AJP - Regu AJP citation statistics
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Regul Integr Comp Physiol 293: R804-R811, 2007. First published May 30, 2007; doi:10.1152/ajpregu.00725.2006
0363-6119/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/2/R804    most recent
00725.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grigore, D.
Right arrow Articles by Alexander, B. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grigore, D.
Right arrow Articles by Alexander, B. T.

DEVELOPMENTAL PHYSIOLOGY AND PREGNANCY

Placental insufficiency results in temporal alterations in the renin angiotensin system in male hypertensive growth restricted offspring

Daniela Grigore,1* Norma B. Ojeda,1* Elliot B. Robertson,1 Antoinette S. Dawson,2 Contrina A. Huffman,1 Erick A. Bourassa,3 Robert C. Speth,3 K. Bridget Brosnihan,4 and Barbara T. Alexander1

1Department of Physiology and the Center for Excellence in Cardiovascular-Renal Research, University of Mississippi Medical Center, Jackson, Mississippi; 2Murrah High School, Jackson, Mississippi; 3Department of Pharmacology, School of Pharmacy, University of Mississippi, University, Mississippi; and 4The Hypertension and Vascular Disease Center, Wake Forest University School of Medicine, Winston-Salem, North Carolina

Submitted 13 October 2006 ; accepted in final form 25 May 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Reduced uterine perfusion initiated in late gestation in the rat results in intrauterine growth restriction (IUGR) and development of hypertension by 4 wk of age. We hypothesize that the renin angiotensin system (RAS), a regulatory system important in the long-term control of blood pressure, may be programmed by placental insufficiency and may contribute to the etiology of IUGR hypertension. We previously reported that RAS blockade abolished hypertension in adult IUGR offspring; however, the mechanisms responsible for the early phase of hypertension are unresolved. Therefore, the purpose of this study was to examine RAS involvement in early programmed hypertension and to determine whether temporal changes in RAS expression are observed in IUGR offspring. Renal renin and angiotensinogen mRNA expression were significantly decreased at birth (80 and 60%, respectively); plasma and renal RAS did not differ in conjunction with hypertension (mean increase of 14 mmHg) in young IUGR offspring; however, hypertension (mean increase of 22 mmHg) in adult IUGR offspring was associated with marked increases in renal angiotensin-converting enzyme (ACE) activity (122%) and renal renin and angiotensinogen mRNA (7-fold and 7.4-fold, respectively), but no change in renal ANG II or angiotensin type 1 receptor. ACE inhibition (enalapril, 10 mg·kg–1·day–1, administered from 2 to 4 wk of age) abolished hypertension in IUGR at 4 wk of age (decrease of 15 mmHg, respectively) with no significant depressor effect in control offspring. Therefore, temporal alterations in renal RAS are observed in IUGR offspring and may play a key role in the etiology of IUGR hypertension.

intrauterine growth restriction; kidney; brain; angiotensin; rat


EPIDEMIOLOGICAL AND EXPERIMENTAL studies provide strong evidence to suggest cardiovascular disease and hypertension are programmed by exposure to adverse conditions in utero (1, 6, 11, 12, 13, 17, 30, 51, 55). The inverse relationship observed in epidemiological studies between birth weight and blood pressure suggests that factors involved in prenatal development, which affect fetal growth, are responsible for the in utero programming of arterial blood pressure (6, 7, 25, 31). Mechanisms involved in the prenatal programming of hypertension are unclear. However, animal studies suggest a role for the kidneys (1, 2, 30, 51, 55, 54, 56) in the pathogenesis of prenatal programmed hypertension with inclusion of the renin angiotensin system (RAS) (30, 44, 51, 55).

Numerous investigators have examined the role of the RAS in models of prenatal programming induced by protein restriction during gestation in the rat (33, 34, 40, 43, 45, 48, 51, 52, 55) and prenatal exposure to glucocorticoids (41, 43). Suppression of the RAS observed at birth (51, 55) may lead to permanent structural changes associated with the pathogenesis of hypertension in offspring from protein-restricted dams (55). Upregulation of the renal angiotensin type 1 receptor (AT1R) following late gestational protein restriction is observed as early as 4 wk of age by some investigators (30, 33, 51), but not others (35), and characterization of the renal RAS, including AT1R1 has not yet been determined in the adult hypertensive offspring. Marked increases in plasma renin activity (PRA) following late gestational protein restriction are also observed as early as 4 wk of age by some investigators (30) but not by other investigators who observe suppression of PRA at 4 wk of age with a gradual increase leading to inappropriate activation at 6 mo of age (30). Thus, temporal alterations in the RAS are reported by investigators using similar models of prenatal programming induced by gestational protein restriction (30, 33, 48, 51, 52, 55). More importantly, the critical role of the RAS in the etiology of hypertension programmed by protocols of in utero protein restriction is indicated by RAS blockade studies (24, 48). Furthermore, alterations in the RAS may also be responsible for marked increases in blood pressure programmed by prenatal exposure to glucocorticoids, indicating that fetal insults lead to similar pathways of programmed hypertension (41, 43).

Our laboratory uses a model of prenatal programmed hypertension initiated by reduced uterine perfusion that may better reflect the pathophysiological induction of intrauterine growth restriction (IUGR) in humans in the Western world. IUGR induced by placental insufficiency is associated with development of hypertension in male growth-restricted offspring (1, 40). We previously reported that angiotensin-converting enzyme (ACE) inhibition abolishes hypertension in adult male growth-restricted offspring (40), suggesting that the RAS plays a critical role in the maintenance of established hypertension in this model of IUGR. Thus, the purpose of this study was to determine whether temporal alterations in the RAS are present in male growth-restricted offspring from reduced uterine perfusion dams, and to determine the quantitative importance of the RAS in the early phase of programmed hypertension in male growth-restricted offspring.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
All experimental procedures were done in accordance with National Institutes of Health guidelines with approval by the Animal Committee at the University of Mississippi Medical Center. Rats were housed in a temperature-controlled room (23°C) with a 12:12-h light-dark cycle with food and water available ad libitum. At day 14 of gestation, female timed pregnant Sprague-Dawley rats (Harlan, Indianapolis, IN) destined for reduced uterine perfusion were clipped as described below. All dams were allowed to deliver at term with one control litter size-matched to a reduced uterine perfusion litter. Minimum litter size was 8 pups. Birth weight was recorded within 12 h and offspring from all litters were weaned at 3 wk of age. Only male offspring were used for all studies since only male IUGR offspring develop and remain hypertensive into adulthood. For ACE inhibition studies, young male offspring from 12 control and 11 reduced uterine perfusion litters were administered either enalapril, 10 mg·kg–1·day–1 by gavage, using a dose shown previously by our laboratory or others (47) to result in an effective blockade of the ANG II response, as determined by a decrease in arterial pressure and increase in PRA, or vehicle (water and corn syrup, 50:50). Administration of enalapril or vehicle was initiated at 2 wk of age and continued for 2 wk of until 4 wk of age. Mean arterial pressure was measured at 4 wk of age in one group of animals and at 5 wk of age in a second group. For measurement of RAS components at birth, tissues were pooled from offspring of a single litter for collection of adequate tissue for analysis. Six litters of control and 8 litters of reduced uterine perfusion dams were utilized. For studies involving quantitation of RAS components in older animals, kidneys were not pooled, as kidneys were sufficient in size for analysis, and therefore, each measurement represents one kidney per animal. For these determinations, tissues and serum were collected from offspring born to a total of 12 control rats and 13 reduced uterine perfusion rats. Kidneys and plasma were collected from animals following decapitation.

Reduced uterine perfusion in the pregnant rat. As previously described (1), reduced uterine perfusion was used to induce IUGR. Briefly, all rats undergoing surgical procedures were anesthetized with 2% isoflurane (W. A. Butler) delivered by Vaporizer (Ohio Medical Products, Madison, WI). At day 14 of gestation, a midline abdominal incision was done and the lower abdominal aorta was isolated and a silver clip (0.203 mm ID) was placed around the aorta above the iliac bifurcation. Because compensation of blood flow to the placenta occurs through an adaptive increase in ovarian blood flow, flow to both the right and left ovarian arteries that supply the uterus was reduced using silver clips (0.100 mm ID). Pregnant rats used for the control group were not exposed to surgical procedures. On the basis of previous observations, no differences have been observed between offspring from pregnant rats undergoing a sham operation and offspring from pregnant rats not exposed to surgical procedures. (B. T. Alexander, unpublished data, 2003).

Acute arterial pressure measurements in conscious rats. Mean arterial pressure (MAP) was measured acutely, as previously described (1). Briefly, rats were anesthetized with isoflurane, as described above and surgically instrumented with a carotid arterial catheter [polyethylene (PE)-50 tubing]. After 3 days of recovery, rats acclimated to restraint were placed in modified restraining cages with arterial pressure monitored with a pressure transducer connected to a data acquisition kit (DATAQ Instruments, Akron, OH) and computer for continuous recording. All animals were acclimated to restraint for 2 h before a 1-h equilibration period followed by two 20-min pressure determinations. All pressure measurements were made during midmorning hours.

Measure of plasma renin activity. Renin activity in plasma was measured by RIA using a modification of Haber and associates (22) with ANG I standards, tracer, and antibody from the National Institute for Standards and Technology (Gaithersburg, MD), Perkin Elmer Life Sciences (Waltham, MA), and Arnel, respectively.

ACE activity assay. Isolated kidney cortices were homogenized in an assay buffer consisting of (in mmol/l) 50 HEPES, pH 7.4, 150 NaCl, 0.5% Triton X-100, 10 µM ZnCl2, and 1.0 PMSF, and then clarified by centrifugation at 10,000 g for 15 min. ACE activity against a synthetic substrate (p-hydroxybenzoyl-glycyl-L-hisidyl-L-leucine) was determined using the colorimetric based ACEcolor kit (Fujirebio). For the assay, tissue samples were standardized to 1 µg protein/µl. For serum ACE activity, 50 µl of serum was used. Optical density was read at 505 nm with a spectrophotometer. Results were calculated as mIU/mg of protein. All data were reported as means ± SE.

Isolation of total cellular RNA and real-time PCR. Total RNA was utilized for quantitation of the mRNA message by real-time PCR. Kidneys were removed, quick frozen in liquid nitrogen, and stored at –80°C. Each kidney was first ground using a liquid nitrogen chilled mortar and pestle, and total RNA was isolated using a guanidine thiocyanide, acid phenol:chloroform procedure (ToTALLY RNA kit, Ambion, Austin, TX). Total RNA concentration and purity were determined spectrophotometrically using A260 and A260/280 ratio, respectively. Total RNA integrity was checked using 1% agarose gel electrophoresis. All RNA isolates were DNA free by treatment with DNAse (DNA-free kit, Ambion, Austin, TX). Two micrograms of total RNA were reverse transcribed using a modified Maloney murine leukemia virus-derived RT and a unique blend of oligo (dT) and random hexamer primers (iScript cDNA Synthesis Kit, Bio-Rad, Hercules, CA). One microliter of the resulting cDNA was amplified by real-time PCR using SYBR Green (iQ SYBR Green Supermix, Bio-Rad) as fluorophore in an iCycler real-time thermal cycler (Bio-Rad). Specific pairs of primers were used for each gene amplification. PCR conditions were optimized for each pair of primers. DNA sequencing of the fragment amplified confirmed specificity of the PCR products: renin (37) forward: GCTACATGGAGAATGGGACTGAA and reverse: ACCACATCTTGGCTGAGGAAAC; angiotensinogen (37) forward: AGCACGGACAGCACCCTATT and reverse: AGAACTCATGGAGCCCAGTCA; and AT2R primers (34) forward: AATTACCCGTGACCAAGTCTTGA and reverse: AGAACATGGAAGGGAAGCCA; and AT1R primers (34) forward: GGCCAGTGTTTTTCTTTTGAATTTAGCAC and reverse: GTTCCCCTTGTTTGGTGTAT.

ACE mRNA expression was assessed using RT2 PCR Primer Set for Rat ACE (SuperArray Bioscience). Results were calculated using the 2{Delta}{Delta}CT method and expressed in folds increase/decrease of the gene of interest in IUGR vs. control rats. All reactions were performed in triplicate, and beta-actin was used as an internal control (RT-PCR primer and control set; Invitrogen, Carlsbad, CA). Level of mRNA expression was calculated using the mathematical formulas for delta/delta CT recommended by Applied Biosystems (Foster City, CA; Applied Biosystems User Bulletin, No. 2, 1997).

Radioimmunoassay for ANG II. Briefly, frozen kidneys were quickly weighed and quick frozen in liquid nitrogen. For analysis, they were homogenized and extracted using Sep-Pak columns. Solvent was evaporated, and recovery of radiolabeled angiotensin added to the samples was determined during the extraction. Recovery of radiolabeled peptide was corrected for recovery. ANG II was measured using the Alpco Diagnostics kit (Windham, NH).

Radioligand autoradiography for ANG II receptors and ACE. Quantitative autoradiography was used to determine renal AT1R, AT2R, and ACE binding from whole kidneys as previously described (5, 28, 29). Briefly, kidneys were snap-frozen in liquid nitrogen, cut sagitally into sequential 20-µm-thick frozen sections within 1 wk of harvest, thaw-mounted onto gelatin-coated slides, air-dried, and stored at –20 C. Within 1 wk of sectioning, the sections were thawed, and the autoradiography procedure was carried out. For AT1 and AT2 receptor autoradiography, sections were preincubated for 30 min at room temperature in isotonic buffer (50 mM NaPO4, 150 mM NaCl, 5 mM EDTA, 0.1 mM bacitracin, pH 7.1–7.2). Consecutive sections were incubated for 2 h in isotonic buffer containing 0.4 nM 125I-SI ANG II plus a saturation concentration (3 µM) of ANG II to block both AT1 and AT2 receptors for nonspecific binding; 0.4 nM 125I-SI ANG II plus 10 mM PD123177 (an AT2R-selective compound) for measurement of AT1R; and 0.4 nM 125I-SI ANG II plus 10 mM losartan (an AT1-selective antagonist) for measurement of AT2R, as previously described (35). For ACE autoradiography, sections were preincubated in 50 mM Tris, 100 mM NaCl buffer (pH 7.4 at 22°C) for 30 min at room temperature, and then incubated with 125I-351A plus or minus 1 µM MK-422 for 1 h at room temperature for determination of ACE as previously described (4, 24). Following radioligand incubation, sections were rinsed, dried, and exposed to Kodak Biomax MR1 X-ray film, at –20°C for ~36 h. A standard slide with calibrated concentrations ranging from 1 to 600 nCi/mg 125I (Microscales, GE Healthcare Biosciences, Piscataway, NJ) was included in each cassette. The film was developed using an automated film processor.

Image analysis. Images were captured by use of an Advanced Imaging System image analysis system (Imaging Research) via an analog video camera. The density of ANG II receptors was referenced to the 125I standards processed with each film.

Statistics. All data are presented as means ± SE. Statistical differences were evaluated using repeated-measures one-way ANOVA, followed by a Student's t-test. The criterion for statistical significance was set at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Birth and body weights. As reported previously (1), weight at birth was significantly reduced in growth-restricted offspring compared with control offspring (5.7 ± 0.1 vs. 6.4 ± 0.3 g, P < 0.01, IUGR vs. control, respectively). However, body weight was not significantly decreased at either 4 (80 ± 3 g) or 5 wk of age in growth-restricted offspring (126 ± 4 g) compared with control (80 ± 3 and 119 ± 4 g, respectively). However, treatment with enalapril from 2 to 4 wk of age led to a significant reduction in body weight in growth-restricted offspring relative to their untreated counterparts at 4 wk of age (66 ± 3 g, P < 0.05) that persisted at 5 wk of age (103 ± 5 g, P < 0.05); enalapril had no significant effect on body weight in control offspring at either 4 (76 ± 2 g) or 5 wk of age (121 ± 2 g). Body weight remained similar at 16 wk of age in growth-restricted offspring (413 ± 50 g) compared with control offspring (411 ± 5 g).

Effect of RAS blockade on MAP. To determine the importance of the RAS in the early phase of hypertension in this model of IUGR, enalapril was administered from 2 to 4 wk of age. The increase in MAP at both 4 and 5 wk of age in growth-restricted offspring was abolished by ACE inhibitor treatment. ACE inhibition did not significantly alter blood pressure in control offspring (Fig. 1).


Figure 1
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 1. Inhibition of the renin angiotensin system (RAS) in intrauterine growth-restricted (IUGR) offspring. Mean arterial pressure was measured in conscious chronically instrumented offspring at 4 and 5 wk of age following treatment with either vehicle or enalapril (treated; 10 m·kg–1·day–1 by gavage from 2 to 4 wk of age). Four-week-old rats comprised the following groups: control vehicle (n = 11), IUGR vehicle (n = 7), control treated (n = 10), and IUGR treated (n = 9). Five-week-old rats comprised the following groups: control vehicle (n = 8), IUGR vehicle (n = 5), control treated (n = 7), and IUGR treated (n = 6). *P < 0.05 vs. untreated control. {dagger}P < 0.05 vs. untreated IUGR. All data are expressed as means ± SE.

 
Measurement of MAP in adult growth-restricted offspring. For characterization of RAS components in adult growth-restricted offspring, tissues were collected at 16 wk of age, a time at which MAP was significantly elevated in growth-restricted offspring (145 ± 2 mmHg, P < 0.05) compared with control (123 ± 2 mmHg). These values, as determined in conscious chronically instrumented animals, are comparable to values of MAP obtained by telemetry (measurement at 16 wk of age following full recovery from probe implantation at 10 wk of age) (40).

Intrarenal expression of RAS components. Expression of renin mRNA in the kidney was significantly decreased by 80% (day 1) in growth-restricted offspring relative to control offspring (Fig. 2A). At 6 wk of age, no difference in expression of renin in the renal cortex was observed in growth-restricted vs. control offspring (Fig. 2B). However, cortical renin mRNA expression was significantly increased by 7-fold at 16 wk of age in growth-restricted offspring (Fig. 2C) compared with control offspring. Renal angiotensinogen mRNA expression followed a similar trend. Renal angiotensinogen mRNA expression, which was significantly decreased at birth (day 1) (Fig. 2D), did not differ significantly at 6 wk of age (Fig. 2E) but was significantly increased at 16 wk of age (Fig. 2F). Renal cortical ACE mRNA expression (Fig. 3, top left) or renal ACE density (Fig. 3, middle left) determined by radioligand autoradiography did not differ at 16 wk of age; however, a significant increase in renal ACE activity (Fig. 3, bottom left) was observed in growth-restricted offspring at 16 wk of age relative to control offspring. Renal AT1 receptor mRNA (Fig. 3, top right) or renal AT1 receptor density (Fig. 3, middle right) were not altered in growth-restricted offspring compared with control offspring at 16 wk of age, and despite a significant increase in renal ACE activity, renal ANG II levels were also not increased at 16 wk of age (Fig. 3F). AT1R binding was greater in the medulla relative to the cortex in both control and growth-restricted offspring (Fig. 4), an observation previously reported by others (20, 57). AT1 receptor binding, as determined by radioligand autoradiography, also did not differ at 4 wk of age. Binding to the angiotensin type 2 (AT2) receptor was not detectable in growth-restricted or control offspring at either 4 or 16 wk of age; AT2 receptor mRNA expression was also not detectable.


Figure 2
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 2. Temporal changes in renal renin and angiotensinogen in IUGR offspring. Real-time PCR was used to assess renal renin mRNA expression in newborn (day 1) (A), 6 wk of age (B), and 16 wk of age (C) or renal angiotensinogen mRNA expression of in newborn (day 1) (D), 6 wk of age (E), and 16 wk of age (F). Quantitation of renal RAS components was normalized relative to renal beta-actin mRNA expression levels. For newborn samples, mRNA expression was quantitated from whole kidney homogenates representing a pool of tissues collected from a single litter; n = 8 IUGR litters and 6 control litters. Individual cortical sections were analyzed from 8 IUGR and 8 control offspring at 6 wk of age; 7 IUGR and 8 control offspring at 16 wk of age. Standard error is calculated from at least three determinations from at least three independent experiments. *P < 0.05 vs. control. All data are expressed as means ± SE.

 

Figure 3
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 3. Renal angiotensin-converting enzyme (ACE), AT1 receptor, and ANG II in IUGR offspring at 16 wk of age. Real-time PCR was used to assess renal ACE (top left) and AT1 receptor (top right) mRNA expression. Quantitation of renal RAS components was normalized relative to renal mRNA beta-actin mRNA expression levels. Individual cortical sections were analyzed from 7 IUGR and 8 control offspring at 16 wk of age. Standard error was calculated from at least 3 determinations from at least three independent experiments. Quantitative binding of renal ACE (middle left) and AT1 receptor (middle right) was determined in 8 IUGR and 8 control offspring. Renal ACE activity (bottom left) and renal ANG II (bottom right) was determined in 6 IUGR and 5 control offspring. All data are expressed as means ± SE.

 

Figure 4
View larger version (93K):
[in this window]
[in a new window]

 
Fig. 4. Quantitative autoradiography of angiotensin type 1 (AT1R) receptors and ACE in whole kidney from control and IUGR offspring at 16 wk of age. Representative autoradiographs are shown of ACE, AT1R, and nonspecific binding of 125 I-SI ANG II.

 
Plasma renin activity. PRA did not differ between control and growth-restricted offspring at either 4 (5.7 ± 2.6 vs. 6.5 ± 2.2 nmol ANG I·l–1·h–1) or 5 wk of age (5.2 ± 1.6 vs. 8.1 ± 0.6 nmol ANG I·l–1h–1), respectively. ACE inhibition from 2 to 4 wk of age resulted in a significant increase in PRA at 4 wk of age in control and growth-restricted treated offspring (114 ± 42.2 and 95.6 ± 37.4 nmol ANG I·l–1·h–1). At 5 wk of age, PRA returned to baseline values in control (6.3 ± 1.7 nmol ANG I·l–1·h–1) or below in growth-restricted offspring (3.2 ± 1.7 nmol ANG I·l–1·h–1, P < 0.05 vs. untreated growth-restricted).

Serum ACE activity. Serum ACE activity was not significantly increased at 16 wk of age in growth-restricted offspring (13.5 ± 1.2 vs. 15.2 ± 1.1 IU ACE/l, control vs. growth-restricted, respectively).


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Fetuses subjected to stressful influences resulting in IUGR are predisposed to the development of cardiovascular disease and hypertension in later life (1, 30, 51, 55). In the rat, reduced uterine perfusion initiated in late gestation results in growth-restricted offspring that develop marked elevations in MAP (1, 40). Significant elevations in MAP observed at 12 wk of age in growth-restricted offspring are not associated with marked changes in glomerular filtration rate or renal plasma flow (1). Therefore, regulatory systems for control of sodium balance and arterial pressure may be altered by placental insufficiency in utero. We previously reported that RAS blockade by use of the ACE inhibitor enalapril abolishes hypertension in adult growth-restricted offspring from reduced uterine perfusion dams (40). This suggests an important role for RAS involvement in the established phase of IUGR-induced hypertension. In the present study, we determined the quantitative importance of the RAS in the early phase of IUGR-induced hypertension. In addition, we also determined whether temporal alterations in the RAS were associated with the etiology of hypertension in this model of IUGR produced in response to reduced uterine perfusion.

An important role for RAS involvement in the development of hypertension in models of prenatal programming induced by low protein is suggested by RAS blockade studies. Early blockade of the RAS by the ACE inhibitor, enalapril (33), or by AT1R blockade (48) prevents development of hypertension in models of programming induced by gestational protein restriction. Although elevated levels of intrarenal ANG II (30, 45) or systemic (32) RAS may not be present at this time, investigators report offspring of protein-restricted dams present increased sensitivity to ANG II (35, 46) that may (46) or may not (35) be associated with increased intrarenal expression of AT1 receptors. In our studies, hypertension is present in growth-restricted offspring from reduced uterine perfusion dams between 4 to 6 wk of age (1). To examine the quantitative importance of the RAS in the early phase of hypertension in this model of IUGR, we administered the ACE inhibitor, enalapril, for 2 wk starting at 2 wk of age. Nephrogenesis is complete by 2 wk of age, so the initiation of an ACE inhibitor at this age in the rat will not interfere with proper renal development (21). Although intrarenal expression of AT1 receptors was not increased at 4 wk of age in growth-restricted offspring, early ACE inhibition abolished hypertension. In addition, the effect of ACE inhibition on arterial pressure was sustained since MAP remained normalized in treated growth-restricted offspring relative to control, treated and untreated, at 5 wk of age, or 1 wk past treatment with enalapril. Thus, the RAS contributes to early hypertension in this model of IUGR induced by placental insufficiency, and increased sensitivity to ANG II may contribute to the etiology of hypertension in growth-restricted offspring.

We next examined whether temporal alterations in the RAS were observed in this model of prenatal programmed hypertension induced by placental insufficiency. RAS components are highly expressed in the developing kidney and play a role in mediating proper nephrogenesis (20, 57). AT1R blockade during the nephrogenic period in the rat leads to a reduction in nephron number and development of hypertension (57), suggesting that the intrarenal RAS contributes to proper nephrogenesis. Models of programming induced by gestational protein restriction consistently exhibit marked reductions in nephron number and kidney size associated with significant increases in arterial pressure in adulthood (30, 51, 55). In one model of gestational protein restriction used by Woods et al. (57), suppression of the RAS is present at birth. Thus, in utero exposure to low protein may lead to alterations in the RAS, resulting in permanent structural changes and subsequent development of hypertension in adult offspring (55). Similar to observations noted by Woods with the low-protein model, we observed a significant decrease in renal mRNA expression of renin and angiotensinogen in newborn growth-restricted offspring. This reduction in renin and angiotensinogen mRNA expression at birth in growth-restricted offspring may also be associated with reductions in nephron number. Kidney weight is reduced in growth-restricted offspring in response to reduced uterine perfusion (1), and reductions in nephron number have been reported by other investigators using similar models of reduced uteroplacental flow in the rat (36, 42) and other species (8, 10).

The RAS is an important regulator of arterial pressure and body fluid balance through the systemic actions of ANG II (23). Inappropriate activation of the peripheral RAS, noted by a marked increase in PRA, is observed in conjunction with established hypertension in a model of gestational protein restriction utilized by Vehaskari and colleagues (53, 54). Vehaskari also notes that RAS blockade abolishes established hypertension in adult offspring of gestational protein-restricted dams (53). Furthermore, alterations in the RAS may also contribute to marked increases in blood pressure induced by prenatal exposure to glucocorticoids (41, 43). Therefore, a role for RAS involvement is indicated in animal models of hypertension produced in response to an adverse insult during fetal development. However, in growth-restricted offspring from reduced uterine perfusion dams, established marked elevations in MAP were not associated with changes in the peripheral RAS, as we previously reported by measure of PRA and plasma renin substrate (40), and in this study, by serum ACE activity. Thus, inappropriate activation of the peripheral RAS is not associated with hypertension in this model of IUGR. However, as suggested by studies in transgenic animals, intrarenal ANG II can contribute to development of hypertension despite the absence of an increase in the peripheral RAS (14). Therefore, the intrarenal RAS, not the peripheral RAS, may contribute to the etiology of hypertension in growth-restricted offspring from reduced uterine perfusion dams.

All components of the RAS are present in the kidney (19). Because RAS blockade abolishes hypertension in adult growth-restricted offspring, suggesting RAS involvement (40), we characterized the renal RAS in growth-restricted offspring to determine whether alterations were present in this model of IUGR-induced hypertension. Renal renin and angiotensinogen mRNA expression were no longer suppressed at 6 wk of age as previously observed at birth and were significantly elevated at 16 wk of age in the cortex of adult growth-restricted offspring relative to control offspring. A marked increase in renal ACE activity was also observed at 16 wk of age in adult growth-restricted offspring. However, ACE and AT1R mRNA expression did not differ upon comparison of adult growth-restricted offspring to control. Quantitative autoradiography also showed no difference between ACE and AT1R expression in the kidneys of adult growth-restricted offspring relative to control. Although renal ACE activity was increased in adult growth-restricted offspring at 16 wk of age in conjunction with increased levels of renin substrate, ANG II formation was not increased.

Angiotensinogen of hepatic origin can serve as the substrate for generation of intrarenal ANG II; however, angiotensinogen is also present within the proximal tubule (27) and can be stimulated by testosterone (39). We previously reported that plasma testosterone levels are elevated twofold in adult male growth-restricted offspring (40). Regulation of renal angiotensinogen by testosterone can occur in a dose-dependent fashion (16), suggesting that elevated testosterone in adult male growth-restricted offspring may serve as the stimulus for enhanced renal angiotensinogen observed in this model of IUGR hypertension. Enhanced renal angiotensinogen levels can lead to activation of the RAS and hypertension (26), and we have demonstrated the importance of the RAS in mediating hypertension in adult male growth-restricted offspring (40). However, despite enhanced intrarenal angiotensinogen, increased intrarenal ANG II was not observed in conjunction with established hypertension in adult male IUGR. Discrepancies in intrarenal angiotensinogen and ANG II are also observed in the Dahl salt-sensitive (28) and Zucker diabetic rat (50), yet the importance of ANG II in these experimental models is demonstrated by the renoprotective effects mediated via AT1 receptor blockade (33, 39, 50). Therefore, the intrarenal RAS, independent of the peripheral RAS, may play a role by contributing to impaired sodium reabsorption and hypertension in adult growth-restricted offspring from reduced uterine perfusion dams.

ANG II blockade studies support a role for RAS involvement in both the development and maintenance of established hypertension in this model of IUGR induced by placental insufficiency. Moreover, temporal alterations in the renal RAS are evident in this model of IUGR. However, it appears that the factors that initiate hypertension in this model of IUGR may differ from the factors that maintain established hypertension. Fetal responses to reduced uterine perfusion indicate suppression of intrarenal RAS at birth, no alteration in the intrarenal RAS in young animals, and marked alterations in the intrarenal RAS in the adult hypertensive animal; in addition, no temporal changes are observed in the peripheral RAS. Because sex differences are observed in this model of IUGR, only male growth-restricted offspring remain hypertensive after puberty, and differential expression of the RAS by sex hormones may contribute to established hypertension in adult male growth-restricted offspring.

Animal studies provide evidence suggesting that insults during gestation result in structural and physiological alterations leading to hypertension associated with permanent changes in the regulatory systems involved in the long-term control of arterial pressure. Alterations in intrarenal RAS contribute to the etiology of hypertension in offspring from reduced uterine perfusion dams, an observation similar to that observed by other investigators using models of gestational protein restriction and prenatal glucocorticoid exposure. The pathogenesis of hypertension is multifactorial, and although insight provided by different animal models highlights the complexities involved in the developmental origins of adult disease, the presence of common mechanistic pathways is suggested.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institutes of Health Grant HL-074927.


    FOOTNOTES
 

Address for reprint requests and other correspondence: B. T. Alexander, Dept. of Physiology and Biophysics, Univ. of Mississippi Medical Center, 2500 North State St., Jackson, MS 39216-4505 (e-mail: balexander{at}physiology.umsmed.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Alexander BT. Placental insufficiency leads to development of hypertension in growth-restricted offspring. Hypertension 41: 457–462, 2003.[Abstract/Free Full Text]
  2. Alexander BT. Fetal programming of hypertension. Am J Physiol Regul Integr Comp Physiol 290: R1–R10, 2006.[Abstract/Free Full Text]
  3. Alexander BT, Hendon AE, Ferril G, Dwyer TM. Renal denervation abolishes hypertension in low birth weight offspring from pregnant rats with reduced uterine perfusion. Hypertension 45: 754–758, 2005.[Abstract/Free Full Text]
  4. Allen AM, Zhuo J, Mendelsohn FA. Localization of angiotensin AT1 and AT2 receptors. J Am Soc Nephrol 10: S23–S29, 1999.[Web of Science][Medline]
  5. Bagby SP, LeBard LS, Luo Z, Ogden BE, Corless C, McPherson ED, Speth RC. ANG II AT(1) and AT(2) receptors in developing kidney of normal microswine. Am J Physiol Renal Physiol 283: F755–F764, 2002.[Abstract/Free Full Text]
  6. Barker DJ. The fetal and infant origin of disease. Eur J Clin Invest 25: 457–463, 1995.[Web of Science][Medline]
  7. Barker DJ, Winter PD, Osmond C, Margetts B, Simmonds SJ. Weight in infancy and death from ischaemic heart disease. Lancet 2: 577–580, 1989.[Web of Science][Medline]
  8. Bassan H, Trejo LL, Kariv N, Bassan M, Berger E, Fattel A, Gozes I, Harel S. Experimental intrauterine growth retardation alters renal development. Pediatr Nephrol 15: 192–195, 2000.[CrossRef][Web of Science][Medline]
  9. Bertram C, Trowern AR, Copin N, Jackson AA, Whorwood CB. The maternal diet during pregnancy programs altered expression of the glucocorticoid receptor and type 2 11beta-hydroxysteroid dehydrogenase: potential molecular mechanisms underlying the programming of hypertension in utero. Endocrinology 142: 2841–2853, 2001.[Abstract/Free Full Text]
  10. Briscoe TA, Rehn AE, Dieni S, Duncan JR, Wlodeck ME, Owens JA, Rees SM. Cardiovascular and renal disease in the adolescent guinea pig after chronic placental insufficiency. Am J Obstet Gynecol 191: 847–855, 2004.[CrossRef][Web of Science][Medline]
  11. Campbell DM, Hall MH, Barker DJ, Cross J, Shiell AW, Godfrey KM. Diet in pregnancy and the offspring blood pressure 40 years later. Br J Obstet Gynaecol 103: 273–280, 1996.[Web of Science][Medline]
  12. Curhan GC, Chertow GM, Willett WC, Spiegelman D, Colditz GA, Manson JE, Speizer FE, Stampfer MJ. Birth weight and adult hypertension and obesity in women. Circulation 94: 1310–1315, 1996.[Abstract/Free Full Text]
  13. Curhan GC, Willet WC, Rimm EB, Spiegelman D, Ascherio AL, Stampfer MJ. Birth weight and adult hypertension, diabetus mellitus, and obesity in U.S. men. Circulation 94: 3246–3250, 1996.[Abstract/Free Full Text]
  14. Davisson RL, Ding Y, Stec DE, Catterall JF, Sigmund CD. Novel mechanism of hypertension revealed by cell-specific targeting of human angiotensinogen in transgenic mice. Physiol Genomics 1: 3–9, 1999.[Abstract/Free Full Text]
  15. DiBona GF. Sympathetic nervous system and the kidney in hypertension. Curr Opin Nephrol Hypertens 11: 197–200, 2002.[CrossRef][Web of Science][Medline]
  16. Ding Y, Sigmund CD. Androgen-dependent regulation of human angiotensinogen expression in KAP-hAGT transgenic mice. Am J Physiol Renal Physiol 280: F54–F60, 2001.[Abstract/Free Full Text]
  17. Forsen T, Eriksson JG, Tuomilehto J, Osmond C, Barker DJ. Growth in utero and during childhood among women who develop coronary heart disease: longitudinal study. BMJ 319: 1403–1407, 1999.[Abstract/Free Full Text]
  18. Gilbert JS, Lang AL, Grant AR, Nijland MJ. Maternal nutrient restriction in sheep: hypertension and decreased nephron number in offspring at 9 mo of age. J Physiol 565: 137–147, 2005.[Abstract/Free Full Text]
  19. Gomez RA, Lynch KR, Chevalier RL, Wilfong N, Everett A, Carey RM, Peach MJ. Renin and angiotensinogen gene expression in maturing rat kidney. Am J Physiol Renal Fluid Electrolyte Physiol 254: F582–F587, 1988.[Abstract/Free Full Text]
  20. Guron G, Friberg P. An intact renin-angiotensin system is a prerequisite for normal renal development. J Hypertens 18: 123–137, 2000.[CrossRef][Web of Science][Medline]
  21. Guron Marcussen NG, Nilsson A, Sundelin B, Friberg P. Postnatal time frame for renal vulnerability to enalapril in rats. J Am Soc Nephrol 10: 1550–1560, 1999.[Abstract/Free Full Text]
  22. Haber E, Koerner T, Page LB, Kliman B, Purnode A. Application of a radioimmunoassay for angiotensin I to the physiologic measurements of plasma renin activity in normal human subjects. J Clin Endocrinol Metab 29: 1349–1355, 1969.[Abstract/Free Full Text]
  23. Hadoke PWF, Lindsay RS, Seckl JR, Walker BR, Kenyon CJ. Altered vascular contractility in adult female rats with hypertension programmed by prenatal glucocorticoid exposure. J Endocrinol 188: 435–442, 2006.[Abstract/Free Full Text]
  24. Hall JE, Guyton AC, Mizelle HL. Role of the renin-angiotensin system in control of sodium excretion and arterial pressure. Acta Physiol Scand Suppl 591: 48–62, 1990.[Medline]
  25. Harrison-Bernard LM, Zhuo J, Kobori H, Ohishi M, Navar LG. Intrarenal AT1 receptor and ACE binding in ANG II-induced hypertensive rats. Am J Physiol Renal Physiol 282: F19–F25, 2002.[Abstract/Free Full Text]
  26. Huxley RR, Shiell AW, Law CM. The role of size at birth and postnatal catch-up growth in determining systolic blood pressure: a systematic review of the literature. J Hypertens 18: 815–831, 2000.[CrossRef][Web of Science][Medline]
  27. Ichihara A, Kobori H, Nishiyama A, Navar LG. Renal renin-angiotensin system. Contrib Nephrol 143: 117–130, 2004.[Web of Science][Medline]
  28. Kobori H, Harrison-Bernard LH, Navar LG. Expression of angiotensinogen mRNA and protein in angiotensin II-dependent hypertension. J Am Soc Nephrol 12: 431–439, 2001.[Abstract/Free Full Text]
  29. Kobori H, Nishiyama A, Abe Y, Navar LG. Enhancement of intrarenal angiotensinogen in Dahl salt-sensitive rats on high salt diet. Hypertension 41: 592–597, 2003.[Abstract/Free Full Text]
  30. Krebs LT, Hanesworth JM, Sardinia MF, Speth RC, Wright JW, Harding JW. A novel angiotensin analog with subnanomolar affinity for angiotensin-converting enzyme. J Pharmacol Exp Ther 293: 260–267, 2000.[Abstract/Free Full Text]
  31. Langley-Evans SC, Welham SJ, Sherman RC, Jackson AA. Weanling rats exposed to maternal low protein diets during discrete periods of gestation exhibit differing severity of hypertension. Clin Sci (Lond) 91: 607–615, 1996.[Medline]
  32. Law CM, Shiell AW. Is blood pressure inversely related to birth weight? The strength of evidence from a sympathethic review of the literature. J Hypertens 14: 935–941, 1996.[Web of Science][Medline]
  33. Manning J, Vehaskari VM. Low birth weight associated adult hypertension in rat. Pediatr Nephrol 16: 417–422, 2001.[CrossRef][Web of Science][Medline]
  34. Manning J, Vehaskari VM. Postnatal modulation of prenatally programmed hypertension by dietary Na and ACE inhibition. Am J Physiol Regul Integr Comp Physiol 288: R80–R84, 2005.[Abstract/Free Full Text]
  35. McMullen S, Gardner DS, Langley-Evans SE. Prenatal programming of angiotensin II type 2 receptor expression in the rat. Br J Nutr 91: 133–140, 2003.[CrossRef][Web of Science]
  36. McMullen S, Gardner DS, Langley-Evans SC. Prenatal programming of angiotensin II type 2 receptor expression in the rat. Br J Nutr 91: 133–140, 2004.[CrossRef][Web of Science][Medline]
  37. Merlet-Benichou C, Glibert T, Muffat-Joly M, Lelievre-Pegorier M, Leroy B. Intrauterine growth retardation leads to a permanent nephron deficit in the rat. Pediatr Nephrol 8: 175–180, 1994.[CrossRef][Web of Science][Medline]
  38. Naito Y, Tsujino T, Fujioka Y, Ohyanagi M, Iwasaki T. Augmented diurnal variations of the cardiac renin-angiotensin system in hypertensive rats. Hypertension 40: 827–833, 2002.[Abstract/Free Full Text]
  39. Navar LG, Von Thun AM, Zou L, el-Dahr SS, Mitchell KD. Enhancement of intrarenal angiotensin II levels in 2 kidney 1 clip and angiotensin II induced hypertension. Blood Press Suppl 2: 88–92, 1995.[Medline]
  40. Nishiyama A, Yoshizumi M, Rahman M, Kobori H, Seth DM, Miyatake A, Zhang GX, Yao L, Hitomi H, Shokoji T, Kiyomoto H, Kimura S, Tamaki T, Kohno M, Abe Y. Effects of AT1 receptor blockade onr enal injury and mitogen-activated protein activity in Dahl salt-sensitive rats. Kidney Int 65: 972–981, 2004.[CrossRef][Web of Science][Medline]
  41. O'Reagan D, Kenyon CJ, Seckl JR, Holmes MC. Glucocorticoid exposure in late gestation in the rat permanently programs gender-specific differences in adult cardiovascular and metabolic physiology. Am J Physiol Endocrinol Metab 287: E863–E870, 2004.[Abstract/Free Full Text]
  42. Ojeda NB, Grigore D, Yanes LL, Iliescu R, Robertson EB, Zhang H, Alexander BT. Testosterone contributes to marked elevations in mean arterial pressure in adult male intrauterine growth-restricted offspring. Am J Physiol Regul Integr Comp Physiol 292: R758–R763, 2007.[Abstract/Free Full Text]
  43. Peers A, Campbell DJ, Wintour EM, Dodic M. The peripheral renin-angiotensin system is not involved in the hypertension of sheep exposed to prenatal dexamethasone. Clin Exp Pharmacol Physiol 28: 306–311, 2001.[CrossRef][Web of Science][Medline]
  44. Pham TD, MacLennan NK, Chiu CT, Laksana GS, Hsu JL, Lane RH. Uteroplacental insufficiency increases apoptosis and alters p53 gene methylation in the full-term IUGR rat kidney. Am J Physiol Regul Integr Comp Physiol 285: R962–R970, 2003.[Abstract/Free Full Text]
  45. Rasch R, Skriver E, Woods LL. The role of the RAS in programming of adult hypertension. Acta Physiol Scand 181: 537–542, 2004.[CrossRef][Web of Science][Medline]
  46. Riviere G, Michaud A, Breton C, VanCamp G, Laborie C, Enache M, Lesage J, Deloof S, Corvol P, Vieau D. Angiotensin-converting enzyme 2 (ACE2) and ACE activities display tissue-specific sensitivity to undernutrition-programmed hypertension in the adult rat. Hypertension 46: 1169–1174, 2005.[Abstract/Free Full Text]
  47. Sahajpal V, Ashton N. Increased glomerular angiotensin II binding in rats exposed to a maternal low-protein diet in utero. J Physiol 563: 193–201, 2005.[Abstract/Free Full Text]
  48. Sahajpal V, Ashton N. Renal function and angiotensin AT1 receptor expression in young rats following intrauterine exposure to maternal low-protein diet. Clin Sci (Lond) 104: 607–614, 2003.[Medline]
  49. Schiffrin EL, Gutkowska J, Thibault G, Genest J. Effect of enalapril (MK-421), an orally active angiotensin I-converting enzyme inhibitor, on blood pressure, active and inactive plasma renin, urinary prostaglandin E2, and kallikrein excretion in conscious rats. Can J Physiol Pharmacol 62: 116–123, 1984.[Web of Science][Medline]
  50. Sherman RC, Langley-Evans SC. Antihypertensive treatment in early postnatal life modulates prenatal dietary influences upon blood pressure in the rat. Clin Sci (Lond) 98: 269–275, 2000.[Medline]
  51. Speth RC, Husain A. Distribution of angiotensin-converting enzyme and angiotensin II-receptor binding sites in the rat ovary. Biol Reprod 38: 695–702, 1988.[Abstract]
  52. Suzaki Y, Ozawa Y, Kobori H. Intrarenal oxidative stress and augmented angiotensinogen are precedent to renal injury in Zucker diabetic fatty rats. Int J Biol Sci 3: 40–46, 2007.[Medline]
  53. Vehaskari VM, Stewart T, Lafont D, Soyez C, Seth D, Manning J. Kidney angiotensin and angiotensin receptor expression in prenatally programmed hypertension. Am J Physiol Renal Physiol 287: F262–F267, 2004.[Abstract/Free Full Text]
  54. Vehaskari VM, Aviles DH, Manning J. Prenatal programming of adult hypertension in the rat. Kidney Int 59: 238–245, 2001.[Web of Science][Medline]
  55. von Lutterotti N, Camargo MJ, Mueller FB, Timmermans PB, Laragh JH. Angiotensin II receptor antagonist markedly reduces mortality in salt-loaded Dahl S rats. Am J Hypertens 4: 346S–349S, 1991.[Medline]
  56. Wintour EM, Johnson K, Koukoulas I, Moritz K, Tersteeg M, Dodic M. Programming the cardiovascular system, kidney and the brain—a review. Placenta 24: S65–S71, 2003.[CrossRef][Web of Science][Medline]
  57. Woods LL, Ingelfinger JR, Nyengaard JR, Rasch R. Maternal protein restriction suppresses the newborn renin-angiotensin system and programs adult hypertension in rats. Pediatr Res 49: 460–467, 2001.[Web of Science][Medline]
  58. Woods LL. Fetal origin of adult hypertension: a renal mechanism? Curr Opin Nephrol Hypertens 9: 419–425, 2000.[CrossRef][Web of Science][Medline]
  59. Woods LL, Rasch R. Perinatal Angiotensin II programs adult blood pressure, glomerular number and renal function in rats. Am J Physiol Regul Integr Comp Physiol 275: R1593–R1599, 1998.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
HypertensionHome page
H. A. Shaltout, J. P. Figueroa, J. C. Rose, D. I. Diz, and M. C. Chappell
Alterations in Circulatory and Renal Angiotensin-Converting Enzyme and Angiotensin-Converting Enzyme 2 in Fetal Programmed Hypertension
Hypertension, February 1, 2009; 53(2): 404 - 408.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. S. Gilbert and M. J. Nijland
Sex differences in the developmental origins of hypertension and cardiorenal disease
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2008; 295(6): R1941 - R1952.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
N. B. Ojeda, D. Grigore, and B. T. Alexander
Developmental Programming of Hypertension: Insight From Animal Models of Nutritional Manipulation
Hypertension, July 1, 2008; 52(1): 44 - 50.
[Full Text] [PDF]


Home page
HypertensionHome page
N. B. Ojeda, D. Grigore, E. B. Robertson, and B. T. Alexander
Estrogen Protects Against Increased Blood Pressure in Postpubertal Female Growth Restricted Offspring
Hypertension, October 1, 2007; 50(4): 679 - 685.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/2/R804    most recent
00725.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grigore, D.
Right arrow Articles by Alexander, B. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grigore, D.
Right arrow Articles by Alexander, B. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.