][Web of Science][Medline]
  37. Lang CH, Frost RA, Nairn AC, MacLean DA, and Vary TC. TNF decreases myocardial and skeletal muscle protein synthesis via alterations in translation initiation but not elongation. Am J Physiol Endocrinol Metab 282: E336–E347, 2002.[Abstract/Free Full Text]
  38. Lang CH, Nystrom GJ, and Frost RA. Burn-induced changes in IGF-I and IGF binding proteins are partially glucocorticoid-dependent. Am J Physiol Regul Integr Comp Physiol 282: R207–R215, 2002.[Abstract/Free Full Text]
  39. Li YH, Fan J, and Lang CH. Differential role of glucocorticoids in mediating endotoxin-induced changes in IGF-I and IGFBP-1. Am J Physiol Regul Integr Comp Physiol 272: R1990–R1997, 1997.[Abstract/Free Full Text]
  40. Mao J, Regelson W, and Kalimi M. Molecular mechanism for RU486 action: a review. Mol Cell Biochem 109: 1–8, 1992.[Web of Science][Medline]
  41. Meadows KA, Holly JMP, and Stewart CEH. Tumor necrosis factor-induced apoptosis is associated with suppression of insulin-like growth factor binding protein-5 secretion in differentiating murine skeletal myoblasts. J Cell Physiol 183: 330–337, 2000.[CrossRef][Web of Science][Medline]
  42. Okazaki R, Riggs BL, and Conover CA. Glucocorticoid regulation of insulin-like growth factor-binding protein expression in normal human osteoblast-like cells. Endocrinology 134: 126–132, 1994.[Abstract/Free Full Text]
  43. Pampusch MS, Xi G, Kamanga-Sollo E, Loseth KJ, Hathaway MR, Dayton WR, and White ME. Production of recombinant porcine IGF-binding protein-5 and its effect on proliferation of porcine embryonic myoblast cultures in the presence and absence of IGF-I and long-R3-IGF-I J. Endocrinology 185:197–206, 2005.[CrossRef]
  44. Rajaram S, Baylink DJ, and Mohan S. Insulin-like growth factor-binding proteins in serum and other biological fluids: regulation and functions. Endocr Rev 18: 801–831, 1997.[Abstract/Free Full Text]
  45. Rousse S, Montarras D, Pinset C, and Dubois C. Up-regulation of insulin-like growth factor binding protein-5 is independent of muscle cell differentiation, sensitive to rapamycin, but insensitive to wortmannin and LY294002. Endocrinology 139: 1487–1493, 1998.[Abstract/Free Full Text]
  46. Salih DAM, Tripathi G, Holding C, Szestak TAM, Gonzalez MI, Carter EJ, Cobb LJ, Eisemann JE, and Peli JM. Insulin-like growth factor-binding protein 5 (IGFBP5) compromises survival, growth, muscle development and fertility in mice. Proc Natl Acad Sci USA 101: 4314–4319, 2004.[Abstract/Free Full Text]
  47. Savary I, Debras E, Dardevet D, Sornet C, Capitan P, Prungnaud J, Mirand PP, and Grizard J. Effect of glucocorticoid excess on skeletal muscle and heart protein synthesis in adult and old rats. Br J Nutr 79: 297–304, 1998.[CrossRef][Web of Science][Medline]
  48. Schimke JMC, Ljungqvist OH, Sarkar G, Conover CA, and Nair SK. A quantitative PCR measurement of messenger RNA expression of IGF-I, IGF-II, and IGFBP-5 in human skeletal muscle. Growth Horm IGF Res 9: 179–186, 1999.[CrossRef][Web of Science][Medline]
  49. Schneider MR, Wolf E, Hoeflich A, and Lahm H. IGF-binding protein-5: flexible player in the IGF system and effector on its own. J Endocrinol 172: 423–440, 2002.[Abstract]
  50. Silverman LA, Cheng ZQ, Hsiao D, and Rosenthal SM. Skeletal muscle cell-derived insulin-like growth factor (IGF) binding proteins inhibit IGF-I-induced myogenesis in rat L6E9 cells. Endocrinology 136: 720–726, 1995.[Abstract]
  51. Spangenburg EE, Abraha T, Childs TE, Pattison JS, and Booth FW. Skeletal muscle IGF-I binding protein-3 and -5 expressions are age, muscle, and load dependent. Am J Physiol Endocrinol Metab 284: E340–E350, 2003.[Abstract/Free Full Text]
  52. Strle K, Broussard SR, McCusker RH, Shen WH, Johnson RW, Freund GG, Dantzer R, and Kelley KW. Proinflammatory cytokine impairment of insulin-like growth factor I-induced protein synthesis in skeletal muscle myoblasts requires ceramide. Endocrinology 145: 4592–4602, 2004.[Abstract/Free Full Text]
  53. Sunic D, McNeil JD, Rayner TE, Andress DL, and Belford DA. Regulation of insulin-like growth factor-binding protein-5 by insulin-like growth factor I and interleukin-1 in ovine articular chondrocytes. Endocrinology 139: 2356–2362, 1998.[Abstract/Free Full Text]
  54. Svanberg E, Frost RA, Lang CH, Isgaard J, Jefferson LS, Kimball SR, and Vary TC. Insulin-like growth factor (IGF)-I/IGF binding protein-3 binary complex attenuates sepsis-induced inhibition of protein synthesis in skeletal muscle. Am J Physiol Endocrinol Metab 279: E1145–E1158, 2000.[Abstract/Free Full Text]
  55. Vary TC and Kimball SR. Sepsis-induced changes in protein synthesis: differential effects on fast-and slow-twitch muscles. Am J Physiol Cell Physiol 262: C1513–C1519, 1992.[Abstract/Free Full Text]
  56. Xin X, Hou YT, Li L, Schmiedlin-Ren P, Christman GM, Cheng HL, Bitar K, and Zimmerman EM. IGF-I increases IGFBP-5 and collagen 1 (I) mRNAs by the MAPK pathway in rat intestinal smooth muscle cells. Am J Physiol Gastrointest Liver Physiol 286: G777–G783, 2004.[Abstract/Free Full Text]
  57. Yin P, Xu Q, and Duan C. Paradoxical actions of endogenous and exogenous insulin-like growth factor-binding protein-5 revealed by RNA interference analysis. J Biol Chem 279: 32660–32666, 2004.[Abstract/Free Full Text]
  58. Yumet G, Shumate ML, Bryant P, Lang CH, and Cooney RN. Tumor necrosis factor mediates hepatic growth hormone resistance during sepsis. Am J Physiol Endocrinol Metab 283: E472–E481, 2002.[Abstract/Free Full Text]
  59. Zhou R, Diehl D, Hoeflich A, Lahm H, and Wolf E. IGF-binding protein-4: biochemical characteristics and functional consequences. J Endocrinol 178: 177–193, 2003.[Abstract]
  60. Zamir O, Hasselgren PO, von Allmen D, and Fischer JE. The effect of interleukin-1 and the glucocorticoid receptor blocker RU38486 on total and myofibrillar protein breakdown in skeletal muscle. J Surg Res 50: 570–583, 1991.



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Q. Jiao, A. M. Pruznak, D. Huber, T. C. Vary, and C. H. Lang
Castration differentially alters basal and leucine-stimulated tissue protein synthesis in skeletal muscle and adipose tissue
Am J Physiol Endocrinol Metab, November 1, 2009; 297(5): E1222 - E1232.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
S. M. Phillips, E. I. Glover, and M. J. Rennie
Alterations of protein turnover underlying disuse atrophy in human skeletal muscle
J Appl Physiol, September 1, 2009; 107(3): 645 - 654.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/4/R963    most recent
00684.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lang, C. H.
Right arrow Articles by Frost, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lang, C. H.
Right arrow Articles by Frost, R. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.