AJP - Regu Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 292: R217-R226, 2007. First published August 24, 2006; doi:10.1152/ajpregu.00852.2005
0363-6119/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/1/R217    most recent
00852.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Will, M. J.
Right arrow Articles by Kelley, A. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Will, M. J.
Right arrow Articles by Kelley, A. E.

REPORT

APPETITE, OBESITY, DIGESTION, AND METABOLISM

Striatal opioid peptide gene expression differentially tracks short-term satiety but does not vary with negative energy balance in a manner opposite to hypothalamic NPY

Matthew J. Will, William M. Vanderheyden, and Ann E. Kelley

Department of Psychiatry, University of Wisconsin-Madison Medical School, Madison, Wisconsin

Submitted 5 December 2005 ; accepted in final form 29 June 2006

ABSTRACT

It has long been known that central opioid systems play an important role in certain aspects of appetite and food intake, particularly with regard to the hedonic or rewarding impact of calorically dense food, such as fat and sugar. Ventral striatal enkephalin may be a key component of this system, as infusions of µ-opiate agonists into this region strongly increase feeding, whereas infusions of opiate antagonists decrease food intake. While pharmacological analysis has consistently supported such a role, direct measurement of enkephalin gene expression in relation to differing food motivational conditions has not been examined. In this study, the effects of a restricted laboratory chow diet (resulting in negative energy balance) as well has recent consumption of chow (short-term satiety) on striatal preproenkephalin (PPE) and prodynorphin (PD) mRNA expression were measured in rats, using both Northern blot analysis and in situ hybridization methods. As a comparison, hypothalamic (arcuate nucleus) neuropeptide Y (NPY) was also measured in these conditions. PPE expression was broadly downregulated throughout the striatum in animals that had recently consumed a meal, whereas it was unaffected by negative energy balance. Expression of an additional striatal peptide gene, PD, did not follow this pattern, although diet restriction caused a decrease in accumbens core dynorphin mRNA. Conversely, as expected, arcuate nucleus NPY mRNA expression was markedly upregulated by negative energy balance, but was unchanged by recent food consumption. This double dissociation between striatal and hypothalamic peptide systems suggests a specific role for striatal PPE in relatively short-term food motivational states, but not in long-term metabolic responses to diet restriction.

preproenkephalin; motivation; satiety prodynorphin; rat


CURRENTLY THERE IS MUCH CONCERN about the worldwide epidemic of obesity. In the past several decades, there has been a steep rise in the prevalence of overweight and obesity, as well as the medical complications that accompany these conditions, such as type 1 diabetes and cardiovascular illnesses (24). Although there is much debate about the relative contributions of various factors, such as changes in exercise patterns, genetic predisposition, and overeating, it is clear that the widespread availability of calorically dense foodstuffs, such as those high in fat and sugar, play a critical role in the obesity epidemic (7).

Because of this epidemic, in recent years there has been a great deal of attention devoted to further understanding the neural pathways and molecular signaling that govern appetite and ingestive behavior (52, 54, 71). Much research has focused on the integration of hypothalamic neuronal processing with signals from the periphery. For example, it is now well established that neurons in the arcuate nucleus are sensitive to circulating factors, such as leptin and ghrelin, and that through their output to the other hypothalamic regions, such as the lateral hypothalamus and periventricular nucleus, promote or restrain feeding (16). The output of these systems, reaching brain stem, neuroendocrine, and limbic networks coordinates the complex behavioral and autonomic patterns that accompany feeding or satiety.

While hypothalamic and brain stem controllers are critical to many aspects of feeding behavior, it is important to consider how corticostriatal networks contribute to the endpoints of ingestion or restraint of ingestion. Emerging research on cortical and basal ganglia function has led to the development of models of higher order, executive control of voluntary motor behavior, including feeding. For example, processes, such as the computation of motor effort to be allocated to obtaining food, the devaluation of the incentive value of food by sensory-specific satiety, and the hedonic impact of preferred foods are now thought to be mediated by networks linking the amygdala, prefrontal cortex, and ventral striatum (1, 11, 29, 51, 53, 65). Human neuroimaging data show that activation in cortical and basal ganglia regions is a prominent aspect of brain activity patterns following exposure to highly preferred food or stimuli associated with food (15, 36, 37, 59, 65). These examples illustrate that critical aspects of the feeding motivational state are controlled by "higher order" corticolimbic substrates, which ultimately influence feeding-related behavioral sequences via their efferent control of effector sites within the hypothalamus and brain stem.

In this regard, a considerable amount of recent research has focused on the role of opioid peptides and opiate receptors within the striatum. It has long been postulated that central opioids play a major role in food intake, and more specifically in palatability and the hedonic impact of energy-dense foods (12, 13, 34, 38, 70). The ventral and dorsal striatum are rich in the peptides enkephalin and dynorphin, which are localized in separate populations of medium-sized spiny neurons and contain high levels of µ-, {delta}-, and {kappa}-opiate receptors. Much research suggests that release of enkephalin and stimulation of µ-opiate receptors within the ventral striatum is associated with enhanced intake of highly palatable food (28). However, most of this work has used indirect methods, such as local administration of specific agonists or antagonists, to reveal the potential role of striatal opioids in feeding (e.g., 9, 45, 74). Little attention has been given to the question of whether the expression of genes encoding these striatal opioid peptides varies with changes in food motivational state. Thus, in the present study, we aimed to investigate the activity of preproenkephalin (PPE) and prodynorphin (PD) mRNA in rats with varying motivational conditions, such as hunger and satiety. These profiles were compared with the profile of neuropeptide Y (NPY) expression within the arcuate nucleus of the hypothalamus, which is well established to increase with food deprivation (31).

METHODS

Subjects. Adult male Sprague-Dawley rats (total n = 28, Harlan Sprague Dawley, Indianapolis, IN) weighing 300–400 g were maintained in a temperature- and humidity-controlled animal colony on a 12:12-h light-dark cycle (lights off at 1900). All subjects were naive and were allowed a minimum of a week adaptation followed by 2 days of daily handling before the beginning of the experiment. Subjects had either free access to normal laboratory chow (24% protein, 4% fat; ad libitum group) or were gradually brought to 85% of their original body weight (food-restricted group), as described below. Drinking water was available ad libitum for both groups throughout the experiment, and animals were weighed daily.

Experimental procedures. For experiment 1 (Northern blot analysis of accumbens PPE and hypothalamic NPY), there were two main groups (n = 6/group): rats that were maintained on an ad libitum diet (ad libitum group) and those that were maintained at 85% free-feeding weight (restricted diet group). The restricted diet group was gradually brought down to 85% over the first week of the experiment, and over the second week were weight stable at this restricted level. On the last day of the experiment, at 1800, food (chow) was removed from half of the subjects in each group, while a measured amount of food was given to the other subjects (18 g/cage). Thus, there were four final treatment conditions: ad libitum diet with food present (NR+), ad libitum diet with the food removed (NR–), restricted diet with food present (R+), and restricted diet with no food present (R–). Because the rats normally become aroused and feed when the lights go off, animals that were given food fed at their usual time, whether food restricted or not. The rats were then killed at 2030, 2.5 h after food was given and lights went out. This was accomplished by isoflurane anesthesia and decapitation. The time point was chosen on the basis of pilot data in our laboratory, indicating a relatively slow response of PPE to stimulus events (in contrast to, for example, immediate early genes, which can respond very quickly to stimulus events). This design, schematically presented in Fig. 1A, allowed the assessment of two factors on gene expression: 1) chronic food restriction (negative energy balance) and whether animals had recently consumed a meal or not (acute motivational condition), and 2) their potential interaction. In experiment 2, this exact same procedure was repeated (n = 8/group), but in this case tissue was prepared for in situ hybridization as described below (see Fig. 1C). All experimental procedures were in accord with protocols approved by the University of Wisconsin Institutional Animal Care and Use Committee.


Figure 1
View larger version (33K):
[in this window]
[in a new window]

 
Fig. 1. A: schematic diagram of experimental paradigm. Different groups of rats were placed on either a restricted feeding regimen or had food (normal laboratory chow) ad libitum for 2 wk (see text for details). For the restricted group, over the first week weight was gradually reduced to the target 85% and over the second week, these rats were weight stable at this level. On the test evening, half of the rats in each group were given food and half were denied food. Rats were killed (Sac) 2.5 h after food was given and lights were turned out. B: sections depicting the punches taken, within the nucleus accumbens (including AcbC, accumbens core; AcbSh, accumbens shell; LAcbSh, lateral accumbens shell), and ventromedial hypothalamus (Arc, arcuate nucleus; VMHA, ventromedial hypothalamic area), for the Northern blot analysis experiment. C: areas of interest that were analyzed in the in situ hybridization experiment. A, olfactory tubercle; B, accumbens core; C, lateral accumbens shell; D, medial accumbens shell; E, anterior dorsal striatum (ADS); F, medial striatum (MS), G, ventrolateral striatum (VLS), H, dorsolateral striatum (DLS). Drawings of sections are adapted from Paxinos and Watson (43a), 1998.

 
Probe generation. For Northern blot analysis, DNA templates were generated by PCR (see primer list below) from total brain RNA using standard techniques. They were then labeled with 32P using the Megaprime DNA labeling system (Amersham Biosciences, England). For in situ hybridization, rat-specific 35S-labeled cRNA probes were transcribed from a DNA clone tagged with a T7 primer at the 3' end (PerkinElmer Life Sciences). Templates for in vitro transcription were generated by PCR from total brain RNA. Complementary DNA for PPE, PD, and NPY used for in situ hybridization was amplified from this library using standard PCR procedures. The following primers were used to generate PCR products for the gene indicated: PPE, forward primer 5'-ACCTTGTCAGAGACAGAACGG-3', reverse primer 5'-CCTCGTGGTCTGGATAACTGC-3'; PD, forward primer 5'-CTTCAAGGCTTCCTCTGTGG-3', reverse primer 5'-CGTTTCTGGTTGTCCCACTT-3'; NPY, forward primer 5'-TGGACTGACCCTCGCTCTATC, reverse primer 5'-ACAACGACAACAAGGGAAATG-3'. A T7 polymerase recognition sequence (GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG) was added to the 5' end of each reverse primer for use in generating the 35S-labeled antisense probe.

Northern blot analysis. Animals were killed as described above, and brains were rapidly removed and cooled. The brain was then dissected on a cold dissecting dish, and 3-mm punches were taken from the nucleus accumbens (tissue from each hemisphere was pooled, and no distinction was made between core and shell subregions; see Fig. 1B). Tissue was stored at –80°C. RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA) using the manufacturer's suggested protocol. Briefly, tissue punches from brain were homogenized in Trizol reagent using a Tissue Tearror (Biospec Products, Bartlesville, OK) and phase separated using chloroform. Total mRNA was precipitated using isopropyl alcohol and washed in 70% ethanol before being reconstituted in diethylpyrocarbonate-treated H2O. The concentration of RNA was determined using the RiboGreen (Molecular Probes, Eugene, OR) method, and RNA quality was assessed using agarose electrophoresis.

One microgram of total RNA from each rat was electrophoresed on a 1.2% agarose/formaldehyde/1x MOPS gel. The gels were transferred to GeneScreen Plus (PerkinElmer Life Sciences, Boston, MA) using PosiBlotter (Stratagene, La Jolla, CA). 32P-labeled cDNA probes (2x 106 cpm/ml) were hybridized to the membrane in Hybisol I (Intergen, Norcross, GA). Northern blots were washed 2x 30 min in 2x saline-sodium citrate (SSC), 0.1% SDS, at 42° and then at a final stringency of 0.5x SSC, 0.1% SDS, at 60°C for 30 min. Membranes were exposed to a phosphorimager screen for 1 day. Screens were scanned on a Typhoon phosphorimager (Molecular Dynamics, Sunnyvale, CA). Quantification was performed using ImageQuant software (Molecular Dynamics).

In situ hybridization. For these rats, upon death the brains were removed and flash frozen in 2-methylbutane and then transferred to dry ice and stored at –80°C. For sectioning, coronal sections (20 µm) were taken from fresh frozen tissue using a Leica CM3050 cryostat. Sections were mounted on slides (Superfrost Plus, Fisher Scientific, Pittsburg, PA) and dried on a slide warmer and then stored at –80°C. Slides were postfixed in 4% paraformaldehyde (pH 7.2 in 0.1 M NaPO4) for 1.5 h at room temperature. Slides were washed 3x 5 min in 2x SSC. Slides were then placed in buffer (0.1 M Tris·HCl, 0.05 M Na4EDTA, pH 8–8.2) containing proteinase K (0.2 mg/ml) for 10 min at 37°C and washed for 2 min in ddH2O to stop the action of the proteinase K. Slides were then washed in 0.01 M triethanolamine containing 0.25% vol/vol acetic anhydride for 10 min at room temperature under constant stirring. Slides were washed in 2x SSC for 5 more minutes and finally dehydrated using a graded ethanol series. Sections were hybridized overnight at 55°C in a solution containing 10% dextran sulfate, 3x SSC, 0.5 M NaPO4, 50% formamide, 1x Denhart's, and 200 µg/ml tRNA, pH 7.5, 0.05 M DTT and 0.1 ng/µl [35S]-labeled antisense cRNA probe. Following hybridization, sections were washed in 500 mM NaCl, 1 mM EDTA, 10 mM Tris·HCl, ph 7.5, and digested for 1 h at 37°C in the same solution containing 20 µg pancreatic RNAse A. Slides were then washed in 1x SSC, 0.2 M DTT (5 min), 0.5x SSC, 0.2 M DTT (5 min), and 0.1 M SSC, 0.2 M DTT (1 h, 70°C), dehydrated in a graded ethanol series, and dried. For autoradiography, sections were exposed to a phosphoimager screen for 4 days and scanned with a Molecular Dynamics Typhoon phosphoimager.

Optical density data values were generated using ImageQuant software (Molecular Dynamics, Amersham Biosciences). Values were corrected for background activity using regions of the tissue (white matter) that did not hybridize to the probe in question. All sections were subjected to the same thresholding for analysis. Striatal regions examined for PPE and PD expression are shown in Fig. 1.

Statistical analysis. The Northern blot data (optical density readings) were analyzed by two-factor between-subjects ANOVA with diet restriction and food consumption being the two factors. For the in situ experiment, all data were subjected to a three-factor ANOVA with diet restriction and food consumption the between-subjects factors and region the within-subjects factor.

RESULTS

Experiment 1: Northern blot analysis of ventral striatal PPE and hypothalamic NPY. As an initial attempt to measure potential changes in gene expression in targeted regions before conducting a more widespread examination with in situ hybridization, PPE mRNA within the nucleus accumbens and NPY expression in the hypothalamus were quantified. The pattern of results indicated that changes in motivational state in relation to food affected both PPE expression and NPY expression, but in different ways. Fig. 2 shows the results from experiment 1 using Northern blot analysis. We found that the two groups of animals that consumed food had relatively lower levels of PPE expression, regardless of deprivation condition. In other words, the food-deprived and ad libitum groups, both of which recently consumed food (the food-restricted animals had consumed all 18 g in the cage; the ad libitum group consumed an average of 14.4 ± 2.3 g/cage before death) had lower levels of accumbens PPE compared with their counterparts that did not have food present [effect of food consumption, F(1,8) = 9.13, P < 0.016]. Deprivation condition did not alter PPE expression [F(1,8) = 1.09, P = 0.33]. NPY expression in the hypothalamus followed a different pattern. Whether food was consumed or not had no effect on NPY mRNA levels, whereas the rats on the restricted diet had markedly higher levels of NPY, compared with nonrestricted rats. The ANOVA indicated an overall effect of deprivation condition [F(1,8) = 21.96, P < 0.002], but no effect of food consumption (P < 0.44). Body weights in grams for the four experimental groups were, on the final evening of the experiments (before feeding): R+, 272 ± 2.6; NR+, 376 ± 4.0; R–, 273.3 ± 4.0; NR– 388 ± 11.1.


Figure 2
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 2. Northern blot analysis of nucleus accumbens preproenkephalin (PPE) mRNA (A) and arcuate nucleus neuropeptide Y (NPY; B) mRNA in different motivational conditions. The consumption of food is associated with a downregulation of accumbens PPE, while this factor does not affect NPY expression. Conversely, negative energy balance induced by a chronically restricted diet results in upregulation of arcuate NPY, but does not affect accumbens PPE levels. Bars represent the means ± SE of optical density readings from the blot shown below the graph (n = 3/motivational condition). **P < 0.01, *P < 0.05. See text for other statistical details.

 
Experiment 2: In situ hybridization analysis of striatal peptide gene expression and NPY. The results with in situ hybridization showed a similar pattern, but this experiment allowed more extensive analysis of striatal subregions in these different motivational conditions. We found that the alteration in PPE expression was clearly apparent throughout widespread regions of the striatum. These results are presented in Fig. 3. Overall, it can be observed that the two groups that consumed food tended to have lower levels of PPE expression in relation to those that did not eat. Overall, ANOVA indicated a significant effect of food consumption [F(1,12) = 15.09, P < 0.002]. There was no main effect of deprivation condition (P < 0.78); however, a significant interaction of the two factors was observed [F(1,12) = 9.36, P < 0.009]. This interaction was due to effects in two regions, the medial shell and accumbens core (see figure legend for details). In those regions, it can be observed from the figure that PPE was relatively less downregulated by food consumption in the food-restricted group (although it still tended to decrease). Subanalyses by ANOVA on each region indicated that the only regions that did not show an effect of food consumption on PPE were the medial striatum and dorsolateral striatum, suggesting that the greatest effects were observed in ventromedial and ventrolateral regions of striatum (including nucleus accumbens).


Figure 3
View larger version (79K):
[in this window]
[in a new window]

 
Fig. 3. A: PPE expression in various subregions of the striatum resulting from optical density analysis in the in situ hybridization experiment. In all areas measured except for the medial striatum and dorsolateral striatum, PPE expression was significantly downregulated following food consumption. **P < 0.01, *P < 0.05, effect of food consumption. {dagger}food consumption times diet condition interaction. B: pseudocolor images of sections through three levels of striatum from representative rats in each treatment group, showing PPE expression. Red and yellow indicate the most intense labeling. See Fig. 1 for regions analyzed and METHODS for details of image analysis.

 
For dynorphin mRNA expression, the pattern was very different. The overall ANOVA indicated no significant effect of deprivation condition (P < 0.13), food consumption (0.81), or interactions (P < 0.18). Survey of Fig. 4 indicates that most striatal regions did not show consistent differences between conditions. However, as the overall ANOVA may have obscured real effects within regions, we conducted subanalyses of individual regions. The only analysis to reveal significance was the accumbens core [F(1,8), = 10.08, P < 0.0131]. It can be noted from Fig. 4C that food restriction diminished dynorphin expression in this area, regardless of whether the rats had recently eaten or not.


Figure 4
View larger version (81K):
[in this window]
[in a new window]

 
Fig. 4. A: optical density analysis of prodynorphin (PD) expression in various subregions of the striatum. In all areas measured, except for the accumbens core, there were no significant effects of food consumption or restricted diet. In the accumbens core, there was a significant decrease in PD levels in rats on the restricted diet. *P < 0.05, effect of diet condition. B: pseudocolor images of sections through three levels of striatum from representative rats in each treatment group. Red and yellow represent the most intense labeling. See Fig. 1 for regions analyzed and METHODS for details of image analysis. C: examples of sections through three levels of striatum showing expression of PD.

 
In summary, striatal enkephalin gene expression was upregulated in rats that were denied food and downregulated in rats that had consumed food within the past several hours. Enkephalin gene expression was not affected by the chronic deprivation condition. Dynorphin gene expression did not change in any consistent direction, although it was lowered in the accumbens core by food restriction.

NPY expression was also measured in the arcuate nucleus using optical density analysis of NYP mRNA under these different conditions (Fig. 5). As observed in the figure, NPY was markedly upregulated by chronic food restriction [F(1,20) = 16.46, P < 0.001], but was unchanged by recent food consumption (P = 0.29).


Figure 5
View larger version (40K):
[in this window]
[in a new window]

 
Fig. 5. A: optical density analysis of neuropeptide Y (NPY) expression in different motivational conditions with the arcuate nucleus of hypothalamus. ***P < 0.01, effect of food restriction. B: photomicrographs of cross section at level of hypothalamus showing upregulation of NPY mRNA in restricted diet condition.

 
DISCUSSION

In this paper, we present novel observations concerning the activity of striatal peptide gene expression in relation to changing food motivational conditions. The experiments reveal, using several approaches that measure gene expression, that PPE mRNA in widespread regions of the striatum tends to be downregulated in animals that have recently consumed a meal, whereas these levels are relatively upregulated in rats that have been denied food during their normal feeding period. This pattern was observed regardless of whether the rats had been kept on a chronic food restriction diet or not. Dynorphin mRNA, which is localized in separate populations of medium spiny neurons from those containing enkephalin (17), did not appear to fluctuate with acute motivational conditions. In marked contrast to striatal PPE expression, arcuate nucleus NPY mRNA expression did not track recent food consumption but rather, as expected from previous findings (see below), was found to be strongly upregulated by chronic negative energy balance. Taken together, this set of results provides direct evidence that the striatal enkephalin system participates in the more immediate aspects of food consumption and short-term satiety, a role that contrasts with, but perhaps complements, the well-established role of hypothalamic NPY and other peptides in energy balance.

Factors contributing to food-associated differences in PPE expression. It is important to first consider what factors could account for the differences in PPE expression observed here. The main finding is that animals that had recently consumed food had relatively lower levels of PPE mRNA expression throughout most striatal regions, whereas those that had not eaten in the past 2 h, regardless of level of hunger or general energy balance, had comparatively higher levels. Thus, long-term food deprivation, changes in energy balance, and overall body weight clearly cannot account for the PPE patterns. Other possibilities are differences in the amount of food consumed, as the restricted animals ate ~4 g more during the 2.5-h feeding period than the ad libitum-fed rats. However, once again, this cannot account for the PPE differences, as both the R+ and NR+ rats showed similar decreases in PPE levels. Finally, one might consider the motor effects of anticipatory arousal in the animals expecting to feed but where food does not become available, as it is well known that hungry animals are more active than satiated ones and that expectation of a meal is linked to anticipatory motor activity (8, 42). Although this possibility cannot be ruled out, one might expect that the food-deprived rats would be considerably more active motorically, but PPE changes were not observed with regard to this factor. Nevertheless, the surge in PPE transcription and presumed synthesis of enkephalin may be an integral part of food-anticipatory motor responses. In this regard, it is interesting that an increase in Fos expression is found within the nucleus accumbens during food-entrained activity, although opioids were not specifically examined in that study (41).

It is important to consider whether variations in the day-night cycle per se might account for the changing patterns of PPE expression, as several studies have established diurnal fluctuations in enkephalin release (6, 14, 63) and in rewarding and/or feeding effects of opiates can be influenced by diurnal rhythms (5, 19, 27). However, rats were all killed at the same period, and the brains of both nonrestricted and the food-restricted rats (which might tend to be entrained by the daily meals) showed similar patterns of PPE expression. Thus, we conclude that recent consumption of food is responsible for the differences observed in PPE expression. Nevertheless, as ingestive behavior and diurnal or food-entrained rhythms are closely linked, it is likely that such rhythms do normally contribute to the general changes in PPE expression over the course of a day. Indeed, we have found that ventral striatal PPE levels tend to be lower during the daylight hours (subjective night for the rats), and to be somewhat higher in the evening hours, in agreement with what has previously been reported.

It is notable that alterations in PPE expression were observed in most regions of striatum examined (refer to Fig. 3). Most studies examining striatal opioids and feeding have focused on the nucleus accumbens (10, 30, 45, 49); mapping studies indicate that relatively more ventral aspects of striatum are most sensitive to opioids (3, 73). This is not surprising, given that more ventral aspects of striatum have traditionally been implicated in reward-related processes. However, it is clear from the regional distribution of the effects that both ventral and dorsal aspects of striatum show PPE alterations in relation to food motivational state. This widespread effect suggests that motivational state is able to induce dynamic enkephalin fluctuations that in turn exert a broad influence over striatal function, influencing sensory, motor, and cognitive processes. It is of interest to compare this regional pattern with a recent report by Pecina and Berridge (44). They found that only a very restricted region in the nucleus accumbens medial shell was sensitive to opioid-mediated enhancement of taste reactivity, while a more widespread area of medial accumbens (and as we have found, accumbens core and striatum) supported opioid-induced increase in ingestion per se. At first glance, that study may seem discrepant with the widespread nature of the upregulation seen here. However, it may be that a very restricted zone (which is intimately connected with the lateral hypothalamus) specializes in mediating hedonic perception of food, while the entire striatum, via its engagement of the indirect pathway (see below), modulates voluntary food-directed motor behavior.

It is also important to note that while enkephalin gene expression was not influenced by food restriction, other striatal systems mediating foraging and learning are clearly influenced by deprivation states; for example, the work of Haberny and Carr (21) has demonstrated marked changes in plasticity-related molecular substrates response to food restriction. These systems, involving dopamine, glutamate, and intracellular signaling factors, such as CREB, undoubtedly interact with the neuropeptide systems in the coordination of goal-directed behavior.

PD expression does not change globally with motivational state. In contrast to fluctuating PPE levels, striatal PD mRNA levels did not track any aspect of motivation state, short- or long-term (with the exception of the accumbens core, see below). A salient feature of striatal organization is that all medium-sized spiny neurons, comprising the vast majority of cell types within the striatum and all of which contain GABA as their main neurotransmitter, can be divided into two main types with regard to neuropeptide content: those containing the opioid peptide enkephalin, and those containing substance P and dynorphin (18, 62, 69). While information processed by both subtypes eventually reaches major basal ganglia output structures, enkephalin-containing neurons project mainly to pallidal regions (the so-called indirect pathway) and the dynorphin/substance P neurons to the substantia nigra and entopeduncular nucleus (direct pathway). We find here evidence for substantial alterations in PPE, while PD does not appear to consistently fluctuate in relation to recent food consumption. This result suggests diverse motivational functions for neurons containing enkephalin compared with those containing dynorphin (although further work is needed to ascertain a potential role for substance P). Consistent with this hypothesis, stimulation of µ-opiate receptors (mimicking enkephalin release) is invariably rewarding in many behavioral paradigms, whereas stimulation of kappa receptors (the target for dynorphin) or increases in dynorphin levels are consistently associated with aversive motivational states (56, 58, 68). For example, increases in striatal dynorphin are observed in the brains of suicide subjects and in drug withdrawal states, and animal models of stress and depression (25, 39, 43, 57), and place aversion is observed in response to kappa stimulation of the nucleus accumbens (4). Moreover, there is a substantial literature showing differential effects of these two striatal opioid peptides on dopamine function, which may also relate to the proposed motivational differences. Overall, mu agonists activate dopamine release, whereas kappa agonists decrease it (60, 64, 67, 72). It is of interest that a fairly substantial reduction in accumbens core dynorphin was found in the brains of rats on restricted diets, also reported by Haberny and Carr (20). The functional significance of this change requires further study.

NPY expression in arcuate nucleus changes with negative energy balance. The finding that NPY mRNA is markedly upregulated in association with negative energy balance replicates many well-established reports in the literature and supports recent notions of arcuate nucleus integration of peripheral and central signals governing feeding (26, 35, 46, 50, 55). Through the processing of various complex signals, such as leptin and ghrelin, NPY-containing neurons promote food search and feeding via connections to other brain regions, such as lateral hypothalamus and paraventricular nucleus (26, 61). What is most salient with regard to the present study is that NPY gene expression did not change in response to recent consumption of a meal, even in the food-deprived rats. A related study that supports this notion is provided by Kim et al. (31), who showed that consumption of a palatable diet alone did not alter NPY mRNA, whereas restricted access to that diet (60% of ad libitum) increased its expression. Nevertheless, a caveat is in order; diurnal fluctuations of arcuate nucleus NPY clearly contribute to the signal to initiate feeding (2), and as we did not take multiple time points of NPY gene expression following ingestion, it is possible that NPY changes may have occurred before or beyond the time point measured here. At least one study has shown increases in arcuate NPY following consumption of a high-carbohydrate meal (66). Moreover, gene expression changes (or lack of changes) may not necessarily reflect peptide levels or release; in one study, food-restricted animals that had recently consumed a meal did indeed show lowered peptide levels 2 h following consumption (26)

Potential mechanisms. Given the pattern of striatal peptide gene expression observed in these experiments, it is of interest to speculate as to why such variations are observed and what other neural systems may be controlling these changes. Much evidence suggests that opioids serve to maintain or prolong feeding (32, 33); these authors found that opiate antagonists shorten meal length once food consumption is initiated, although the actual appetitive responses (food-seeking) are not affected. Thus, opioids may act to prolong feeding beyond fulfillment of acute energy needs, to increase energy reserves. In the current experiments, it may be that PPE gene expression is augmented as the animal awakes and prepares to feed, and consequently, increased enkephalin release serves to prolong eating once consumption begins. The food-related increase in synaptic enkephalin causes a compensatory downregulation of PPE activity, associated with short-term satiety. In contrast, in animals that have not fed and that are hungry, PPE gene expression levels (and perhaps vesicular pools of enkephalin) remain comparatively high. Moreover, these changes may also reflect, as noted earlier, dynamic shifts in incentive motivation and anticipatory arousal in relation to whether the animals are food-seeking or not. Further studies with peptide measurements and preferably microdialysis in behaving animals could test these hypotheses.

Where might such a mechanism be initiated? If striatal PPE is elevated when animals are hungry and seeking food, it would follow that brain systems mediating metabolism and arousal must communicate with striatal neurons. The only known direct input to the striatum from the hypothalamus consists of hypocretin/orexin and melanin-concentrating hormone-containing fibers arising from the lateral hypothalamus to the accumbens shell. This pathway may potentially play a role. However, the nature of the effects observed here, involving widespread regions of ventral and dorsal striatum, suggest a more broad influence. Based on observations that striatal cholinergic neurons may play a key role in food motivation (22, 23, 40, 47, 48), we have recently proposed a model of hypothalamic-thalamic-striatal interactions in which hypothalamic signals modulate striatal enkephalin gene expression via cholinergic interneurons of the striatum (29). While space does not allow a detailed description of that model here, we have hypothesized that information flow through a hypothalamic-midline thalamic-striatal axis impinges on the large aspiny cholinergic interneurons of the striatum, which via their large, overlapping axonal fields, act as a network to modulate enkephalin-containing striatal output neurons. This system may have evolved to coordinate feeding and arousal, and, via engagement of the striatal µ-opioid system, to prolong the feeding central motivational state beyond the fulfillment of acute energy needs. While much further experimentation is needed to test these hypotheses, the present data suggest shifting patterns of striatal enkephalin gene activity, depending on whether an animal is food-seeking or food-sated.

GRANTS

This study was supported by National Institute on Drug Abuse Grant DA-09311 and the Food Research Institute of the University of Wisconsin.

ACKNOWLEDGMENTS

We thank Charles Landry for consultation on this project.

FOOTNOTES


Address for reprint requests and other correspondence: A. E. Kelley, Dept. of Psychiatry, Univ. of Wisconsin-Madison Medical School, 6001 Research Park Blvd., Madison, WI 53719 (e-mail: aekelley{at}wisc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

REFERENCES

  1. Ahn S, Phillips AG. Modulation by central and basolateral amygdalar nuclei of dopaminergic correlates of feeding to satiety in the rat nucleus accumbens and medial prefrontal cortex. J Neurosci 22: 10958–10965, 2002.[Abstract/Free Full Text]
  2. Akabayashi A, Levin N, Paez X, Alexander JT, Leibowitz SF. Hypothalamic neuropeptide Y and its gene expression: relation to light/dark cycle and circulating corticosterone. Mol Cell Neurosci 5: 210–218, 1994.[CrossRef][ISI][Medline]
  3. Bakshi VP, Kelley AE. Striatal regulation of morphine-induced hyperphagia: an anatomical mapping study. Psychopharmacology 111: 207–214, 1993.[CrossRef][Medline]
  4. Bals-Kubik R, Ableitner A, Herz A, Shippenberg TS. Neuroanatomical sites mediating the motivational effects of opioids as mapped by the conditioned place preference paradigm in rats. J Pharmacol Exp Ther 264: 489–495, 1993.[Abstract/Free Full Text]
  5. Barbano MF, Stinus L, Cador M, Ahmed SH. Mesolimbic dopamine drives the diurnal variation in opiate-induced feeding. Pharmacol Biochem Behav 81: 569–574, 2005.[CrossRef][ISI][Medline]
  6. Bayon A, Anton B. Diurnal rhythm of the in vivo release of enkephalin from the globus pallidus of the rat. Regul Pept 15: 63–70, 1986.[CrossRef][ISI][Medline]
  7. Berthoud HR. Mind versus metabolism in the control of food intake and energy balance. Physiol Behav 81: 781–793, 2004.[CrossRef][Medline]
  8. Bindra D. Neuropsychological interpretation of the effects of drive and incentive-motivation on general and instrumental behavior. Psychol Rev 75: 1–22, 1968.[CrossRef][ISI]
  9. Bodnar RJ, Glass MJ, Ragnauth A, Cooper ML. General, mu and kappa opioid antagonists in the nucleus accumbens alter food intake under deprivation, glucoprivic and palatable conditions. Brain Res 700: 205–212, 1995.[CrossRef][ISI][Medline]
  10. Bodnar RJ, Lamonte N, Israel Y, Kandov Y, Ackerman TF, Khaimova E. Reciprocal opioid-opioid interactions between the ventral tegmental area and nucleus accumbens regions in mediating mu agonist-induced feeding in rats. Peptides 26: 621–629, 2005.[CrossRef][ISI][Medline]
  11. Cardinal RN, Parkinson JA, Hall J, Everitt BJ. Emotion and motivation: the role of the amygdala, ventral striatum, and prefrontal cortex. Neurosci Biobehav Rev 26: 321–352, 2002.[CrossRef][ISI][Medline]
  12. Cooper SJ, Jackson A, and Kirkham TC. Endorphins and food intake: kappa opioid receptor agonists and hyperphagia. Pharmacol Biochem Behav 23: 889–901, 1985.[CrossRef][ISI][Medline]
  13. Czirr SA, Reid LD. Demonstrating morphine's potentiating effects on sucrose-intake. Brain Res Bull 17: 639–642, 1986.[CrossRef][ISI][Medline]
  14. Dauge V, Mauborgne A, Cesselin F, Fournie-Zaluski MC, Roques BP. The dual peptidase inhibitor RB101 induces a long-lasting increase in the extracellular level of Met-enkephalin-like material in the nucleus accumbens of freely moving rats. J Neurochem 67: 1301–1308, 1996.[ISI][Medline]
  15. de Araujo IE, Rolls ET, Kringelbach ML, McGlone F, Phillips N. Taste-olfactory convergence, and the representation of the pleasantness of flavour, in the human brain. Eur J Neurosci 18: 2059–2068, 2003.[CrossRef][ISI][Medline]
  16. Elmquist JK, Elias CF, Saper CB. From lesions to leptin: hypothalamic control of food intake and body weight. Neuron 22: 221–232, 1999.[CrossRef][ISI][Medline]
  17. Gerfen CR. The neostriatal mosaic. I. Compartmental organization of projections from the striatum to the substantia nigra in the rat. J Comp Neurol 236: 454–476, 1985.[CrossRef][ISI][Medline]
  18. Gerfen CR. The neostriatal mosaic: multiple levels of compartmental organization. Trends Neurosci 14: 133–138, 1992.
  19. Glimcher PW, Giovino AA, Margolin DH, Hoebel BG. Endogenous opiate reward induced by an enkephalinase inhibitor, thiorphan, injected into the ventral midbrain. Behav Neurosci 98: 262–268, 1984.[CrossRef][ISI][Medline]
  20. Haberny SL, Carr KD. Comparison of basal and D-1 dopamine receptor agonist-stimulated neuropeptide gene expression in caudate-putamen and nucleus accumbens of ad libitum fed and food-restricted rats. Brain Res Mol Brain Res 141:121–7, 2005.[Medline]
  21. Haberny SL, Carr KD. Food restriction increases NMDA receptor-mediated calcium-calmodulin kinase II and NMDA receptor/extracellular signal-regulated kinase 1/2-mediated cyclic amp response element-binding protein phosphorylation in nucleus accumbens upon D-1 dopamine receptor stimulation in rats. Neuroscience 132: 1035–1043, 2005.[CrossRef][ISI][Medline]
  22. Hajnal A, Galosi R, Lenard L. Role of accumbens cholinergic interneurons in the maintenance of body weight. Neurobiology (Bp) 5: 473–476, 1997.
  23. Hajnal A, Szekely M, Galosi R, Lenard L. Accumbens cholinergic interneurons play a role in the regulation of body weight and metabolism. Physiol Behav 70: 95–103, 2000.[CrossRef][Medline]
  24. Hill JO, Wyatt HR, Reed GW, Peters JC. Obesity and the environment: where do we go from here? Science 299: 853–855, 2003.[Abstract/Free Full Text]
  25. Hurd YL, Herman MM, Hyde TM, Bigelow LB, Weinberger DR, Kleinman JE. Prodynorphin mRNA expression is increased in the patch vs matrix compartment of the caudate nucleus in suicide subjects. Mol Psychiatry 2: 495–500, 1997.[CrossRef][ISI][Medline]
  26. Kalra SP, Dube MG, Sahu A, Phelps CP, Kalra PS. Neuropeptide Y secretion increases in the paraventricular nucleus in association with increased appetite for food. Proc Natl Acad Sci USA 88: 10931–10935, 1991.[Abstract/Free Full Text]
  27. Kelley AE, Bakshi VP, Fleming S, Holahan MR. A pharmacological analysis of the substrates underlying conditioned feeding induced by repeated opioid stimulation of the nucleus accumbens. Neuropsychopharmacology 23: 455–467, 2000.[CrossRef][ISI][Medline]
  28. Kelley AE, Bakshi VP, Haber SN, Steininger TL, Will MJ, Zhang M. Opioid modulation of taste hedonics within the ventral striatum. Physiol Behav 76: 365–377, 2002.[CrossRef][Medline]
  29. Kelley AE, Baldo BA, Pratt WE. A proposed hypothalamic-thalamic-striatal axis for the integration of energy balance, arousal, and food reward. J Comp Neurol 493: 72–85, 2005.[CrossRef][ISI][Medline]
  30. Kim EM, Quinn JG, Levine AS, O'Hare E. A bi-directional mu-opioid-opioid connection between the nucleus of the accumbens shell and the central nucleus of the amygdala in the rat. Brain Res 1029: 135–139, 2004.[CrossRef][ISI][Medline]
  31. Kim EM, Welch CC, Grace MK, Billington CJ, Levine AS. Effects of palatability-induced hyperphagia and food restriction on mRNA levels of neuropeptide-Y in the arcuate nucleus. Brain Res 806: 117–121, 1998.[CrossRef][ISI][Medline]
  32. Kirkham TC, Blundell JE. Effect of naloxone and naltrexone on the development of satiation measured in the runway: comparisons with D-amphetamine and D-fenfluramine. Pharmacol Biochem Behav 25: 123–128, 1986.[CrossRef][ISI][Medline]
  33. Kirkham TC, Blundell JE. Effects of naloxone and naltrexone on meal patterns of freely-feeding rats. Pharmacol Biochem Behav 26: 515–520, 1987.[CrossRef][ISI][Medline]
  34. Kirkham TC, Cooper SJ. Attenuation of sham feeding by naloxone is stereospecific: evidence for opioid mediation of orosensory reward. Physiol Behav 43: 845–847, 1988.[CrossRef][Medline]
  35. Kotz CM, Grace MK, Briggs JE, Billington CJ, Levine AS. Naltrexone induces arcuate nucleus neuropeptide Y gene expression in the rat. Am J Physiol Regul Integr Comp Physiol 271: R289–R294, 1996.[Abstract/Free Full Text]
  36. Kringelbach ML. Food for thought: hedonic experience beyond homeostasis in the human brain. Neuroscience 126: 807–819, 2004.[CrossRef][ISI][Medline]
  37. Kroener S, Rosenkranz JA, Grace AA, Barrionuevo G. Dopamine modulates excitability of basolateral amygdala neurons in vitro. J Neurophysiol, 2004.
  38. Levine AS, Billington CJ. Opioids as agents of reward-related feeding: a consideration of the evidence. Physiol Behav 82: 57–61, 2004.[CrossRef][Medline]
  39. Mague SD, Pliakas AM, Todtenkopf MS, Tomasiewicz HC, Zhang Y, Stevens WC Jr, Jones RM, Portoghese PS, and Carlezon WA Jr. Antidepressant-like effects of kappa-opioid receptor antagonists in the forced swim test in rats. J Pharmacol Exp Ther 305: 323–330, 2003.[Abstract/Free Full Text]
  40. Mark GP, Rada P, Pothos E, Hoebel BG. Effects of feeding and drinking on acetylcholine release in the nucleus accumbens, striatum, and hippocampus of freely behaving rats. J Neurochem 58: 2269–2274, 1992.[CrossRef][ISI][Medline]
  41. Mendoza J, Angeles-Castellanos M, Escobar C. Differential role of the accumbens shell and core subterritories in food-entrained rhythms of rats. Behav Brain Res 158: 133–142, 2005.[CrossRef][ISI][Medline]
  42. Mistlberger RE. Circadian food-anticipatory activity: formal models and physiological mechanisms. Neurosci Biobehav Rev 18: 171–195, 1994.[CrossRef][ISI][Medline]
  43. Newton SS, Thome J, Wallace TL, Shirayama Y, Schlesinger L, Sakai N, Chen J, Neve R, Nestler EJ, Duman RS. Inhibition of cAMP response element-binding protein or dynorphin in the nucleus accumbens produces an antidepressant-like effect. J Neurosci 22: 10883–10890, 2002.[Abstract/Free Full Text]
  44. Paxinos G, Watson C. The Rat Brain in Stereotoxic Coordinates. San Diego, CA: Academic, 1998.
  45. Pecina S, Berridge KC. Hedonic hot spot in nucleus accumbens shell: where do µ-opioids cause increased hedonic impact of sweetness? J Neurosci 25: 11777–11786, 2005.[Abstract/Free Full Text]
  46. Pecina S, Berridge KC. Opioid site in nucleus accumbens shell mediates eating and hedonic ‘liking' for food: map based on microinjection Fos plumes. Brain Res 863: 71–86, 2000.[CrossRef][ISI][Medline]
  47. Pesonen U, Huupponen R, Rouru J, Koulu M. Hypothalamic neuropeptide expression after food restriction in Zucker rats: evidence of persistent neuropeptide Y gene activation. Brain Res Mol Brain Res 16: 255–260, 1992.[Medline]
  48. Pratt WE, Kelley AE. Nucleus accumbens acetylcholine regulates appetitive learning and motivation for food via activation of muscarinic receptors. Behav Neurosci 118: 730–739, 2004.[CrossRef][ISI][Medline]
  49. Pratt WE, Kelley AE. Striatal muscarinic antagonism reduces 24 hour food intake in association with decreased PPE gene expression. Eur J Neurosci 22: 3229–3240, 2005.[CrossRef][ISI][Medline]
  50. Ragnauth A, Moroz M, Bodnar RJ. Multiple opioid receptors mediate feeding elicited by mu and delta opioid receptor subtype agonists in the nucleus accumbens shell in rats. Brain Res 876: 76–87, 2000.[CrossRef][ISI][Medline]
  51. Sahu A, Kalra PS, Kalra SP. Food deprivation and ingestion induce reciprocal changes in neuropeptide Y concentrations in the paraventricular nucleus. Peptides 9: 83–86, 1988.[CrossRef][ISI][Medline]
  52. Salamone JD, Cousins MS, Snyder BJ. Behavioral functions of nucleus accumbens dopamine: empirical and conceptual problems with the anhedonia hypothesis. Neurosci Biobehav Rev 21: 341–359, 1997.[CrossRef][ISI][Medline]
  53. Saper CB, Chou TC, Elmquist JK. The need to feed: homeostatic and hedonic control of eating. Neuron 36: 199–211, 2002.[CrossRef][ISI][Medline]
  54. Schoenbaum G, Chiba AA, Gallagher M. Orbitofrontal cortex and basolateral amygdala encode expected outcomes during learning. Nat Neurosci 1: 155–159, 1998.[CrossRef][ISI][Medline]
  55. Schwartz MW, Porte D Jr. Diabetes, obesity, and the brain. Science 307: 375–379, 2005.[Abstract/Free Full Text]
  56. Schwartz MW, Sipols AJ, Grubin CE, Baskin DG. Differential effect of fasting on hypothalamic expression of genes encoding neuropeptide Y, galanin, and glutamic acid decarboxylase. Brain Res Bull 31: 361–367, 1993.[CrossRef][ISI][Medline]
  57. Shippenberg TS, Elmer GI. The neurobiology of opiate reinforcement. Crit Rev Neurobiol 12: 267–303, 1998.[ISI][Medline]
  58. Shirayama Y, Ishida H, Iwata M, Hazama GI, Kawahara R, Duman RS. Stress increases dynorphin immunoreactivity in limbic brain regions and dynorphin antagonism produces antidepressant-like effects. J Neurochem 90: 1258–1268, 2004.[CrossRef][ISI][Medline]
  59. Skoubis PD, Lam HA, Shoblock J, Narayanan S, Maidment NT. Endogenous enkephalins, not endorphins, modulate basal hedonic state in mice. Eur J Neurosci 21: 1379–1384, 2005.[CrossRef][ISI][Medline]
  60. Small DM, Zatorre RJ, Dagher A, Evans AC, and Jones-Gotman M. Changes in brain activity related to eating chocolate: from pleasure to aversion. Brain 124: 1720–1733, 2001.[Abstract/Free Full Text]
  61. Spanagel R, Herz A, Shippenberg TS. Identification of the opioid receptor types mediating beta-endorphin-induced alterations in dopammine release in the nucleus accumbens. Eur J Pharmacol 190: 177–184, 1990.[CrossRef][ISI][Medline]
  62. Stanley BG, Magdalin W, Seirafi A, Thomas WJ, Leibowitz SF. The perifornical area: the major focus of (a) patchily distributed hypothalamic neuropeptide Y-sensitive feeding system(s). Brain Res 604: 304–317, 1993.[CrossRef][ISI][Medline]
  63. Steiner H, Gerfen CR. Role of dynorphin and enkephalin in the regulation of striatal output pathways and behavior. Exp Brain Res 123: 60–76, 1998.[CrossRef][ISI][Medline]
  64. Tang F, Tang J, Chou J, Costa E. Age-related and diurnal changes in Met5-Enk-Arg6-Phe7 and Met5-enkephalin contents of pituitary and rat brain structures. Life Sci 35: 1005–1014, 1984.[CrossRef][ISI][Medline]
  65. Thompson AC, Zapata A, Justice JB Jr, Vaughan RA, Sharpe LG, and Shippenberg TS. {kappa}-opioid receptor activation modifies dopamine uptake in the nucleus accumbens and opposes the effects of cocaine. J Neurosci 20: 9333–9340, 2000.[Abstract/Free Full Text]
  66. Wang GJ, Volkow ND, Telang F, Jayne M, Ma J, Rao M, Zhu W, Wong CT, Pappas NR, Geliebter A, Fowler JS. Exposure to appetitive food stimuli markedly activates the human brain. Neuroimage 21: 1790–1797, 2004.[CrossRef][ISI][Medline]
  67. Wang J, Dourmashkin JT, Yun R, Leibowitz SF. Rapid changes in hypothalamic neuropeptide Y produced by carbohydrate-rich meals that enhance corticosterone and glucose levels. Brain Res 848: 124–136, 1999.[CrossRef][ISI][Medline]
  68. Wang JQ, McGinty JF. D-1 and D-2 receptor regulation of preproenkephalin and preprodynorphin mRNA in rat striatum following acute injection of amphetamine or methamphetamine. Synapse 22: 114–122, 1996.[CrossRef][ISI][Medline]
  69. Wise RA. Opiate reward: sites and substrates. Neurosci Biobehav Rev 13: 129–133, 1989.[CrossRef][ISI][Medline]
  70. Wise SP, Murray EA, Gerfen CR. The frontal cortex-basal ganglia system in primates. Crit Rev Neurobiol 10: 317–356, 1996.[ISI][Medline]
  71. Woods JS, Leibowitz SF. Hypothalamic sites sensitive to morphine and naloxone: effects on feeding behavior. Pharmacol Biochem Behav 23: 431–438, 1985.[CrossRef][ISI][Medline]
  72. Woods SC, Schwartz MW, Baskin DG, Seeley RJ. Food intake and the regulation of body weight. Annu Rev Psychol 51: 255–277, 2000.[CrossRef][ISI][Medline]
  73. Yoshida Y, Koide S, Hirose N, Takada K, Tomiyama K, Koshikawa N, Cools AR. Fentanyl increases dopamine release in rat nucleus accumbens: involvement of mesolimbic mu- and delta-2-opioid receptors. Neuroscience 92: 1357–1365, 1999.[CrossRef][ISI][Medline]
  74. Zhang M. Striatal modulation of opioid-induced palatable feeding: anatomical mapping studies. Soc Neurosci Abstr 24: 706, 1998.
  75. Zhang M, Gosnell BA, Kelley AE. Intake of high-fat food is selectively enhanced by mu opioid receptor stimulation within the nucleus accumbens. J Pharmacol Exp Ther 285: 908–914, 1998.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/1/R217    most recent
00852.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Will, M. J.
Right arrow Articles by Kelley, A. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Will, M. J.
Right arrow Articles by Kelley, A. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.