Am J Physiol Regul Integr Comp Physiol 292: R983-R987, 2007.
First published September 28, 2006; doi:10.1152/ajpregu.00483.2006

0363-6119/07 $8.00
ENVIRONMENTAL, EXERCISE AND RESPIRATORY PHYSIOLOGY
Denervation does not change the ratio of collagen I and collagen III mRNA in the extracellular matrix of muscle
Ellen M. Arruda,1,2
Kevin Mundy,1
Sarah Calve,2 and
Keith Baar3
1Department of Mechanical Engineering and 2Program in Macromolecular Science and Engineering, University of Michigan, Ann Arbor, Michigan; and 3Division of Molecular Physiology, University of Dundee, Dundee, Scotland
Submitted 11 July 2006
; accepted in final form 24 September 2006
 |
ABSTRACT
|
|---|
Denervation or inactivity is known to decrease the mass and alter the phenotype of muscle and the mechanics of tendon. It has been proposed that a shift in the collagen of the extracellular matrix (ECM) of the muscle, increasing type III and decreasing type I collagen, may be partially responsible for the observed changes. We directly investigated this hypothesis using quantitative real-time PCR on muscles and tendons that had been denervated for 5 wk. Five weeks of denervation resulted in a 2.91-fold increase in collagen concentration but no change in the content of collagen in the muscle, whereas in the tendon there was no change in either the concentration or content of collagen. The expression of collagen I, collagen III, and lysyl oxidase mRNA in the ECM of muscle decreased (76 ± 1.6%, 73 ± 2.3%, and 83 ± 3.2%, respectively) after 5 wk of denervation. Staining with picrosirius red confirmed the earlier observation of a change in staining color from red to green. Taken with the observed equivalent decreases in collagen I and III mRNA, this suggests that there was a change in orientation of the ECM of muscle becoming more aligned with the axis of the muscle fibers and no change in collagen type. The change in collagen orientation may serve to protect the smaller muscle fibers from damage by increasing the stiffness of the ECM and may partly explain why the region of the tendon closest to the muscle becomes stiffer after inactivity.
connective tissue; inactivity; injury; picrosirius red; exercise
THE EXTRACELLULAR MATRIX (ECM) of muscle is thought to play an important role in the lateral transmission of the force produced within muscle fibers. This lateral transmission of force is important in decreasing the injury induced by contraction (7). Therefore, changes in the composition of the ECM could lead to changes in the ability of muscle to transmit force and limit contraction-mediated muscle damage.
During aging, immobilization, and denervation, there is an increase in the concentration of the ECM of muscle without a change in the total collagen content (5, 6, 11, 12, 14, 16). This increase in collagen concentration in the ECM of muscle during inactivity is likely the result of a decrease in the rate of collagen degradation as the rate of collagen synthesis is significantly decreased (1, 1113). Despite evidence that the synthesis of both type I and III collagen is decreased, Miller et al. (8) suggested that there is a change in the type of collagen in the muscle ECM after unloading. This assertion is made from color changes observed in the ECM of the muscle using picrosirius red. However, this in an indirect way of measuring the collagen isoform, and to date there is no direct measure of the type of collagen within the ECM of muscle following inactivity. Miller et al. also suggested that increased type III collagen and decreased type I collagen that they observed after 14 days of unloading decreased muscle stiffness. However, our group (2) recently showed that 5 wk of denervation results in a 3.9-fold increase in the stiffness (tangent modulus of the linear region of the stress-strain curve) and a 70% decrease in extensibility (toe region of the stress-strain curve) of the tibialis anterior (TA) tendon unit. Interestingly, this was primarily the result of an increase in stiffness in the section of the tendon closest to the muscle. The present study was designed to test the hypothesis that inactivity increases the ratio of type III to type I collagen in muscle, resulting in a stiffening of the tendon proximal to the muscle. To test this hypothesis, the right leg of male Fischer rats was functionally denervated for 5 wk and the ECM was studied enzymatically, histochemically, and by quantitative real-time PCR. The data presented here suggest that the content and orientation of collagen within muscle change but the type of collagen stays relatively constant after a period of forced inactivity.
 |
METHODS
|
|---|
Animals.
Six-month-old male Fischer rats were obtained from Charles River Laboratories (Wilmington, MA) and housed in a specific pathogen-free barrier facility in the Unit for Laboratory Animal Medicine at the University of Michigan until experimentation. After denervation, the rats were housed in a separate specific pathogen-free return room. All experimental procedures were approved by the University Committee for the Use and Care of Animals at the University of Michigan.
Functional denervation and collection.
Rats were anesthetized with an intraperitoneal injection of pentobarbital sodium (50 mg/kg, supplemented as necessary). The right sciatic nerve was exposed before its point of trifurcation, and a 0.5-cm piece was removed. The connective tissue and skin were sutured independently, and on recovery the animals were returned to their cages for 5 wk.
Determination of collagen concentration and content.
The Achilles and TA tendons and soleus and TA muscles were surgically removed from the denervated and contralateral control legs 5 wk after denervation. The tendons and muscles were stripped of overlying connective tissue and fat and placed in sterile PBS before the determination of hydroxyproline by use of the method of Woessner (15). Briefly, tendons and muscles were dried at 110°C for 1 h and weighed immediately. The tissue was then digested overnight in 6 N hydrochloric acid at 130°C. The next day, the pH was raised to
7 by addition of sodium hydroxide, chloramine T was added, and the tubes were incubated for 20 min at room temperature. The chloramine T was inactivated by the addition of perchloric acid before an equal volume of Ehrlich reagent was added. The tubes were incubated at 60°C for 20 min and cooled, and absorbance was measured at 557 nm. Hydroxyproline was converted to collagen, assuming that it accounts for 13.8% of the total collagen, as suggested by Neuman and Logan (9). Collagen concentration was determined by normalizing the collagen content to the dry mass of the tissue.
Polarized light microscopy.
Muscles and tendons to be analyzed by polarized light microscopy were fixed in TissueTec before freezing in methylbutane cooled with dry ice and stored at 80°C until processed. Cross sections (7 µm thick) were made and stained with picrosirius red (8). Briefly, sections were incubated in 0.2% phosphomolybdic acid, 0.1% picrosirius red (direct red 80 in saturated picric acid), and 0.01 N HCl and then dried and mounted in Permount. The specimens were viewed between two crossed, polarized filters by a light microscope.
Gene expression.
Muscles and tendons to be analyzed for gene expression were frozen in liquid nitrogen and stored at 80°C before processing. Tissues were homogenized in 500 µl Trizol reagent with the use of a glass-on-glass homogenizer, and RNA was isolated according to the manufacturers' instructions. The purified RNA was treated with DNase I (DNase-free; Ambion, Austin, TX) for 30 min at 37°C to remove DNA and then reverse transcribed with a reverse transcription system (Promega, Madison, WI). Quantitative RT-PCR was carried out with SYBR green JumpStart Taq ReadyMix (Sigma, St. Louis, MO) with primers to collagen I (forward: GGAGAGTACTGGATCGACCCTAAC; reverse: CTGACCTGTCTCCATGTTGCA), collagen III (forward: GAAAAAACCCTGCTCGGAATT; reverse: GGATCAACCCAGTATTCTCCACTCT), lysyl oxidase (forward: TGGCACCGGTTACTTCCAGTAC; reverse: ACGTGGATGCCTGGATGTAGT), and GAPDH (forward: TGGAAAGCTGTGGCGTGAT; reverse: TGCTTCACCACCTTCTTGAT). Fluorescence was monitored during PCR by an Opticon fluorescence detection system (MJ Research, Reno, NV). PCR data were then normalized to GAPDH, and the relative amount of mRNA was determined by calculating 2
CT (where CT is threshold cycle).
Statistics.
Data are presented as means ± SE for four muscles and tendons per group. Differences in mean values were compared within groups (e.g., control vs. denervated), and significant differences were determined by ANOVA. The level of significance was set at P < 0.05.
 |
RESULTS
|
|---|
Gross characteristics of muscle and tendon after denervation.
Denervation resulted in a 67 ± 2% decrease in muscle mass. The concentration of collagen within the muscle increased 2.9 ± 0.4-fold, whereas the overall content of collagen was statistically unchanged (Fig. 1). Neither the tendon collagen concentration nor content was changed.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 1. Five weeks of denervation leads to increased muscle collagen concentration within muscle with no changes in collagen levels in tendon. Collagen concentration (A) and content (B) in the soleus muscle after 5 wk of denervation are shown. Collagen concentration (C) and content (D) in the tibialis anterior tendon after 5 wk of denervation are also shown. *Significantly different from control, P < 0.05 (n = 4).
|
|
Gross morphology of muscle ECM.
Muscles from control and denervated legs were sectioned into 7-µm slices and then stained with picrosirius red and viewed under polarized light (Fig. 2). Soleus muscles from the control leg showed punctate staining of yellow, green, and red, with red being the most prevalent color. Under the same conditions, the ECM from the denervated muscles stained predominantly green with some areas of red and yellow staining. The areas of red staining corresponded to the perivascular regions of the denervated muscle. There were no changes in picrosirius red staining in the Achilles tendon after 5 wk of denervation (data not shown).

View larger version (100K):
[in this window]
[in a new window]
|
Fig. 2. Five weeks of denervation leads to changes in picrosirius red staining control and denervated legs. Soleus muscles of control (A) and 5-wk denervated (B) legs were cut into 7-µm-thick sections before they were stained with picrosirius red. Sections were viewed at x20 under polarized light. Red and green staining represents collagen fibrils of different anisotropies in section. Red staining occurs in collagen fibrils that are oriented at a large angle with respect to the muscle fiber, and green staining demonstrates collagen fibrils that are more oriented along the muscle fibers and therefore circular and isotropic in section.
|
|
Expression of lysyl oxidase and collagen I and III after denervation.
The expression of lysyl oxidase, an enzyme responsible for collagen cross-linking, and collagens I and III mRNA in the denervated soleus muscle decreased 83 ± 3.2%, 76 ± 1.6%, and 73 ± 2.3%, respectively (Fig. 3). In the Achilles tendon, denervation resulted in a similar trend toward decreased lysyl oxidase and collagens I and III mRNA, which did not reach statistical significance (73 ± 13.5%, 54 ± 23.4%, and 35 ± 13%, respectively).

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 3. Collagen I (COL1) and III (COL3) and lysyl oxidase (LOX) expression are decreased in the soleus muscle after 5 wk of denervation. RNA was isolated from the soleus muscle (A) and Achilles tendon (B) of control (CTL) and denervated (DEN) legs. The purified RNA was treated with DNase and reverse transcribed, and quantitative PCR was carried out with primers to collagen I, collagen III, lysyl oxidase, and GAPDH. Relative amounts of each mRNA are presented as means ± SE. *Significantly different from control (n = 4 samples).
|
|
 |
DISCUSSION
|
|---|
From the studies reported here, we conclude that forced inactivity results in muscle atrophy, an increase in the concentration of collagen, a shift in the color produced under polarized light by picrosirius red staining, but no change in the relative expression of collagen I or III mRNA.
Previously, it had been proposed that there was a shift in the type of collagen within the ECM of muscle after a period of forced inactivity (8). Because the type of collagen can affect the mechanics of the ECM, we have directly tested this hypothesis by quantitative real-time PCR. We find that the expression of all of the ECM mRNA studied decreased equivalently in the denervated soleus muscle. This is in contrast to Miller et al. (8) who found that the expression of both type I and III collagen mRNA was unchanged out to 28 days of unloading. The different results may be due to physiological differences between unloading and denervation, problems with the original Northern blotting probes, the increased sensitivity of quantitative real-time PCR, or the ability to use the contralateral leg as a control in the present study, decreasing variability. In any case, because there is an equivalent decrease in mRNA for both collagen I and III, only a selective increase in collagen I degradation could produce the shift suggested by Miller et al. from their picrosirius red staining.
The color produced under polarized light by picrosirius red staining reflects the in-plane anisotropy of the stained collagen. In the past, this was thought to be dependent on the thickness of the collagen fibers, with thicker fibers appearing more red. Therefore, thicker type I collagen fibers were thought to stain red, whereas thinner type III collagen fibers were thought to stain green. It is this color difference that Miller et al. (8) used to estimate the ratio of type I to type III collagen (8). They found that muscles from rats that were hindlimb unloaded showed a shift in picrosirius red staining similar to that observed here with denervation. These data were interpreted to suggest that there was a shift in the type of collagen from type I to type III in muscle ECM after unloading. Miller et al. went on to hypothesize that the shift toward type III collagen protein in the ECM would decrease muscle stiffness and therefore adversely affect the ability of the muscle to store elastic energy, leading to increased muscle fatigability. However, considering the data for type I and III collagen expression presented here and data in the literature on decreased collagen synthesis (1, 1113), this might not be the proper interpretation. A more accurate interpretation of the anisotropy observed under polarized light with picrosirius red considers the angle that the collagen fiber makes with the section. Collagen fibers are optically isotropic in a section perpendicular to the fiber axis but have a different polarizability along their axis. Their optical anisotropy or birefringence is a function of the angle that the fiber makes with the section. A collagen fiber that is more aligned with the muscle fiber axis produces a circular cross section that has low anisotropy in the plane of section and appears green (Fig. 4). A collagen fiber that is oriented at a greater angle with respect to the muscle fiber axis such that its section is an oval will display a higher degree of anisotropy and produce a red color. Therefore, an alternative explanation for the data from Miller et al. and those reported here is that it is the angle of the collagen in relation to the muscle fiber and not the type of collagen that is changing following inactivity or unloading.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 4. Proposed model of how muscle extracellular matrix (ECM) may serve a protective function during disuse atrophy. A: in a large myofiber, the collagen is arrayed radially, promoting the lateral transmission of force. B: as the myofiber atrophies, there is a decrease in the angle between the collagen fibers and the midline of the muscle fiber so that the collagen is more aligned with the fiber. C: a 7-µm section produces a large oval-shaped cut in the collagen molecule. D: a 7-µm section of a collagen molecule of the same diameter produces a smaller, more circular section. In the aligned position, the ECM collagen would bear a greater percentage of the load placed on the fiber. Because the smaller fibers produce less force, the realignment of the ECM may be important in protecting the muscle from damage.
|
|
Support for this hypothesis can be found in the recent literature. Purslow (10) has shown that the collagen in the ECM of a normal muscle fiber is oriented at a large angle to the muscle fibers to laterally transmit forces. More importantly, Jarvinen et al. (4) have clearly shown, using electron micrographic images, that as a muscle atrophies the angle between the collagen ECM and the long axis of the fiber decreases. The result of this shift is that the muscle ECM becomes more parallel to the fiber. Experimentally, this is seen as a larger, more oval-shaped, collagen cross section in the normal muscle ECM and a smaller, more circular, collagen molecule following denervation. The shift from the oval-shaped to the circular cross section would explain the change in picrosirius red staining, from predominantly red to predominantly green, which was observed in both studies (8). The functional ramification of this change in orientation would be that the ECM surrounding the weakened fiber would become stiffer and not more compliant, as hypothesized by Miller et al. An increase in stiffness would result because the load applied to the collagen matrix is determined by the cosine of the angle between the collagen matrix and the axis of the fiber. Decreasing this angle would increase the stress on the collagen at the same absolute load, and therefore the ECM would assume more of the stress applied to the fiber in an effort to protect the fiber from injury. This shift in collagen orientation may explain part of the observed increase in stiffness within the muscle region of tendon with inactivity (2).
In conclusion, we have found that denervation inactivity leads to a change in the orientation of the ECM of muscle with no change in collagen constitution. The change in collagen orientation concomitant with muscle atrophy may serve to protect smaller muscle fibers from damage. However, the overall propensity for injury is the result of changes not only in the muscle but in the tendon as well. Because tendon is the primary mechanical buffer that protects muscle fibers from damage (3), the effect of the shift in ECM orientation on muscle damage is likely quite small.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: K. Baar, Division of Molecular Physiology, Univ. of Dundee, CIR Dow St., Dundee DD1 5EH, Scotland, United Kingdom (e-mail: k.baar{at}dundee.ac.uk)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Ahtikoski AM, Koskinen SO, Virtanen P, Kovanen V, Takala TE. Regulation of synthesis of fibrillar collagens in rat skeletal muscle during immobilization in shortened and lengthened positions. Acta Physiol Scand 172: 131140, 2001.[CrossRef][ISI][Medline]
- Arruda EM, Calve S, Dennis RG, Mundy K, Baar K. Regional variation of tibialis anterior tendon mechanics is lost following denervation. J Appl Physiol 101: 11131117, 2006.[Abstract/Free Full Text]
- Griffiths RI. Shortening of muscle fibres during stretch of the active cat medial gastrocnemius muscle: the role of tendon compliance. J Physiol 436: 219236, 1991.[Abstract/Free Full Text]
- Jarvinen TA, Jozsa L, Kannus P, Jarvinen TL, Jarvinen M. Organization and distribution of intramuscular connective tissue in normal and immobilized skeletal muscles. An immunohistochemical, polarization and scanning electron microscopic study. J Muscle Res Cell Motil 23: 245254, 2002.[CrossRef][ISI][Medline]
- Kannus P, Jozsa L, Jarvinen TL, Kvist M, Vieno T, Jarvinen TA, Natri A, Jarvinen M. Free mobilization and low- to high-intensity exercise in immobilization-induced muscle atrophy. J Appl Physiol 84: 14181424, 1998.[Abstract/Free Full Text]
- Karpakka J, Virtanen P, Vaananen K, Orava S, Takala TE. Collagen synthesis in rat skeletal muscle during immobilization and remobilization. J Appl Physiol 70: 17751780, 1991.[Abstract/Free Full Text]
- Lynch GS, Rafael JA, Chamberlain JS, Faulkner JA. Contraction-induced injury to single permeabilized muscle fibers from mdx, transgenic mdx, and control mice. Am J Physiol Cell Physiol 279: C1290C1294, 2000.[Abstract/Free Full Text]
- Miller TA, Lesniewski LA, Muller-Delp JM, Majors AK, Scalise D, Delp MD. Hindlimb unloading induces a collagen isoform shift in the soleus muscle of the rat. Am J Physiol Regul Integr Comp Physiol 281: R1710R1717, 2001.[Abstract/Free Full Text]
- Neuman RE, Logan MA. The determination of hydroxyproline. J Biol Chem 184: 299306, 1950.[Free Full Text]
- Purslow PP. Strain-induced reorientation of an intramuscular connective tissue network: implications for passive muscle elasticity. J Biomech 22: 2131, 1989.[CrossRef][ISI][Medline]
- Savolainen J, Myllyla V, Myllyla R, Vihko V, Vaananen K, Takala TE. Effects of denervation and immobilization on collagen synthesis in rat skeletal muscle and tendon. Am J Physiol Regul Integr Comp Physiol 254: R897R902, 1988.[Abstract/Free Full Text]
- Savolainen J, Vaananen K, Vihko V, Puranen J, Takala TE. Effect of immobilization on collagen synthesis in rat skeletal muscles. Am J Physiol Regul Integr Comp Physiol 252: R883R888, 1987.[Abstract/Free Full Text]
- Takala TE, Virtanen P. Biochemical composition of muscle extracellular matrix: the effect of loading. Scand J Med Sci Sports 10: 321325, 2000.[CrossRef][ISI][Medline]
- Virtanen P, Tolonen U, Savolainen J, Takala TE. Effect of reinnervation on collagen synthesis in rat skeletal muscle. J Appl Physiol 72: 20692074, 1992.[Abstract/Free Full Text]
- Woessner JF Jr. The determination of hydroxyproline in tissue and protein samples containing small proportions of this imino acid. Arch Biochem Biophys 93: 440447, 1961.[CrossRef][ISI][Medline]
- Zimmerman SD, McCormick RJ, Vadlamudi RK, Thomas DP. Age and training alter collagen characteristics in fast- and slow-twitch rat limb muscle. J Appl Physiol 75: 16701674, 1993.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
J. M. Haus, J. A. Carrithers, C. C. Carroll, P. A. Tesch, and T. A. Trappe
Contractile and connective tissue protein content of human skeletal muscle: effects of 35 and 90 days of simulated microgravity and exercise countermeasures
Am J Physiol Regulatory Integrative Comp Physiol,
October 1, 2007;
293(4):
R1722 - R1727.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Heinemeier, J. L. Olesen, F. Haddad, H. Langberg, M. Kjaer, K. M. Baldwin, and P. Schjerling
Expression of collagen and related growth factors in rat tendon and skeletal muscle in response to specific contraction types
J. Physiol.,
August 1, 2007;
582(3):
1303 - 1316.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2007 by the American Physiological Society.