AJP - Regu AJP: Heart and Circulatory Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Regul Integr Comp Physiol 291: R327-R334, 2006. First published March 23, 2006; doi:10.1152/ajpregu.00901.2005
0363-6119/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/2/R327    most recent
00901.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chillingworth, N. L.
Right arrow Articles by Donaldson, L. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chillingworth, N. L.
Right arrow Articles by Donaldson, L. F.

CALL FOR PAPERS
Sex and Gender in Pain and Inflammation

Sex differences in inflammation and inflammatory pain in cyclooxygenase-deficient mice

Naomi L. Chillingworth,1 Scott G. Morham,2 and Lucy F. Donaldson1

1Department of Physiology, University of Bristol School of Medical Sciences, University Walk, Bristol, United Kingdom; and 2Myriad Genetics, Salt Lake City, Utah

Submitted 21 December 2005 ; accepted in final form 14 March 2006


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 GRANTS
 REFERENCES
 
There are two cyclooxygenase (COX) genes encoding characterized enzymes, COX-1 and COX-2. Nonsteroidal anti-inflammatory drugs are commonly used as analgesics in inflammatory arthritis, and these often inhibit both cyclooxygenases. Recently, inhibitors of COX-2 have been used in the treatment of inflammatory arthritis, as this isoform is thought to be critical in inflammation and pain. The objective of this study was to determine the effect of COX-1 or COX-2 gene disruption on the development of chronic Freund’s adjuvant-induced arthritis and inflammatory pain in male and female mice. The effect of COX-1 or COX-2 gene disruption on inflammatory hyperalgesia, allodynia, inflammatory edema, and arthritic joint destruction was studied. COX-2 knockout mice (COX-2 –/–) showed reduced edema and joint destruction in female, but not male, animals. In addition, neither male nor female COX-2 –/– mice developed thermal hyperalgesia or mechanical allodynia, either ipsilateral or contralateral to the inflammation. COX-1 gene disruption also reduced inflammatory edema and joint destruction in female, but not male mice, although females of both COX –/– lines did show some bony destruction. There was no difference in ipsilateral allodynia between COX-1 knockout and wild-type animals, but female COX-1 –/– mice showed reduced contralateral allodynia compared with male COX-1 –/– or wild-type mice. These data show that the gene products of both COX genes contribute to pain and local inflammation in inflammatory arthritis. There are sex differences in some of these effects, and this suggests that the effects of COX inhibitors may be sex dependent.

allodynia; arthritis; hyperalgesia

THERE ARE TWO KNOWN CYCLOOXYGENASE (COX) genes, each encoding at least one functional COX enzyme. Traditional thinking has held that COX-1 is a constitutively expressed enzyme that performs housekeeping functions, whereas COX-2 is an inducible enzyme that has roles in inflammation and cellular mitosis. There are known to be other splice variants of the COX genes, but little is currently known about the possible function of these proteins (68). COX enzymes are, to varying degrees, the molecular targets of the nonsteroidal anti-inflammatory drugs (NSAIDs), which are widely used in the treatment of inflammation and pain (21, 36).

As COX-2 is induced at sites of inflammation and tumor growth, it is thought to be important in inflammatory and hyperplastic processes, whereas COX-1 is expressed widely in many tissues where it is involved in normal function, such as gastroprotection. Recent evidence, however, suggests that these "housekeeping" and "pathological" roles of COX-1 and COX-2, respectively, are oversimplified, as COX-2 may have roles in physiological functions and COX-1 may be involved in pathological processes (11, 40, 41, 77). In addition, elimination of COX-1 function both by pharmacological means and gene targeting does not result in gastrotoxicity, indicating a more complex interplay between COX-1 and COX-2 in gastric homeostasis than previously surmised (70, 78).

Chronic inflammatory arthritides, such as rheumatoid arthritis (RA), are characterized by dense inflammatory infiltrate in joints, with joint destruction and ankylosis. Pain in inflammatory arthritis is often treated with NSAIDs, or recently with COX-2-selective inhibitors (45) with the rationale that COX inhibition will reduce the inflammatory process. Although COX-2 has been found to be expressed in rheumatoid joints (56), the role of the individual COX isoforms and specifically COX-1 in this disease is less clear. Adjuvant-induced arthritis has been used for some time in the rat as a good model of RA, particularly with regard to joint destruction (16). We have developed this model in the mouse, to facilitate studies of RA in genetically modified animals (18).

During inflammation, pharmacological inhibition of cyclooxygenases has produced conflicting data on the role of these enzymes in nociception, with either COX-1 (34), COX-2 (72, 73), or both enzymes reported to be important (24, 26, 57, 58). COX-1, in addition to COX-2, may have important functions in inflammatory nociception, despite the current emphasis on COX-2 inhibitors as analgesics (59). All COX isoforms have been found in areas of the central and peripheral nervous systems appropriate to a role in nociceptive processing (9, 14, 15, 19, 31, 81). Pharmacological inhibition of central COX-2 results in reduced allodynia (69), although others have found inhibition of both COX isoforms decreases nociceptive responses (58).

Although we have not previously found a sex-dependent alteration of incidence of pathology in either rats or mice with Freund’s adjuvant-induced disease (18, 28), sex differences in the severity of disease have been reported in other models of arthritis (48, 80). Women have a higher incidence of RA (7, 79), have poorer prognosis than men (79), and report more prevalent and more severe pain than men (3). Interestingly it has been reported that the nonselective NSAID ibuprofen has little effect on noninflammatory experimental pain in women, although it is effective in men (76). There are no reported differences in the degree of NSAID usage between males and females with RA, however (47).

We have used COX knockout mice to investigate whether the disruption of individual COX genes has a distinct effect on inflammatory arthritis, including edema formation, joint destruction, and on pain behavior, including primary and secondary inflammatory hyperalgesia and allodynia. As sex differences have been reported in RA, experimental arthritis, and in inflammatory nociception, we have investigated these parameters independently in female and male mice.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS AND DISCUSSION
 GRANTS
 REFERENCES
 
All procedures were carried out on adult mice (20–25 g) with disruption of either the COX-1 or COX-2 genes. The background strain of both COX –/– lines was the same, with homologous recombination carried out in 129ES cells, and founders from the C57/BL6 line. Both lines were backcrossed through at least 12 generations (55, 61). All experimental procedures, including housing of animals, conformed to United Kingdom Home Office legislation.

Genotyping of Knockout Mice

Mice were tail-tipped under local anesthesia, and DNA was extracted by incubation in proteinase K followed by phenol:chloroform extraction and ethanol precipitation. Primer sets for COX-1 wild-type and mutant alleles were as previously published (62). Wild-type 5' primer: (COX1–5': AGGAGATGGCTGCTGAGTTGG), 3' primer (COX1–3': AATCTGACTTTCTGAGTTGCC), and mutant allele primer (COX1-Neo: GCAGCCTCTGTTCCACATACAC) gave PCR products of 600 and 700 base pairs, respectively. Primer pairs for COX-2 wild-type and mutant alleles (COX-2 wild-type 5': CATCCCTACCATTTGTAAGGAA; COX-2 wild-type 3': TGTTTGAAGCTGTACTCCTGGTCTT; COX-2 mutant 5': AGGATCTCCTGTCATCTCACCTTG; COX-2 mutant 3': CCAAGCTCTTCAGCAATATCACG) gave PCR products of 399 and 450 base pairs, respectively. In all studies, knockout mice were compared with wild-type age- and sex-matched control animals (n = 5–12 per group).

Chronic Inflammatory Arthritis in Mice

Chronic inflammatory arthritis was induced in mice using intradermal injection of Freund’s complete adjuvant (FCA; 250 µg attenuated Mycobacterium tuberculosis/100 µl mineral oil, made in-house) at two sites around the left tibiotarsal joint, under a brief halothane anesthesia (4% halothane in oxygen). Heat-killed Mycobacterium tuberculosis was a gift from Professor D. S. McQueen, University of Edinburgh and was originally obtained from the United Kingdom Ministry of Agriculture Fisheries and Food, now known as Department for Environment Food and Rural Affairs. This procedure results in unilateral tibiotarsal joint arthritis, with edema that is maintained for at least 20 days post-FCA injection in 100% of mice (18). Arthritic edema was assessed by direct measurement of tibiotarsal joint circumference using a tape measure every day and comparison was made to preinjection values. At the termination of the experiment, after 20 days, mice were killed by cervical dislocation. Hind paws were removed, fixed in formal saline, and then decalcified in Gooding and Stewart’s solution as previously described (18). Sections (10 µm) were stained with hematoxylin and eosin for histological analysis. Arthritis was assessed by scoring of histological sections of the tibiotarsal joints, according to features of arthritis present, as previously described (30) using a Nikon microscope. Histological sections were scored blind to treatment for the degree of inflammation as previously described (18) and according to the following scale: 0, no inflammation; 1, mild inflammatory infiltrate in skin and overlying tissues; 2, dense cutaneous inflammatory infiltrate, but no synovitis or arthritis; 3, synovitis; 4, hyperplastic synovium, inflammatory infiltrate/fibrin in the joint; 5, arthritis with destruction of articular tissues, pannus formation.

Thermal and Mechanical Inflammatory Nociception

Thermal and mechanical nociceptive tests were carried out before FCA injection and thereafter every 2 days on all mice. Thermal withdrawal latencies were determined using the Hargreaves apparatus, and mechanical nociceptive thresholds were determined using von Frey hairs, as previously described (18). Mechanical allodynia was assessed by determination of withdrawal thresholds to standard von Frey filaments, on both inflamed ipsilateral and noninflamed contralateral hindpaws. The plantar surface of each hindpaw was stimulated with von Frey filaments of increasing force until the filament that gave withdrawal responses to 3/5 stimuli was reached. This was then recorded as the force required to elicit a withdrawal response. Thermal hyperalgesia was assessed by the Hargreaves method (44). An infrared beam was placed under the plantar surface of each hindpaw, and the time taken for a withdrawal response to occur was recorded. Allodynia and hyperalgesia were assessed every 2 days. Comparison of nociceptive responses was made between wild-type and knockout mice and also to pre-FCA injection responses.

Data Analysis

All measures were compared with preinjection values using ANOVA followed by Dunnett’s post hoc test. Intergroup comparisons (within or between genotype or sex) were made using ANOVA followed by Bonferroni (intergroup comparisons) post hoc tests. All analysis was performed on raw data; in some cases, data are presented as percentage of control to prevent any lack of clarity due to slight differences in control values between genotypes and for easy comparison. In accordance with UK legislation, all animal numbers were the minimum necessary to achieve statistical significance. Acceptable statistical power for each measure was >0.85.


   RESULTS AND DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
GRANTS
 REFERENCES
 
Contribution of COX-1 and COX-2 Gene Products to the Development of Arthritis in Male and Female Mice

All wild-type mice developed arthritis to the same degree, regardless of sex. At 20 days after injection, all wild-type controls exhibited histological features of arthritis in the injected tibiotarsal joint, which were similar to features of RA, including hyperplastic synovium, dense inflammatory infiltrate into synovium, and evidence of bone remodeling (Fig. 1). Although female animals of both mutant genotypes showed histological evidence of inflammatory infiltrate and some evidence of bone destruction (Fig. 1, D and E), this was less apparent in male mice, which were essentially indistinguishable from wild-type controls, showing all the features found in wild-type animals. There was no histological evidence of contralateral inflammation in any animal, either wild-type or knockout. Thus there was a significant sex difference in both COX-1 –/– and COX-2 –/– mice, in that in female mice, but not males, loss of either COX isoform significantly reduced the severity of the joint destruction seen after FCA injection. These findings and those on nociceptive behaviors in these animals are summarized in Table 1.


Figure 1
View larger version (96K):
[in this window]
[in a new window]
  		Fig. 1. Histological features of arthritis in wild-type (WT), and male and female COX-1 and COX-2 –/– mice, 20 days after Freund’s complete adjuvant (FCA) injection. A: histological analysis showed that female COX-1 –/– mice (open bars) showed significantly less joint destruction than male –/–, or male or female WT controls (solid bars) (n = 5 per group. *P < 0.05; **P < 0.01). [For male COX-2 –/– vs. WT sample size analysis shows n > 35 per group (for no change in SD) for P < 0.05, power >0.85]. B and C: sections from female (B) and male (C) inflamed WT joints showing hyperplastic synovium (HS) covering the articular surface above normal cartilage (C), and pannus invasion (arrow) of subchondral bone (Bn) underlying the cartilage (C) (scale bars = 100 µm). D: section from a COX-1 –/– female mouse showing relatively normal joint appearance, including normal cartilage (C) and bone (Bn). Skin (Sk) overlying the joint also shows little evidence of inflammation (scale bar = 100 µm). E: section from a COX-2 –/– female mouse also showing relatively normal joint appearance, similar to the COX-1 –/– female (scale bar = 100 µm). F and G: sections from male COX-1 –/– male mice showing dense inflammatory infiltrate (I) overlying the joint and in bone marrow, HS, and invasion of bone (arrow) (scale bars F = 100 µm, G = 50 µm).

 

View this table:
[in this window]
[in a new window]
  		Table 1. Summary of the changes in inflammatory and nociceptive parameters measured in wild-type and COX knockout mice

 
Cyclooxygenases and prostaglandins are intimately involved in the control of bone turnover, activating both osteoclasts and osteoblasts (43). The effect of disruption of either COX gene on the more severe bony changes seen in arthritic joints probably reflects the relationship between prostaglandin synthesis and bone turnover in both normal and inflammatory conditions (43).

These data were mirrored by the effect of COX gene disruption on joint edema. In female COX-1 and COX-2 –/– mice, joint swelling was significantly reduced compared with wild-type animals from day 6 (COX-2 –/–) and day 14 (COX-1 –/–) (Fig. 2A). Mean joint circumferences in female wild-type animals were 9.8 ± 0.4 mm at day –1, which was not significantly different from preinjection values in COX-1 –/– or COX-2 –/– animals. Wild-type joint circumferences increased to 17.9 ± 0.6 mm at 20 days, whereas female COX-1 –/– joint circumferences only increased to 14 ± 0.4 mm and female COX-2 –/– to 12.6 ± 0.9 mm (both at day 20). Male COX-1 –/– and COX-2 –/– mice showed no significant difference in the degree of edema from wild-type animals at all times (Table 1, Fig. 2B).


Figure 2
View larger version (16K):
[in this window]
[in a new window]
  		Fig. 2. Sex differences, cyclooxygenases, and inflammatory edema. A: female COX-1 –/– (open squares) and COX-2 –/– (open circles) mice had significantly less joint edema than WT controls (solid squares), particularly in the chronic stages of the disease. Effects on edema appeared earlier in COX-2 –/– mice compared with COX-1 knockouts. (*P < 0.05 WT compared with COX-2 –/–; {dagger}P < 0.05 WT compared with both –/– phenotypes; {ddagger}P < 0.05 WT cf COX-1 –/–). B: male COX-1 and COX-2 –/– animals showed no significant change in joint edema compared with WT controls.

 
No study to date has examined sex differences and cyclooxygenases in arthritis; indeed, many studies use animals of only one sex and would therefore have not seen any sex-based differences (1, 82). In female mice, estrogen regulates PGI2 production by both COX-1 (65) and COX-2 (33), and this has been speculated to confer a protective effect in atherosclerosis (33). Pharmacological COX-2 inhibition (39, 62, 64, 82) or gene ablation prevents arthritis development; COX-2 gene disruption affects both bony destruction and edema in arthritis. The former effect is possibly attributable to the prevention of osteoclastogenesis by COX-2 inhibition (49).

There is conflicting evidence in the literature to implicate COX-2 in edema formation; in acute inflammation, COX-2 inhibition has been reported to reduce (39, 66) or have no effect upon edema (35, 38). Genetically modified mice in which COX-2 is upregulated show increased edema in the carrageenan model (42). The differences in edema occur earlier in COX-2 –/– compared with COX-1 –/– mice, and we hypothesize that the lack of inflammation-induced COX-2 induction could account for most of the differences in histological score and edema formation seen in these animals.

COX-1 gene products have not been previously implicated in disease progression in arthritis; indeed, there is a paucity of evidence in the literature on potential functions of COX-1 in arthritis, although COX-1 inhibition does attenuate inflammation in other models (8, 55, 58). To our knowledge, this is the first report of both an important role for COX-1 gene products in the joint destruction associated with inflammatory arthritis and a sex difference in the function of this isoform.

COX-1 is increased in RA and osteoarthritis in humans (50, 56), although not in all cases (22). The effect of COX-1 inhibition on edema is in agreement with other findings in animal models. In acute inflammation, edema is prevented by specific COX-1 inhibition (71). In more chronic inflammation, COX-1 expression is higher and more prolonged than COX-2 expression and is particularly important with their contribution to the regulation of inflammatory hyperemia, which will, of course, contribute to the level of edema (32), as increased blood flow to the joint will per se increase fluid filtration and possibly contribute to edema, according to Starling’s hypothesis. Recent work has reported that COX-1 expression is increased in adjuvant-induced arthritis in rats at 15 days postinjection (20), the same point at which COX-1 ablation has significant effects on arthritis and edema in our model, thus supporting our data on a contribution of COX-1 in the later stages of arthritis. Nonspecific pharmacological COX inhibition also affects more chronic increases in joint swelling (2, 12), suggesting, in agreement with our data, that no single COX isoform is responsible for this feature of the disease, but that both contribute.

Contribution of COX Gene Products to the Development of Inflammatory Thermal Hyperalgesia and Mechanical Allodynia in Male and Female Mice

Thermal hyperalgesia. All wild-type mice developed significant primary (at the site of inflammation) thermal hyperalgesia (Fig. 3A) from day 1 (reduction of withdrawal latency from 14 ± 1 s to 4 ± 0.5 s at day 6), and this was maintained throughout the period of arthritis. No animals developed contralateral thermal hyperalgesia: "mirror hyperalgesia" (data not shown).


Figure 3
View larger version (16K):
[in this window]
[in a new window]
  		Fig. 3. Sex differences in thermal hyperalgesia. Male COX-1 –/– mice have less hyperalgesia than females. A: COX-1 knockout mice (n = 12, open squares) developed thermal hyperalgesia that was significantly less than that seen in WT controls (n = 12, solid squares), and that resolved after day 15. COX-2 knockout mice did not develop significant primary thermal hyperalgesia at any point (n = 10, open circles) (*P < 0.05, **P < 0.01, ***P < 0.0001 ANOVA followed by Bonferroni’s post hoc test). B: female COX-1 –/– (n = 5, open diamonds) and WT (n = 5, solid squares) mice developed equivalent primary thermal hyperalgesia that did not resolve. Male COX-1 –/– mice (n = 7, open triangles) developed hyperalgesia that was significantly less profound than that in female COX-1 –/– or male (n = 7) wild-type mice (*P < 0.05, **P < 0.01 ANOVA followed by Bonferroni’s post hoc test).

 
Although both male and female COX-1 –/– mice developed significant ipsilateral thermal hyperalgesia, there was a significant difference in this measure between male and female COX-1 –/– mice (Fig. 3B). For example, reductions of withdrawal latency were from 14 ± 1 s at day 0 to 4 ± 0.5 s (P < 0.001) in females at day 8 but from 15 ± 1 s at day 0 to only 9 ± 1 s (P < 0.001) in males at the same time. Male mice exhibited significantly less ipsilateral hyperalgesia for most of the study (Table 1 and Fig. 3B). Thermal hyperalgesia in female animals was not significantly different from that seen in wild-type mice of either sex (Fig. 3B). Contralateral hyperalgesia was not observed in any animal, irrespective of genotype or sex (not shown).

COX-2 knockout mice did not develop ipsilateral thermal hyperalgesia at any point, and their response latencies were significantly less than wild types at all times (Fig. 3A).

Mechanical allodynia. All wild-type mice developed significant ipsilateral mechanical allodynia, as did COX-1 –/– mice (Fig. 4A). Von Frey thresholds dropped from 3 ± 0.5 g to 1 ± 0.1 g at day 1 (P < 0.001). Ipsilateral allodynia in wild-type and COX-1 –/– animals developed rapidly (24 h) and did not resolve over 20 days. There were no observed sex differences in ipsilateral allodynia, with male and female COX-1 –/– animals showing an equivalent degree of allodynia (Table 1 and Fig. 4C) [e.g., 0.8 ± 0.1 g (female day 8), compare with 0.6 ± 0.1 (male day 8)].


Figure 4
View larger version (22K):
[in this window]
[in a new window]
  		Fig. 4. Cyclooxygenases and mechanical allodynia. COX-1 ablation inhibits contralateral allodynia in male but not female mice. A: COX-1 knockout (n = 12, open squares) and WT (n = 12, solid squares) mice all developed significant primary mechanical allodynia, which was not seen in COX-2 knockout animals (n = 10, open circles) (*P < 0.05, **P < 0.01, ***P < 0.001 ANOVA followed by Bonferroni’s post hoc test). B: COX-1 knockout (n = 12, open squares) and WT (n = 12, solid squares) mice developed significant secondary mechanical allodynia, which was not seen in COX-2 knockout animals (n = 10, open circles) (**P < 0.01, ***P < 0.001 ANOVA followed by Bonferroni). C: Male and female COX-1 knockout mice all developed significant primary allodynia equivalent to that of WT mice (n = 7 and 5, respectively, P < 0.001 ANOVA followed by Dunnett’s test). There were no significant differences between groups. D: Male COX-1 knockout animals (n = 7, open triangles) developed contralateral mechanical allodynia equivalent to that seen in WT controls (solid triangles), but this was not seen in female COX-1 knockout animals (n = 5, open diamonds) (*P < 0.05, **P < 0.01 ANOVA followed by Bonferroni’s test).

 
Neither male nor female COX-2 –/– mice developed ipsilateral allodynia at any point (Fig. 4A), suggesting that COX-2 has a significant role in the initiation and maintenance of allodynic responses in inflammatory arthritis.

Wild-type and male COX-1 –/– mice also developed significant contralateral mechanical allodynia in the uninflamed paw (Fig. 4B). Female mice had no significant reduction in threshold compared with control preinjection values, whereas male COX-1 –/– mice showed withdrawal thresholds of a similar magnitude to wild-type animals (Table 1, Fig. 4D).

COX-2 –/– animals did not develop secondary mechanical allodynia (Fig. 4B) irrespective of sex. Thus in the COX-2 –/– line, neither thermal hyperalgesia nor mechanical allodynia was seen in knockout mice. In the COX-1 –/– mice, females showed more profound changes in thermal hyperalgesia than males despite a greater degree of inflammation in males. In contrast, male and female COX-1 –/– mice developed equal levels of ipsilateral allodynia, whereas only male, and not females, showed significant contralateral allodynia (Table 1).

There is extensive literature on the role of cyclooxygenases in nociceptive processing, most of which supports an important role for the inducible isoform COX-2, in agreement with our data (25, 57, 58, 73, 83). The complete lack of hyperalgesia and allodynia in COX-2 mice is presumably a combination of the lack of both inducible COX-2 expressions at the site of inflammation and within the spinal cord; both areas in which COX-2 expression is increased during peripheral inflammation (9, 53), thus affecting both peripheral and central effects of prostaglandins on nociceptive neurons.

There is a paucity of evidence on a potential contribution of COX-1 to pain in arthritis, although COX-1 inhibition does attenuate nociception in some models (8, 58). Nonspecific pharmacological inhibition of COX has previously shown a greater contribution of prostaglandins to the development of allodynia as opposed to hyperalgesia (46).

Contralateral hyperalgesia and allodynia have been described in various models by different laboratories, and this "mirror pain" is considered to be a form of secondary hyperalgesia or allodynia (4, 6, 17, 52, 74). Secondary hyperalgesia and allodynia are mediated through activation of spinal neurons, and it is assumed that contralateral alterations in nociceptive processing are mediated through similar processes (29, 54). A large body of evidence, gathered over the past 7 years, on the actions of prostaglandins in the CNS [excellently reviewed by Vanegas and Schaible (75)] shows that centrally administered prostaglandins can result in allodynia. Intrathecal administration of both PGE2 and PGF2{alpha} results in allodynia. PGE2 is thought to exert this action through EP1 and EP3 receptors, as agonists at these receptors also cause allodynia (75). These effects require capsaicin-sensitive primary afferents to be functional. Recent data also support previous findings on the contribution of EP2 receptors to inflammatory secondary hyperalgesia and allodynia (67). Our data therefore suggest that the effect of COX-1 knockout on contralateral allodynia may be mediated through an effect on PGE2 production within the central nervous system, rather than a direct effect on the primary afferent, as COX-1 knockout in females had no effect on primary allodynia.

Analysis of our data demonstrates a sexually dimorphic role for COX-1 in joint destruction, edema, and nociceptive processing. There are many reports of sexual differences in pain responses, in humans and animals (10) and in both inflammatory and neuropathic pain (13, 51). For example, women are more likely to be prescribed NSAIDs than men in the treatment of osteoarthritis (27). Our data agree with studies that show that females show greater sensitivity to thermal (13, 23) and males greater sensitivity to mechanical stimulation (23). Sex differences in nociceptive processing have been attributable to estrogens and their suppression of nociceptive signaling in females (13, 23), together with some contribution from androgens (5). Sex differences in opioid analgesic efficacy have been previously reported (e.g., Ref. 37), as have sex differences in NSAID efficacy (76). It is, however, unclear from our data whether estrogens or androgens or both could mediate the effects we describe, as estrogens can regulate both COX isoforms to some degree. Testosterone can both enhance COX-2 expression (63) and inhibit prostaglandin production (60). We are not aware of any studies that have examined the role of testosterone in prostaglandin production in arthritis.

We have shown that COX gene disablement has effects on both disease severity and nociception, in a sex-specific manner. COX 1 knockout females have less severe bone destruction and inflammation. Males exhibit less thermal hyperalgesia than females, but they develop more contralateral mechanical allodynia. COX 2 knockout females have less severe bone destruction and inflammation and exhibit decreased thermal hyperalgesia compared with male knockouts or wild types of either sex.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by a grant from the Arthritis Research Campaign, UK. N. L. Chillingworth was funded by a Department of Physiology, University of Bristol Postgraduate Studentship.

Present address of N. L. Chillingworth: Department of Biology and Biochemistry, University of Bath, Claverton Down, Bath, BA2 7AY UK.


   FOOTNOTES
 

Address for reprint requests and other correspondence: L. F. Donaldson, Dept. of Physiology, Univ. of Bristol, School of Medical Sciences, Faculty of Medical and Veterinary Sciences, University Walk, Bristol BS8 1TD, UK (E-mail: Lucy.Donaldson{at}bris.ac.uk)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 GRANTS
 REFERENCES
 

  1. Ackerman NR, Kappas K, and Maloney P. Possible disease-modifying effects of naproxen in the adjuvant-arthritic rat. Agents Actions 15: 428–435, 1984.[Medline]
  2. Ackerman NR, Rooks WH, 2nd Shott L, Genant H, Maloney P, and West E. Effects of naproxen on connective tissue changes in the adjuvant arthritic rat. Arthritis Rheum 22: 1365–1374, 1979.[Web of Science][Medline]
  3. Affleck G, Tennen H, Keefe FJ, Lefebvre JC, Kashikar-Zuck S, Wright K, Starr K, and Caldwell DS. Everyday life with osteoarthritis or rheumatoid arthritis: independent effects of disease and gender on daily pain, mood, and coping. Pain 83: 601–609, 1999.[CrossRef][Web of Science][Medline]
  4. Ainsworth L, Budelier K, Clinesmith M, Fiedler A, Landstrom R, Leeper BJ, Moeller L, Mutch S, O’Dell K, and Ross J. Transcutaneous electrical nerve stimulation (TENS) reduces chronic hyperalgesia induced by muscle inflammation. Pain 120: 182–187, 2006.[CrossRef][Web of Science][Medline]
  5. Aloisi AM, Ceccarelli I, and Fiorenzani P. Gonadectomy affects hormonal and behavioral responses to repetitive nociceptive stimulation in male rats. Ann NY Acad Sci 1007: 232–237, 2003.[CrossRef][Medline]
  6. Aloisi AM, Porro CA, Cavazzuti M, Baraldi P, and Carli G. ’Mirror pain’ in the formalin test: behavioral and 2-deoxyglucose studies. Pain 55: 267–273, 1993.[CrossRef][Web of Science][Medline]
  7. Arthritis Research Campaign. Arthritis: The Big Picture, 2002. [The data are available at http://www.arc.org.uk/about_arth/bigpic.htm]
  8. Ballou LR, Botting RM, Goorha S, Zhang J, and Vane JR. Nociception in cyclooxygenase isozyme-deficient mice. Proc Natl Acad Sci USA 97: 10272–10276, 2000.[Abstract/Free Full Text]
  9. Beiche F, Scheuerer S, Brune K, Geisslinger G, and Goppelt-Struebe M. Up-regulation of cyclooxygenase-2 mRNA in the rat spinal cord following peripheral inflammation. FEBS Lett 390: 165–169, 1996.[CrossRef][Web of Science][Medline]
  10. Berkley KJ. Sex differences in pain. Behav Brain Sci 20: 371–380; discussion 435–513, 1997.[CrossRef][Web of Science][Medline]
  11. Bertolini A, Ottani A, and Sandrini M. Dual acting anti-inflammatory drugs: a reappraisal. Pharmacol Res 44: 437–450, 2001.[CrossRef][Web of Science][Medline]
  12. Blackham A, Burns JW, Farmer JB, Radziwonik H, and Westwick J. An X-ray analysis of adjuvant arthritis in the rat. The effect of prednisolone and indomethacin. Agents Actions 7: 145–151, 1977.[Medline]
  13. Bradshaw H, Miller J, Ling Q, Malsnee K, and Ruda MA. Sex differences and phases of the estrous cycle alter the response of spinal cord dynorphin neurons to peripheral inflammation and hyperalgesia. Pain 85: 93–99, 2000.[CrossRef][Web of Science][Medline]
  14. Breder CD, Dewitt D, and Kraig RP. Characterization of inducible cyclooxygenase in rat brain. J Comp Neurol 355: 296–315, 1995.[CrossRef][Web of Science][Medline]
  15. Breder CD, Smith WL, Raz A, Masferrer J, Seibert K, Needleman P, and Saper CB. Distribution and characterization of cyclooxygenase immunoreactivity in the ovine brain. J Comp Neurol 322: 409–438, 1992.[CrossRef][Web of Science][Medline]
  16. Butler SH, Godefroy F, Besson JM, and Weil-Fugazza J.. A limited arthritic model for chronic pain studies in the rat. Pain 48: 73–81, 1992.[CrossRef][Web of Science][Medline]
  17. Chen J, Luo C, Li H, and Chen H. Primary hyperalgesia to mechanical and heat stimuli following subcutaneous bee venom injection into the plantar surface of hindpaw in the conscious rat: a comparative study with the formalin test. Pain 83: 67–76, 1999.[CrossRef][Web of Science][Medline]
  18. Chillingworth NL and Donaldson LF. Characterisation of a Freund’s complete adjuvant-induced model of chronic arthritis in mice. J Neurosci Methods 128: 45–52, 2003.[CrossRef][Medline]
  19. Chopra B, Giblett S, Little JG, Donaldson LF, Tate S, Evans RJ, and Grubb BD. Cyclooxygenase-1 is a marker for a subpopulation of putative nociceptive neurons in rat dorsal root ganglia. Eur J Neurosci 12: 911–920, 2000.[CrossRef][Web of Science][Medline]
  20. Claveau D, Sirinyan M, Guay J, Gordon R, Chan CC, Bureau Y, Riendeau D, and Mancini JA. Microsomal prostaglandin E synthase-1 is a major terminal synthase that is selectively up-regulated during cyclooxygenase-2-dependent prostaglandin E2 production in the rat adjuvant-induced arthritis model. J Immunol 170: 4738–4744, 2003.[Abstract/Free Full Text]
  21. Crofford LJ. Is there a place for non-selective NSAIDs in the treatment of arthritis? Joint Bone Spine 69: 4–7, 2002.[Medline]
  22. Crofford LJ, Wilder RL, Ristimaki AP, Sano H, Remmers EF, Epps HR, and Hla T. Cyclooxygenase-1 and -2 expression in rheumatoid synovial tissues. Effects of interleukin-1 beta, phorbol ester, and corticosteroids. J Clin Invest 93: 1095–1101, 1994.[Web of Science][Medline]
  23. Dina OA, Aley KO, Isenberg W, Messing RO, and Levine JD. Sex hormones regulate the contribution of PKCepsilon and PKA signalling in inflammatory pain in the rat. Eur J Neurosci 13: 2227–2233, 2001.[CrossRef][Web of Science][Medline]
  24. Dirig DM, Isakson PC, and Yaksh TL. Effect of COX-1 and COX-2 inhibition on induction and maintenance of carrageenan-evoked thermal hyperalgesia in rats. J Pharmacol Exp Ther 285: 1031–1038., 1998.[Abstract/Free Full Text]
  25. Dirig DM, Konin GP, Isakson PC, and Yaksh TL. Effect of spinal cyclooxygenase inhibitors in rat using the formalin test and in vitro prostaglandin E2 release. Eur J Pharmacol 331: 155–160, 1997.[CrossRef][Web of Science][Medline]
  26. Dirig DM and Yaksh TL. Spinal synthesis and release of prostanoids after peripheral injury and inflammation. Adv Exp Med Biol 469: 401–408, 1999.[Web of Science][Medline]
  27. Dominick KL, Ahern FM, Gold CH, and Heller DA. Gender differences in NSAID use among older adults with osteoarthritis. Ann Pharmacother 37: 1566–1571, 2003.[Abstract/Free Full Text]
  28. Donaldson LF. The primary Afferent Nociceptor and Neuropeptide Gene Expression: Importance in Experimental Arthritis. (PhD thesis). Edinburgh, UK: University of Edinburgh, 1994.
  29. Donaldson LF. Unilateral arthritis: contralateral effects. Trends Neurosci 22: 495–496, 1999.[Medline]
  30. Donaldson LF, Seckl JR, and McQueen DS. A discrete adjuvant-induced monoarthritis in the rat: effects of adjuvant dose. J Neurosci Methods 49: 5–10, 1993.[CrossRef][Web of Science][Medline]
  31. Dou W, Jiao Y, Goorha S, Raghow R, and Ballou LR. Nociception and the differential expression of cyclooxygenase-1 (COX-1), the COX-1 variant retaining intron-1 (COX-1v), and COX-2 in mouse dorsal root ganglia (DRG). Prostaglandins Other Lipid Mediat 74: 29–43, 2004.[CrossRef][Web of Science][Medline]
  32. Egan CG, Lockhart JC, Ferrell WR, Day SM, and McLean JS. Pathophysiological basis of acute inflammatory hyperaemia in the rat knee: roles of cyclo-oxygenase-1 and -2. J Physiol 539: 579–587, 2002.[Abstract/Free Full Text]
  33. Egan KM, Lawson JA, Fries S, Koller B, Rader DJ, Smyth EM, and FitzGerald GA. COX-2-derived prostacyclin confers atheroprotection on female mice. Science 306: 1954–1957, 2004.[Abstract/Free Full Text]
  34. Euchenhofer C, Maihofner C, Brune K, Tegeder I, and Geisslinger G. Differential effect of selective cyclooxygenase-2 (COX-2) inhibitor NS 398 and diclofenac on formalin-induced nociception in the rat. Neurosci Lett 248: 25–28, 1998.[CrossRef][Web of Science][Medline]
  35. Francischi JN, Chaves CT, Moura AC, Lima AS, Rocha OA, Ferreira-Alves DL, and Bakhle YS. Selective inhibitors of cyclooxygenase-2 (COX-2) induce hypoalgesia in a rat paw model of inflammation. Br J Pharmacol 137: 837–844, 2002.[CrossRef][Medline]
  36. Friedman ES, LaNatra N, and Stiller MJ. NSAIDs in dermatologic therapy: review and preview. J Cutan Med Surg 6: 449–459, 2002.[Medline]
  37. Gear RW, Miaskowski C, Gordon NC, Paul SM, Heller PH, and Levine JD. The kappa opioid nalbuphine produces gender- and dose-dependent analgesia and antianalgesia in patients with postoperative pain. Pain 83: 339–345, 1999.[CrossRef][Web of Science][Medline]
  38. Gentilli M, Mazoit JX, Bouaziz H, Fletcher D, Casper RF, Benhamou D, and Savouret JF. Resveratrol decreases hyperalgesia induced by carrageenan in the rat hind paw. Life Sci 68: 1317–1321, 2001.[CrossRef][Web of Science][Medline]
  39. Gilroy DW, Tomlinson A, Greenslade K, Seed MP, and Willoughby DA. The effects of cyclooxygenase 2 inhibitors on cartilage erosion and bone loss in a model of Mycobacterium tuberculosis-induced monoarticular arthritis in the rat. Inflammation 22: 509–519, 1998.[CrossRef][Medline]
  40. Gilroy DW, Tomlinson A, and Willoughby DA. Differential effects of inhibition of isoforms of cyclooxygenase (COX-1, COX-2) in chronic inflammation. Inflamm Res 47: 79–85, 1998.[CrossRef][Web of Science][Medline]
  41. Gilroy DW, Tomlinson A, and Willoughby DA. Differential effects of inhibitors of cyclooxygenase (cyclooxygenase 1 and cyclooxygenase 2) in acute inflammation. Eur J Pharmacol 355: 211–217, 1998.[CrossRef][Web of Science][Medline]
  42. Hannon R, Croxtall JD, Getting SJ, Roviezzo F, Yona S, Paul-Clark MJ, Gavins FNE, Perretti M, Morris JF, Buckingham JC, and Flower RJ. Aberrant inflammation and resistance to glucocorticoids in annexin 1-/- mouse. FASEB J 17: 253–255, 2003.[Abstract/Free Full Text]
  43. Harder AT and An YH. The mechanisms of the inhibitory effects of nonsteroidal anti-inflammatory drugs on bone healing: A concise review. J Clin Pharmacol 43: 807–815, 2003.[Abstract/Free Full Text]
  44. Hargreaves K, Dubner R, Brown F, Flores C, and Joris J. A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain 32: 77–88, 1988.[CrossRef][Web of Science][Medline]
  45. Harley C and Wagner S. The prevalence of cardiorenal risk factors in patients prescribed nonsteroidal anti-inflammatory drugs: Data from managed care. Clin Ther 25: 139–149, 2003.[CrossRef][Web of Science][Medline]
  46. Hay CH, Trevethick MA, Wheeldon A, Bowers JS, and de Belleroche JS. The potential role of spinal cord cyclooxygenase-2 in the development of Freund’s complete adjuvant-induced changes in hyperalgesia and allodynia. Neuroscience 78: 843–850, 1997.[CrossRef][Web of Science][Medline]
  47. Helin-Salmivaara A, Klaukka T, and Huupponen R. Heavy users of non-steroidal anti-inflammatory drugs: a nationwide prescription database study in Finland. Eur J Clin Pharmacol 59: 477–482, 2003.[CrossRef][Medline]
  48. Holmdahl R. Female preponderance for development of arthritis in rats is influenced by both sex chromosomes and sex steroids. Scand J Immunol 42: 104–109, 1995.[CrossRef][Web of Science][Medline]
  49. Igarashi K, Woo JT, and Stern PH. Effects of a selective cyclooxygenase-2 inhibitor, celeCOXib, on bone resorption and osteoclastogenesis in vitro. Biochem Pharmacol 63: 523–532, 2002.[CrossRef][Medline]
  50. Iniguez MA, Pablos JL, Carreira PE, Cabre F, and Gomez-Reino JJ. Detection of COX-1 and COX-2 isoforms in synovial fluid cells from inflammatory joint diseases. Br J Rheumatol 37: 773–778, 1998.[Abstract/Free Full Text]
  51. Joseph EK and Levine JD. Sexual dimorphism for protein kinase c epsilon signaling in a rat model of vincristine-induced painful peripheral neuropathy. Neuroscience 119: 831–838, 2003.[CrossRef][Medline]
  52. Sluka KA, Kalra A, and Moore SA. Unilateral intramuscular injections of acidic saline produce a bilateral, long-lasting hyperalgesia. Muscle Nerve 24: 37–46, 2001.[CrossRef][Web of Science][Medline]
  53. Kang RY, Freire-Moar J, Sigal E, and Chu CQ. Expression of cyclooxygenase-2 in human and an animal model of rheumatoid arthritis. Br J Rheumatol 35: 711–718, 1996.[Abstract/Free Full Text]
  54. Koltzenburg M, Wall PD, and McMahon SB. Does the right side know what the left is doing? Trends Neurosci 22: 122–127, 1999.[CrossRef][Web of Science][Medline]
  55. Langenbach R, Morham SG, Tiano HF, Loftin CD, Ghanayem BI, Chulada PC, Mahler JF, Lee CA, Goulding EH, Kluckman KD, Kim, HS, and Smithies O. Prostaglandin synthase 1 gene disruption in mice reduces arachidonic acid-induced inflammation and indomethacin-induced gastric ulceration. Cell 83: 483–492, 1995.[CrossRef][Web of Science][Medline]
  56. Lee YH, Choi SJ, Kim A, Kim CH, Ji JD, and Song GG. Expression of cyclooxygenase-1 and -2 in rheumatoid arthritis synovium. J Korean Med Sci 15: 88–92, 2000.[Medline]
  57. Martinez RV, Reval M, Campos MD, Terron JA, Dominguez R, and Lopez-Munoz FJ. Involvement of peripheral cyclooxygenase-1 and cyclooxygenase-2 in inflammatory pain. J Pharm Pharmacol 54: 405–412, 2002.[CrossRef][Web of Science][Medline]
  58. Mazario J, Gaitan G, and Herrero JF. Cyclooxygenase-1 vs. cyclooxygenase-2 inhibitors in the induction of antinociception in rodent withdrawal reflexes. Neuropharmacology 40: 937–946, 2001.[CrossRef][Web of Science][Medline]
  59. Meli R, Antonelli E, and Cirino G. Analgesia and cyclo-oxygenase inhibitors. Dig Liver Dis 33: S8–S11, 2001.[Medline]
  60. Miyagi M, Morishita M, and Iwamoto Y. Effects of sex hormones on production of prostaglandin E2 by human peripheral monocytes. J Periodontol 64: 1075–1078, 1993.[Web of Science][Medline]
  61. Morham SG, Langenbach R, Loftin CD, Tiano HF, Vouloumanos N, Jennette JC, Mahler JF, Kluckman KD, Ledford A, Lee CA, and Smithies O. Prostaglandin synthase 2 gene disruption causes severe renal pathology in the mouse. Cell 83: 473–482, 1995.[CrossRef][Web of Science][Medline]
  62. Myers LK, Kang AH, Postlethwaite AE, Rosloniec EF, Morham SG, Shlopov BV, Goorha S, and Ballou LR. The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis. Arthritis Rheum 43: 2687–2693. 2000.[CrossRef][Web of Science][Medline]
  63. Neeraja S, Sreenath AS, Reddy PR, and Reddanna P. Expression of cyclooxygenase-2 in rat testis. Reprod Biomed Online 6: 302–309, 2003.[Medline]
  64. Ochi T and Goto T. Anti-inflammatory activity of a novel selective cyclooxygenase-2 inhibitor, FR140423, on type II collagen-induced arthritis in Lewis rats. Prostaglandins Other Lipid Mediat 66: 317–327, 2001.[Medline]
  65. Ospina JA, Krause DN, and Duckles SP. 17beta-estradiol increases rat cerebrovascular prostacyclin synthesis by elevating cyclooxygenase-1 and prostacyclin synthase. Stroke 33: 600–605, 2002.[Abstract/Free Full Text]
  66. Pinheiro RM and Calixto JB. Effect of the selective COX-2 inhibitors, celecoxib and rofecoxib in rat acute models of inflammation. Inflamm Res 51: 603–610, 2002.[CrossRef][Medline]
  67. Reinold H, Ahmadi S, Depner UB, Layh B, Heindl C, Hamza M, Pahl A, Brune K, Narumiya S, Muller U, and Zeilhofer HU. Spinal inflammatory hyperalgesia is mediated by prostaglandin E receptors of the EP2 subtype. J Clin Invest 115: 673–679, 2005.[CrossRef][Web of Science][Medline]
  68. Roos KL and Simmons DL. Cyclooxygenase variants: the role of alternative splicing. Biochem Biophys Res Commun 338: 62–69, 2005.[CrossRef][Web of Science][Medline]
  69. Samad TA, Moore KA, Sapirstein A, Billet S, Allchorne A, Poole S, Bonventre JV, and Woolf CJ. Interleukin-1beta-mediated induction of COX-2 in the CNS contributes to inflammatory pain hypersensitivity. Nature 410: 471–475, 2001.[CrossRef][Medline]
  70. Sigthorsson G, Simpson RJ, Walley M, Anthony A, Foster R, Hotz-Behoftsitz C, Palizban A, Pombo J, Watts J, Morham SG, and Bjarnason I. COX-1 and 2, intestinal integrity, and pathogenesis of nonsteroidal anti-inflammatory drug enteropathy in mice. Gastroenterology 122: 1913–1923, 2002.[CrossRef][Web of Science][Medline]
  71. Siqueira-Junior JM, Peters RR, Brum-Fernandes AJ, and Ribeiro-do-Valle RM. Effects of valeryl salicylate, a COX-1 inhibitor, on models of acute inflammation in mice. Pharmacol Res 48: 437–443, 2003.[CrossRef][Medline]
  72. Smith CJ, Zhang Y, Koboldt CM, Muhammad J, Zweifel BS, Shaffer A, Talley JJ, Masferrer JL, Seibert K, and Isakson PC. Pharmacological analysis of cyclooxygenase-1 in inflammation. Proc Natl Acad Sci USA 95: 13313–13318, 1998.[Abstract/Free Full Text]
  73. Suzuki M, Hayash I, Nara Y, Kumaga Y, Okamoto H, Hoka S, and Majima M. Participation of cyclooxygenases in cutaneous thermal nociception under non-inflamed and inflamed conditions. Inflamm Res 50: 283–287, 2001.[Medline]
  74. Turnbach ME, Seth Spraggins D, and Randich A. Spinal administration of prostaglandin E2 or prostaglandin F2{alpha} primarily produces mechanical hyperalgesia that is mediated by nociceptive specific spinal dorsal horn neurons. Pain 97: 33–45, 2002.[CrossRef][Web of Science][Medline]
  75. Vanegas H and Schaible HG. Prostaglandins and cyclooxygenases in the spinal cord. Prog Neurobiol 64: 327–363, 2001.[CrossRef][Web of Science][Medline]
  76. Walker JS and Carmody JJ. Experimental pain in healthy human subjects: gender differences in nociception and in response to ibuprofen. Anesth Analg 86: 1257–1262, 1998.[Abstract]
  77. Wallace JL, Bak A, McKnight W, Asfaha S, Sharkey KA, and MacNaughton WK. Cyclooxygenase 1 contributes to inflammatory responses in rats and mice: implications for gastrointestinal toxicity. Gastroenterology 115: 101–109, 1998.[CrossRef][Web of Science][Medline]
  78. Wallace JL, McKnight W, Reuter BK, and Vergnolle N. NSAID-induced gastric damage in rats: requirement for inhibition of both cyclooxygenase 1 and 2. Gastroenterology 119: 706–714, 2000.[CrossRef][Web of Science][Medline]
  79. Wilder RL. Rheumatoid arthritis: epidemiology, patholgy, and pathogenesis In: Primer on the Rhuematic Diseases (10th ed.), edited by Schumacher R, Klippel J, and Koopman W. Atlanta, GA: The Arthritis Foundation, 1993, p. 86–89.
  80. Wilder RL, Calandra GB, Garvin AJ, Wright KD, and Hansen CT. Strain and sex variation in the susceptibility to streptococcal cell wall-induced polyarthritis in the rat. Arthritis Rheum 25: 1064–1072, 1982.[Web of Science][Medline]
  81. Willingale HL, Gardiner NJ, McLymont N, Giblett S, and Grubb BD. Prostanoids synthesized by cyclo-oxygenase isoforms in rat spinal cord and their contribution to the development of neuronal hyperexcitability. Br J Pharmacol 122: 1593–1604, 1997.[CrossRef][Web of Science][Medline]
  82. Yamada R, Sano H, Hla T, Hashiramoto A, Kawahito Y, Mukai S, Kohno M, Tsubouchi Y, Inoue M, Komatsu A, Inoue K, and Kondo M. Selective inhibition of cyclooxygenase-2 with antisense oligodeoxynucleotide restricts induction of rat adjuvant-induced arthritis. Biochem Biophys Res Commun 269: 415–421, 2000.[Medline]
  83. Zhao Z, Chen SR, Eisenach JC, Busija DW, and Pan HL. Spinal cyclooxygenase-2 is involved in development of allodynia after nerve injury in rats. Neuroscience 97: 743–748, 2000.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
M. Granado, A. I Martin, M{a} A. Villanua, and A. Lopez-Calderon
Experimental arthritis inhibits the insulin-like growth factor-I axis and induces muscle wasting through cyclooxygenase-2 activation
Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1656 - E1665.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. J. Berkley, S. S. Zalcman, and V. R. Simon
Sex and gender differences in pain and inflammation: a rapidly maturing field
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2006; 291(2): R241 - R244.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/2/R327    most recent
00901.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chillingworth, N. L.
Right arrow Articles by Donaldson, L. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chillingworth, N. L.
Right arrow Articles by Donaldson, L. F.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.