AJP - Regu Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Regul Integr Comp Physiol 294: R819-R828, 2008. First published January 9, 2008; doi:10.1152/ajpregu.00273.2007
0363-6119/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/3/R819    most recent
00273.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Villanueva, S.
Right arrow Articles by Vio, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Villanueva, S.
Right arrow Articles by Vio, C. P.

INFLAMMATION AND CYTOKINES

Inhibition of bFGF-receptor type 2 increases kidney damage and suppresses nephrogenic protein expression after ischemic acute renal failure

Sandra Villanueva,2 Carlos Cespedes,1 Alexis A. Gonzalez,1 Eric Roessler,3 and Carlos P. Vio1

1Laboratorio de Fisiologia, Pontificia Universidad Catolica de Chile, Santiago; 2Laboratorio de Fisiologia Integrativa y Molecular, Universidad de Los Andes, Santiago; and 3Laboratorio de Nefrologia, Pontificia Universidad Catolica de Chile, Santiago, Chile

Submitted 20 April 2007 ; accepted in final form 3 January 2008


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Recovery from acute renal failure (ARF) requires the replacement of injured cells by new cells that are able to restore tubule epithelial integrity. We have recently described the expression of nephrogenic proteins [Vimentin, neural cell adhesion molecule, basic fibroblast growth factor (bFGF), Pax-2, bone morphogen protein-7, Noggin, Smad 1-5-8, p-Smad, hypoxia-inducible factor-1{alpha}, vascular endothelial growth factor], in a time frame similar to that observed in kidney development, after ischemic ARF induced in an ischemia-reperfusion (I/R) model. Furthermore, we show that bFGF, a morphogen involved in mesenchyme/epithelial transition in kidney development, induces a reexpression of morphogenic proteins in an earlier time frame and accelerates the recovery process after renal damage. Herein, we confirm that renal morphogenes are modulated by bFGF and hypothesized that a decrease in bFGF receptor 2 (bFGFR2) levels by the use of antisense oligonucleotides diminishes the expression of morphogenes. Male Sprague-Dawley rats submitted to ischemic injury were injected with 112 µg/kg bFGFR2 antisense oligonucleotide (bFGFR2-ASO) followed by reperfusion. Rats were killed, and the expression of nephrogenic proteins and renal marker damage was analyzed by immunohistochemistry and immunoblot. Animals subjected to I/R treated with bFGFR2-ASO showed a significant reduction in morphogen levels (P < 0.05). In addition, we observed an increase in markers of renal damage: macrophages (ED-1) and interstitial {alpha}-smooth muscle actin. These results confirm that bFGF participates in the recovery process and that treatment with bFGFR2-ASO induces an altered expression of morphogen proteins.

kidney; morphogen; regeneration; basic fibroblast growth factor receptor 2-antisense oligonucleotide

ACUTE RENAL FAILURE (ARF) is a clinical syndrome associated with high morbidity and mortality; however, it is potentially reversible if the patients survive the initial insult (31). Acute tubular necrosis (ATN) due to poor renal perfusion is the most common cause of ARF (13). The principal cause of ATN is hypoxia induced by ischemia-reperfusion (I/R), which could be induced by certain clinical conditions, such as hypovolemia or sepsis (23). ATN is characterized by a regeneration phase that involves recovery of kidney function (22). Although the morphological characteristics of this process have been described, the molecular basis of the events leading to recovery are not completely understood (32).

We have hypothesized that renal regeneration may recapitulate part of the kidney genetic program elicited during organogenesis, including apoptosis (2, 36). In this context, we have described the reexpression of several morphogenes in the regeneration phase of ATN in a temporal pattern similar to that observed during kidney development (36). These observations open the possibility that morphogenes could be involved in the recovery process.

The nephrogenic proteins reported after ischemic ATN are the mesenchymal proteins Ncam (1), WT-1 (42), and Vimentin (43) and the epithelial proteins Pax-2 (8, 17, 29), which play a crucial role during early metanephric development (29). Similarly, bone morphogen protein 7 (BMP-7) (11), its antagonist Noggin (7, 35), and their transcription factors Smad 1 and 5 (21) are first expressed by embryo mesenchymal cells, are downregulated in the adult (41), and are reexpressed in the recovery phase of ischemic ATN induced by I/R in the same sequential pattern as that observed during kidney development (36).

An important protein secreted at early stages of kidney development is the basic fibroblast growth factor (bFGF). bFGF is necessary to promote mesenchymal cell condensation (18), inhibition of apoptosis, transition epithelial-mesenchymal (34) and early tubulogenesis (27, 30).

Previously, we have evaluated the effect of bFGF in the recovery of ATN using a recombinant protein. We reported that kidney damage was reduced, and the reexpression pattern of the morphogens and transcription factors analyzed was earlier in time and greater in intensity. These results show that bFGF can be involved in the recovery process and suggest that a bFGF treatment can accelerate the repair after ischemic damage in rat kidneys (37).

In the present study, we hypothesized that a decrease in bFGF receptor 2 (bFGFR2) levels, using an antisense oligonucleotide (ASO), will diminish the expression of morphogenes and that this deregulation would contribute to the delay of morphogen expression, impairing the recovery of kidney submitted to I/R.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals. Adult male Sprague-Dawley rats (220–250 g) were housed and maintained at the University animal care facilities; food and water were supplied ad libitum in a 12:12-h light-dark cycle. All experimental procedures were in accordance with institutional and international standards for the human care and use of laboratory animals (Animal Welfare Assurance Publication A5427-01, Office for Protection from Research Risks, Division of Animal Welfare, National Institutes of Health) as previously described (36, 37). All protocols were reviewed and approved by the Universidad P. Universidad Católica de Chile.

Renal I/R injury and bFGFR2-ASO treatment. An established model of renal I/R injury was performed (36, 37); this mimics structural and functional consequences of renal ischemia, including the presence of apoptotic tubular epithelial cell (4). Animals (n = 5 for each I/R group) were anesthetized with ketamine-xylazine (25:2.5 mg/kg ip), and body temperature was maintained at 37°C. Both kidneys were exposed by a flank incision, and both renal arteries were occluded with nontraumatic vascular clamps for 30 min. After 30 min of clamping, the left kidney was injected intrarenally with bFGFR2-ASO (112 µg/kg) (9) in a total volume of 200 µl and was considered as treated; the right kidney was injected with the same volume of saline and served as a control. After the injection, clamps were removed, renal blood flow was reestablished, and the incisions were sutured. A group of sham animals (n = 5) was included; these animals were subjected to the same surgical procedure and conditions, without clamping the renal arteries. A third group was included corresponding to animals injected intrarenally with bFGFR2-ASO in both kidneys; these animals were used to analyze renal function. Rats were allowed to recover in a warm room with water and food ad libitum. The rats were killed under anesthesia (ketamine-xylazine) at 24, 48, 72, and 96 h after reperfusion; both kidneys were removed and processed for immunohistochemistry and Western blot.

ASO treatment. ASO phosphorothioate including 23 bases (TGTTTGGGCAGGACAGTGAGCCA) was synthesized by solid phase and biotinylated. The sequence was designed to hybridize with the 3'-region of the rat bFGFR2 mRNA promotor. The lyophilized product was diluted in 0.9% saline sodium chloride and injected in the medulla area with a 30-gauge needle (37). A dose of 112 µg/kg was administered in a total volume of 200 µl. Preliminary data using methylene blue dye or Bouin's solution demonstrated that the volume used allowed extensive diffusion through the tissue.

The visualization of ASO was performed using streptavidin peroxidase conjugate and was developed with 3,3'-diaminobenzidine (DAB).

Tissue processing and immunohistochemical analysis. Immunohistochemical studies in Paraplast-embedded sections were performed as previously described (36, 37, 38). For cryosections, the kidney sections (3–4 mm thick) were processed as recently described (36).

Immunolocalization studies were performed using an indirect immunoperoxidase technique (36, 37). Briefly, the tissue sections were incubated with the primary antibody overnight at room temperature, followed by incubation with the corresponding secondary antibody and with the peroxidase-antiperoxidase (PAP) complex. Peroxidase activity was detected by incubation of the sections with 0.1% (wt/vol) DAB and 0.03% (vol/vol) hydrogen peroxide. For some specific antibodies, immunoreactivity was revealed using a secondary antibody conjugated to alkaline phosphatase in the presence of nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate (4.5:3.5 µl/ml) in 100 mM Tris buffer, pH 9.5. Controls for the immunostaining procedure were prepared by omission of the first antibody by its replacement with normal or preimmune serum of the same species (39).

Antibodies and chemicals. Primary antibodies were used as previously described (36). Monoclonal antibodies against Vimentin (clone 40E-C) and neural cell adhesion molecules (Ncam, clone 5B8) were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the National Institute of Child Health and Human Development and maintained by the University of Iowa Department of Biological Sciences (Iowa City, IA). Goat polyclonal antibodies against Pax-2, BMP-7, Smads 1-5-8, p-Smad 2-3, bFGF, and the monoclonal antibody against vascular endothelial growth factor (VEGF, clone C-1) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Monoclonal antibody against macrophages (clone ED-1) was obtained from Biosource (Camarillo, CA); {alpha}-smooth muscle actin ({alpha}-SMA, clone 1A4) was obtained from Sigma Aldrich (St. Louis, MO); hypoxia-induced factor 1{alpha} (HIF-1{alpha}, clone H1{alpha}67) was obtained from Novus Biological (Littleton, CO); and Noggin was gift of Dr. R. Harland.

Secondary antibodies and the corresponding PAP complexes were purchased from ICN Pharmaceuticals-Cappel (Aurora, OH). Triton X-100, DAB, carrageenan, Tris·HCl, hydrogen peroxide, phosphate salts, and other chemicals were purchased from Sigma Aldrich.

Protein extraction and immunoblotting. Whole kidney sections (~1 mm thick) were homogenized as previously described (36), and the protein concentration was determined through the Bradford method with the reagent obtained from Bio-Rad (Richmond, CA). Western blotting was performed as described by Harlow and Lane (16). For SDS-PAGE, proteins were mixed with sample buffer (100 mM Tris·HCl, pH 6.8, 200 mM dithiothreitol, 4% SDS, 0.2% bromphenol blue, and 20% glycerol), transferred to nitrocellulose membranes, and blocked as previously described (36). After being blocked, the membranes were probed with the corresponding antibody, washed with Tris-buffered saline-0.1% Tween 20, and incubated with horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. Immunoreactivity was detected using the enhanced chemiluminescence technique obtained from Perkin-Elmer, Life Sciences (Boston, MA). The positive controls for all nephrogenes were proteins isolated from the embryo at 17 days of development, and normal level controls were obtained from sham-operated rat kidneys. Western blots were run for all samples (n = 5) in each time period, and a representative blot from each group is shown.

Blots were scanned, and densitometric analysis was performed using the public domain NIH Image program v1.61 (US National Institutes of Health, http://rsb.info.nih.gov/nih-image). Expression of {alpha}-tubulin was used to normalize for variation in sample loading.

Detection and quantification of renal cell apoptosis by "in situ" end labeling of fragmented DNA. Apoptotic cells in kidney tissue slices were visualized using the Apop Tag Fluorescein In Situ Apoptosis Detection Kit by the indirect TUNEL method from Chemicon (Temecula, CA) following the manufacturer's protocol.

Determination of functional and tissue damage. As previously described (36), functional damage was assessed through serum creatinine levels (33), and tissue damage was evaluated using periodic acid-Schiff (PAS) staining and immunolocalization of interstitial macrophages (ED-1) and myofibroblasts ({alpha}-SMA).

The interstitial {alpha}-SMA immunoreactive area was determined by image analysis using Simple PCI software from Compix (Cranberry Township, PA). The tissue sections were observed and photographed using a Nikon optiphot microscope and dxm 1200 digital camera (Nikon, Tokyo, Japan). The values corresponding to total immunostained (brown) cells were averaged and expressed as the mean absolute values and the mean percentage of stained cell area per field (0.064 mm2) with a modification of a previously described method [40].

Statistical analysis. The differences were assessed with the nonparametric test of Mann-Whitney for pairwise comparisons when overall significance was detected. The significance level was defined at P < 0.05.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Effect of ASO on the bFGFR2 expression. Levels of bFGFR2 mRNA and protein were analyzed by RT-PCR and Western blot in kidney submitted to I/R and injected with bFGFR2-ASO or saline. After 24 h of I/R, an important inhibition of bFGFR2 mRNA and protein was observed in kidney treated with bFGFR2-ASO compared with kidneys injected with saline (Fig. 1). This inhibition was maintained at 48, 72, and 96 h after I/R (Fig. 1).


Figure 1
View larger version (59K):
[in this window]
[in a new window]

  		Fig. 1. Effect of antisense oligonucleotide (ASO) on basic fibroblast growth factor receptor 2 (bFGFR2) expression. PCR and Western blot were performed in kidney samples collected at 24, 48, 72, and 96 h after ischemia-reperfusion (I/R; n = 5 for each I/R group). Kidneys were injected with saline (I/R + S) or with bFGFR2-ASO (I/R + bFGFR2-ASO). An important inhibition in the bFGFR2 mRNA and protein was observed in kidney treated with ASO compared with kidneys injected with saline at 24 to 96 h after I/R. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

 
Visualization of bFGFR2-ASO. The visualization of bFGFR2-ASO was performed using streptavidin peroxidase conjugate and was developed with DAB. We observed a nuclear stain in kidneys injected with bFGFR2-ASO at 24 to 96 h after I/R. This stain was not observed in control kidneys injected with saline (Fig. 2).


Figure 2
View larger version (106K):
[in this window]
[in a new window]

  		Fig. 2. Visualization of bFGFR2-ASO. The visualization of bFGFR2-ASO was performed using streptavidin peroxidase conjugate and was developed with 3,3'-diaminobenzidine (DAB). The nuclear stain in kidneys injected with bFGFR2-ASO was observed at 24 (B), 48 (C), 72 (D), and 96 (E) h after I/R. The nuclear stain was not observed in control kidneys injected with saline (A). Scale bar = 25 µm. The arrows indicate localization of nuclear stain for each time point.

 
Determination of tissue damage. Renal functional damage by I/R was assessed by serum creatinine levels, which in rats subjected to the I/R protocol and injected with saline was 0.6 ± 0.1, 0.4 ± 0.1, 0.4 ± 0.05, and 0.4 ± 0.02 mg/dl at 24, 48, 72, and 96 h, respectively. In animals subjected to the I/R protocol and injected with FGFR2-ASO, the creatinine levels observed were higher: 1.1 ± 0.5, 0.9 ± 0.1, 0.9 ± 0.2, and 0.9 ± 0.3 mg/dl at 24, 48, 72, and 96 h, respectively.

The PAS staining of renal sections injected with saline showed a histological damage consistent with ATN at 24 h after I/R (data not shown); however, these alterations were not detected at 96 h after I/R (Fig. 3D) where we observed near-normal renal histology (Fig. 3A). In contrast, the bFGFR2-ASO-treated kidney showed an altered morphology at 24 h after I/R that was maintained to 96 h after I/R; these alterations were characterized by flattening of the brush-border epithelia and were consistent with ATN (Fig. 3G).


Figure 3
View larger version (157K):
[in this window]
[in a new window]

  		Fig. 3. Evidence of tissue damage in hypoxic kidney induced by I/R. Immunohistochemistry was performed in kidney samples collected at 96 h after I/R (n = 5 for each I/R group) in sham kidney (A–C) injected with saline (D–F) or with bFGFR2-ASO (G–I). A clear induction of renal damage markers such as macrophages (ED-1) (H), or myofibroblast {alpha}-smooth muscle actin ({alpha}-SMA) (I) was observed in the interstitial space from the inner and outer medulla in kidney injected with bFGFR2-ASO. This stain was also observed with lower intensity in kidney injected with saline (E and F). Staining for ED-1 and {alpha}-SMA was performed using peroxidase and was revealed with DAB (brown color reaction). The tissue damage was evaluated by periodic acid-Schiff (PAS) staining. PAS staining (A, D, and G) and brush-border and epithelial flattening are shown in kidney injected with bFGFR2-ASO (G), indicating that I/R can prolong the renal damage in kidney injected with bFGFR2-ASO. Opposite results were observed in kidney injected with saline at 96 h (D), with morphology closer to normal kidney (A). Scale bar = 100 µm. The arrows indicate the localization of the corresponding marker for each panel.

 
The renal damage markers showed an increased number of macrophages (ED-1) and interstitial {alpha}-SMA at 24 and 96 h after I/R in bFGFR2-ASO-treated kidneys ({alpha}-SMA: 18,839 µm2 and ED-1: 3,132 µm2; Fig. 3, H and I). Conversely, kidneys injected with saline showed a lower presence of both markers at 96 h after I/R ({alpha}-SMA: 6,084 µm2 and ED-1: 465 µm2; Fig. 3, E and F). These differences were significant (P < 0.05).

Determination of in situ cell death detection. DNA fragmentation is a hallmark of apoptosis that can be measured by the TUNEL technique. Control kidneys injected with saline showed TUNEL positive cells predominately localized in proximal tubular and interstitial cells and in some collecting duct cells of the inner and outer medulla at 24 h after injection (data not shown), but these cells did not show TUNEL positive cells [6.02/high power factor (hpf)] 96 h after I/R (Fig. 4A). Kidneys treated with bFGFR2-ASO showed a marked increased in the number and intensity of the label primarily in proximal tubular cells and its interstitial cells at 24 h that was maintained to 96 h after I/R (~29.49/hpf) (Fig. 4B). Most TUNEL-positive cells exhibited morphological features of apoptotic death (shrinkage of cytoplasm and condensation of nucleus).


Figure 4
View larger version (87K):
[in this window]
[in a new window]

  		Fig. 4. Distribution of TUNEL positive cells in hypoxia induced by I/R. A and B: TUNEL technique was performed in kidney samples obtained 96 h after I/R injected with saline (A) or bFGFR2-ASO (B) (n = 5 for each I/R group). A strong staining was observed into proximal tubular cells from the inner and outer medulla at the first stage of damage induced by acute tubular necrosis (ATN) in kidney injected with bFGFR2-ASO (B). In contrast, reduced staining was observed in kidney injected with saline (A). Staining for TUNEL was performed using fluorescence (green color reaction). Scale bar = 100 µm. The arrows indicate the localization of the corresponding marker for each panel.

 
Detection of markers induced by hypoxia: HIF-1{alpha} and VEGF. As reported previously, following renal artery clamping and injection with saline, a strong nuclear accumulation of HIF-1{alpha} occurred within the first 30 min. HIF-1{alpha} staining increased and peaked at 48 h after I/R in the kidney injected with saline (Figs. 5. 1A and 6C); from 48 h onward, the number of HIF-1{alpha} positive cell nuclei steadily declined, disappearing at 96 h (Fig. 5.1A). In kidneys treated with bFGFR2-ASO, HIF-1{alpha} immunostaining was observed at 24–48 h after I/R, but with a reduction in the number of positive cells and shorting in the staining area (Fig. 6E). The expression of HIF-1{alpha} was observed in papillary collecting ducts, the thick ascending limb, and proximal tubular cells, which are mainly localized in the inner and outer medulla of kidneys (Fig. 6, A, C, and E).


Figure 5
View larger version (48K):
[in this window]
[in a new window]

  		Fig. 5. Immunoblot of nephrogenic proteins in acute renal failure (ARF) induced by I/R. 5.1: expression of endothelial cell markers in kidney regeneration was studied by immunoblot for proteins: hypoxia-inducible factor (HIF)-1{alpha} (A) and vascular endothelial growth factor (VEGF, B) at 24, 48, 72, and 96 h after 30 min ischemia in kidney injected with saline or bFGFR2-ASO. An increase in HIF-1{alpha} and VEGF levels was observed in kidney injected with saline, with a maximum at 48 h, followed by a decrease that reached control levels at 96 h. Kidneys injected with bFGFR2-ASO showed a reduced expression of these markers at 24 and 48 h after I/R, followed by an increase at 72–96 h after I/R, but with levels that are lower than control kidney injected with saline. 5.2: Expression of metanephric mesenchymal (MM) and early epithelial markers in kidney regeneration was studied by immunoblot for morphogenic proteins neural cell adhesion molecule (Ncam, C), Pax-2 (D), and Vimentin (E). Samples were collected at 24, 48, 72, and 96 h after ischemia. Kidneys injected with saline showed an increase of MM markers Ncam, Pax-2, and Vimentin with a maximum at 48 h after ischemia. Expression levels of these markers decreased at 72 h and returned to basal level at 96 h. Kidneys injected with bFGFR2-ASO showed a reduced expression of these markers at 24 and 48 h after I/R. Only after 72–96 h after I/R was an increase in expression observed, which is inferior to that observed in kidney injected with saline. 5.3: expression of epithelial and tubular markers in kidney regeneration was studied by immunoblot for morphogenic proteins bone morphogen protein (BMP)-7 (F) and bFGFR2 (G). Samples were collected at 24, 48, 72, and 96 h after kidney ischemia. An increase in epithelial and tubular proteins can be observed with a maximum at 48 h and a decrease at 72 h after ischemia in kidney injected with saline. In kidney injected with bFGFR2-ASO was observed as diminishing in these markers at 24 h, maintained at 48 h after I/R, followed by a increase at 72–96 h after I/R. The expression observed in kidney injected with bFGFR2-ASO was inferior that observed in kidney injected with saline. 5.4: expression of the transcription pathway for BMP-7 was studied by immunoblot for morphogenic proteins BMP-7 (H), Noggin (I), and the 1-5-8 nonphosphorylated (J) and phosphorylated (K) form of the transcription factor Smad. Samples were collected at 24, 48, 72, and 96 h after kidney ischemia. A maximum increase in BMP-7 and Noggin protein levels was observed at 24 h followed by a decrease at 72–96 h after ischemia in kidney injected with saline. In contrast, kidneys injected with bFGFR2-ASO showed decreased expression of both markers at 24 h, with a peak at 24–48 h followed by a limited increase at 72–96 h after I/R. Expression levels of kidney injected with bFGFR2-ASO are inferior to that observed in kidneys injected with saline. Smad proteins show an increase with a maximum at 48–72 h and decreased at 96 h after ischemia in kidneys injected with saline. However, kidneys injected with bFGFR2-ASO showed undetectable protein levels (n = 5 for each I/R).

 

Figure 6
View larger version (110K):
[in this window]
[in a new window]

  		Fig. 6. Immunolocalization of endothelial cell markers in kidney regeneration. Staining for HIF-1{alpha} (A, C, and E) and VEGF (B, D, and F) was done in animals submitted to ischemia. A and B correspond to sham control animals. Maximum intensity of staining was observed 48 h after ischemia in kidney injected with saline (C and D). Staining for each marker was also performed at similar time periods in kidneys injected with bFGFR2-ASO (E and F), detecting substantially lower levels (n = 5 for each group). Expression of these markers was observed in papillary collecting ducts, thick ascending limb, and proximal tubular cells localized mainly in the inner and outer medulla of kidney. Staining of HIF-1{alpha} was performed using peroxidase and was revealed with DAB (brown color reaction). Staining for VEGF was performed using alkaline phosphatase and was revealed with tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP; blue color reaction). Scale bar = 100 µm. The arrows indicate the localization of the corresponding marker for each panel.

 
VEGF is an angiogenic signaling molecule induced by hypoxia. VEGF showed a marked expression 24 h after I/R in the kidney injected with saline (Fig. 5.1B and 6D) and decreased significantly at 96 h (Fig. 5.1B). In bFGFR2-ASO-treated kidney, we observed a diminished expression of VEGF at 24 h after I/R (Fig. 5.1B and 6F) (P < 0.05); this expression was constant and decreased by 96 h (Fig. 5.1B). The expression of these proteins was observed in proximal tubule cells mainly localized in the inner and outer medulla (Fig. 6, A–F).

Expression of mesenchymal and epithelial markers in kidney after I/R. Representative expression patterns are shown for mesenchymal and epithelial markers in kidneys injected with saline or bFGFR2-ASO after I/R (Figs. 7 and 8). ATN induced by I/R in rats injected with bFGFR2-ASO leads to an altered distribution pattern of mesenchymal markers (Ncam, Pax-2, Vimentin, and Noggin) and tubular epithelial markers (bFGFR, BMP-7) in a opposed manner to previous reports using recombinant bFGF (36) (Figs. 7, E–L, and 8, E, F, I, and J). In the healthy adult kidney (sham control), some of these proteins were detected in collecting duct cells, with the highest expression in the papilla. Conversely, cells from proximal tubules and glomeruli or peritubular cells localized in the inner/outer medulla and medullary rays were devoid of labeling (Figs. 7, A–D and 8, A and B) (36).


Figure 7
View larger version (169K):
[in this window]
[in a new window]

  		Fig. 7. Immunolocalization of MM and early epithelial markers in kidney regeneration. Kidney slices were immunostained for bFGF (A, E, and I), Ncam (B, F, and J), Pax 2 (C, G, and K), and Vimentin (D, H, and L) in sham control animals (A–D) and 24 h after ischemia in kidneys injected with saline (E–H) or with bFGFR2-ASO (I–L) (n = 5 for each group). The MM markers Vimentin and Ncam were localized in the peritubular area in the inner and outer medulla. The early epithelial proteins Pax 2 and bFGF were localized in the proximal tubular cells in the inner and outer medulla. Staining for all four markers was decreased after ischemia in kidneys injected with bFGFR2-ASO (I–L) vs. kidney injected with saline (E–H). Staining for bFGF, Ncam, Pax 2, and Vimentin was performed using peroxidase and was revealed with DAB (brown color reaction). Scale bar = 100 µm. The arrows indicate localization of the corresponding marker for each panel.

 

Figure 8
View larger version (167K):
[in this window]
[in a new window]

  		Fig. 8. Immunolocalization of BMP-7, a BMP antagonist and elements of Smad. Maximum staining intensity for BMP-7 (E), Noggin (F), Smad 1-5-8 (G), and p-Smad (H) was observed at 48 h after 30 min ischemia in kidneys injected with saline. Kidney slices from rats injected with bFGFR2-ASO were also stained for each marker (I–L). A–D: sham animal controls (n = 5 for each group). Staining for BMP-7 and Noggin proteins increased at 48 h after ischemia and was localized to the proximal tubular cells from the inner and outer medulla in kidneys injected with saline (E and F). Staining for Smad 1-5-8 proteins increased with a maximum at 24–48 h and was localized to the proximal tubular cells from the inner and outer medulla in kidneys injected with saline (G and H). Kidneys treated with bFGFR2-ASO showed a reduced signal (I–L). Staining for BMP-7 and Noggin was performed using peroxidase and was developed with DAB (brown color reaction). Staining for Smad 1-5-8 and p-Smad was performed using alkaline phosphatase and was developed with NBT/BCIP (blue color reaction). Scale bar = 100 µm. The arrows indicate the localization of the corresponding marker for each panel.

 
In kidneys injected with saline, the highest expression after I/R was observed at 24–72 h for BMP-7, Ncam, and Noggin and at 48 h for bFGFR. The expression of these proteins decreased at 96 h after I/R (Figs. 5.2, 5.3, and 5.4) in a time fashion similar to previous reports (36). These proteins were mainly localized to the inner and outer medulla; bFGFR and BMP-7 were localized to proximal tubule cells; Ncam and Noggin were localized in the peritubular area (Figs. 7, E and F, and 8, E and F).

In bFGFR2-ASO-treated kidneys, low expression for mesenchymal and epithelial markers Ncam, Pax-2, Vimentin, and Noggin was observed at 24 h after I/R and was maintained out to 72–96 h (Figs. 5.2 and 5.4I). This expression pattern in the recovery phase was consistent with the maintenance of cellular damage (Figs. 7, I–L, and 8J). For the tubular markers BMP-7 and bFGFR, a downward expression was observed at each time point; in the case of BMP-7, proteins peaked at 72 h and decreased at 96 h after I/R (Figs. 5.3F and 8I). In summary, we observed that all morphogenic protein levels tested were diminished in kidneys treated with bFGFR2-ASO compared with kidneys injected with saline.

BMP-7, a survival factor for undifferentiated mesenchyme (12), is antagonized by Noggin protein (7, 35) and phosphorylates the transcription factors Smad 1 and 5 (21). The transcription factor Smad (total and phosphorylated) was studied in cells from kidneys after I/R, injected with bFGFR2-ASO or saline (Figs. 5.4, J and K, and 8, G, H, K, and L). Reexpression of both states was observed in proximal tubule cells in the inner and outer medulla. In kidney injected with saline, the maximum expression of Smad 1-5-8 and p-Smad (the active form of Smad) was observed at 24–48 h after I/R (Fig. 8, G and H), similar to the ones reported previously (36); however, in kidneys injected with bFGFR2-ASO, the expression level was lower at the same time (Fig. 5.4, J and K), and the immunostaining cannot be observed at 24–48 h after I/R (Fig. 8, K and L).

Levels of markers for differentiation in kidneys submitted to I/R. To study the effect of ATN induced by I/R on kidneys injected with bFGFR2-ASO or saline, freshly prepared extracts from inner/outer medulla kidney sections were analyzed with the corresponding antibodies to evaluate the expression of nephrogenic proteins. Western blots were run with all samples (n = 5) in each time period, and selected blots are shown as being representative from each group. Compared with kidney homogenates injected with saline, the kidneys treated with bFGFR2-ASO showed diminished protein levels similar to that observed by immunohistochemistry in proximal tubular cells (Fig. 5.1–5.4) (P < 0.05). In summary, at 24–48 h after I/R, diminished levels of HIF-1{alpha}, VEGF, bFGF, Ncam, Pax-2, Vimentin, Noggin, BMP-7, Smad 1-5-8, and p-Smad levels were observed. This reduction was also observed in samples obtained 72–96 h after I/R (Figs. 5.1–5.4).


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
Embryonic kidney development is characterized by proliferation of undifferentiated cells, followed by later differentiation of daughter cells into specific cell phenotypes. A similar sequence of events can be observed during the regeneration process, opening the possibility that renal regeneration may recapitulate part of the kidney genetic program during organogenesis, including apoptosis (2, 36). To test this hypothesis, we have previously studied the effect of recombinant bFGF added exogenously in a model of ATN induced by I/R. Recombinant bFGF promoted acceleration in the repair process and prevented damage in kidney submitted to I/R (37). In this study, we performed complementary analysis and evaluated the effect of the inhibition of bFGF morphogen on the repair process and the subsequent morphogenic induction in kidney damage.

Apoptosis is a programmed mode of cell death that plays an important role in the pathogenesis of the ischemic ATN (25). Apoptosis and the presence of markers of kidney damage, including macrophages (ED-1), interstitial {alpha}-SMA, and PAS staining, are methods used to evaluate the cellular damage induced by ischemia (36). Ischemic kidneys treated with bFGFR2-ASO showed a significant increase in the number of tubular TUNEL positive cells, a strong immunoreactivity to ED-1 and {alpha}-SMA, and morphological characteristics in agreement with an important damage in tubular cells at 24 h and maintained at 96 h after I/R. This is significant, considering that in control kidneys these characteristics were maintained for only 24–48 h, indicating that damage was more extensive in the presence of bFGFR2-ASO. In addition, we did not detected mitosis when evaluated by PAS staining, in agreement with previous reports (36, 37). Together, these results suggest that bFGFR2-ASO may increase the renal tubular apoptosis triggered by ischemia. An important observation was that the number of TUNEL positive cells was maintained, whereas the expression of morphogenic proteins and cellular mitosis was inhibited. These data show that the inhibition of bFGF can increase apoptotic cell death leading to a delayed or incomplete recovery of the kidney. In addition, we showed that the reexpression of morphogenes can be induced only when cellular death is not present (36, 37).

Previous studies have demonstrated that hypoxia can induce the expression of specific proteins involved in the repair process (2, 36). The induction of HIF-1{alpha} is an early event in the sequence of cellular changes following the interruption of blood flow and has an important role in the initiation of subsequent reactions. In this study, the kidneys injected with bFGFR2-ASO showed lower levels of HIF-1{alpha} at 72–96 h after I/R; this was considerably later than previous reports (36, 37). HIF-1{alpha} may play an important role in the balance between cell death and/or survival and thus induce the expression of morphogenic proteins to help in the recovery process (36).

Although ATN has been tightly linked to tubular epithelia cell injury, there are also vascular factors involved, as observed by the damage of peritubular capillaries in rats subjected to renal ischemia (3, 6, 26). Considering this data, we analyzed the expression of VEGF, which is known to be regulated by HIF-1{alpha}. VEGF is essential for vasculogenesis and angiogenesis and allows various cellular types to survive and proliferate under extreme stress conditions, such as hypoxia (15, 19, 20). A significant decrease in VEGF expression was detected in kidneys treated with bFGFR2-ASO when compared with previously reported data (36, 37). Because of the considerable impact of VEGF on angiogenesis (5), it is possible that bFGFR2-ASO could inhibit endothelial function and thus slow the repair process. The upregulation of VEGF by FGF has been described (27); therefore, the bFGFR2 inhibition by ASO may contribute to the reduction of VEGF levels.

Ncam, bFGF, and BMP-7 are known to play a crucial role during early metanephric kidney development (17). After kidney injury induced by I/R, these proteins are locally restricted and reexpressed in the regenerating proximal tubules (36, 37) and are overexpressed in kidneys injected with recombinant bFGF (37). Our results in kidney injected with saline confirm the previous reports (17, 36), but in kidney treated with bFGFR2-ASO the abundance of these morphogenes was lower. Because previous reports have shown an upregulation of BMP by FGF (12), it is possible that the inhibition of FGFR can reduce the expression of these proteins.

Vimentin, a marker of mesenchymal cells and fully dedifferentiated renal epithelia, is not present in healthy adult tubule, but its reexpression occurs during tubular regeneration and proliferation (36, 43). The low resulting levels of these proteins in kidneys treated with bFGFR2-ASO show that in kidney cells the nephrogenic proteins may be required for repair and that a state of differentiation similar to that present in renal early development (36, 37) is absent in kidney treated with bFGFR2-ASO.

An interaction between BMP and FGF has been reported in early development, and a reexpression of BMP and its antagonist Noggin after I/R has been described (36, 37). Herein, in kidneys treated with bFGFR2-ASO both BMP and Noggin were expressed in lower amounts. The relevance of this data is related to the regulatory function of Noggin and BMP. Noggin could be generating specific signals to determine differentiation of a particular cell type, or it could make cell groups sensitive to a specific morphogen, such as BMP. Furthermore, this indicates that Noggin may be involved in kidney development and in the regeneration process after kidney damage. In addition, previous reports have shown the upregulation of Noggin, BMP, and their transcription factors (Smad) by bFGF (10, 14, 24). Therefore, inhibition of bFGF by bFGFR2-ASO may explain the reduced expression of these proteins.

BMP signaling is mediated by Smad 1-5-8 proteins in kidney development (41). Smad and p-Smad are reexpressed after kidney damage, with a maximum in a time coincident with the highest levels of Noggin and BMP. Its expression decreases in a similar fashion as epitheliogenic proteins, similar to what has been reported in embryonic development (36). Based on the observed patterns of expression, we speculate that Smads may play specific roles in the recovery phase of ATN during kidney damage, replicating its expression profile observed during kidney development.

Perspectives and Significance

Our results demonstrate that, during the recovery process, bFGF can be reexpressed to restore mature kidney function in a process similar to nephrogenesis during embryonic development. These finding suggest that the repair process is inhibited by the treatment with bFGFR2-ASO.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by Fondecyt Grants 3050075 (S. Villanueva) and 1050977 (C. P. Vio).


   ACKNOWLEDGMENTS
 
We thank Maria Alcoholado, Eva Bustamante, and Jose Miguel Erpel for technical assistance in tissue processing and TUNEL techniques and Drs. Gareth Owen, Victoria Velarde, and Elisa Marusic for critical reading of the manuscript.


   FOOTNOTES
 

Address for reprint requests and other correspondence: S. Villanueva, Laboratorio de Fisiologia Integrativa y Molecular, Universidad de Los Andes, San Carlos Apoquindo 2200, Santiago, Chile (e-mail: svillanueva{at}uandes.cl)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Abbate M, Brown D, Bonventre J. Expression of NCAM recapitulates tubulogenic development in kidneys recovering from acute ischemia. Am J Physiol Renal Physiol 277: F454–F463, 1999.[Abstract/Free Full Text]
  2. Al-awqati Q, Oliver JA. Stem cells in the kidney. Kidney Int 61: 387–395, 2002.[CrossRef][Web of Science][Medline]
  3. Basile DP, Donohoe D, Roethe K, Osborn JL. Renal ischemic injury results in permanent damage to peritubular capillaries and influences long-term function. Am J Physiol Renal Physiol 281: F887–F899, 2001.[Abstract/Free Full Text]
  4. Basile DP, Fredrich K, Alausa M, Vio CP, Liang M, Rieder MR, Greene AS, Cowley AW Jr. Identification of persistently altered gene expression in kidney following functional recovery from ischemic acute renal failure. Am J Physiol Renal Physiol 288: F253–F263, 2005.[Abstract/Free Full Text]
  5. Breier G, Albrecht U, Sterrer S, Risau W. Expression of vascular endothelial growth factor during embryonic angiogenesis and endothelial cell differentiation. Development 114: 521–532, 1992.[Abstract]
  6. Brodsky SV, Yamamoto T, Tada T, Kim B, Chen J, Kajiya F, Goligorsky MS. Endothelial dysfunction in ischemic acute renal failure: rescue by transplanted endothelial cells. Am J Physiol Renal Physiol 282: F1140–F1149, 2002.[Abstract/Free Full Text]
  7. Brunet LJ, McMahon JA, McMahon AP, Harland RM. Noggin, cartilage morphogenesis, and joint formation in the mammalian skeleton. Science 280: 1455–1457, 1998.[Abstract/Free Full Text]
  8. Cai Q, Dmitrieva N, Ferraris J, Brooks H, van Balkom B, Burg M. Pax-2 expression occurs in renal medullary epithelial cells in vivo and in cell culture, is osmoregulated, and promotes osmotic tolerance. Proc Natl Acad Sci USA 102: 503–508, 2005.[Abstract/Free Full Text]
  9. Carstens RP, Wagner EJ, Garcia-Blanco MA. An intronic splicing silencer causes skipping of the IIIb exon of fibroblast growth factor receptor 2 through involvement of polypyrimidine tract binding protein. Mol Cell Biol 20: 7388–7400, 2000.[Abstract/Free Full Text]
  10. Chiba S, Kurokawa MS, Yoshikawa H, Ikeda R, Takeno M, Tadokoro M, Sekino H, Hashimoto T, Suzuki N. Noggin and basic FGF were implicated in forebrain fate and caudal fate, respectively, of the neural tube-like structures emerging in mouse ES cell culture. Exp Brain Res 163: 86–99, 2005.[CrossRef][Web of Science][Medline]
  11. Dudley AT, Lyons KM, Robertson EJ. A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye. Genes Dev 9: 2795–2807, 1995.[Abstract/Free Full Text]
  12. Dudley AT, Godin RE, Robertson EJ. Interaction between FGF and BMP signaling pathways regulates development of metanephric mesenchyme. Genes Dev 13: 1601–1613, 1999.[Abstract/Free Full Text]
  13. Esson ML, Schrier RW. Diagnosis and treatment of acute tubular necrosis. Ann Intern Med 137: 744–752, 2002.[Abstract/Free Full Text]
  14. Fakhry A, Ratisoontorn C, Vedhachalam C, Salhab I, Koyama E, Leboy P, Pacifici M, Kirschner RE, Nah HD. Effects of FGF-2/-9 in calvarial bone cell cultures: differentiation stage-dependent mitogenic effect, inverse regulation of BMP-2 and noggin, and enhancement of osteogenic potential. Bone 36: 254–266, 2005.[Medline]
  15. Freeburg PB, Abrahamson DR. Hypoxia-inducible factors and kidney vascular development. J Am Soc Nephrol 14: 2723–2730, 2003.[Abstract/Free Full Text]
  16. Harlow E, Lane D. Antibodies: A Laboratory Manual. Cold Spring Harbor, NY: Published by Cold Spring Harbor, 1998.
  17. Imgrund M, Grone E, Grone HJ, Kretzler M, Holzman L, Schlondorff D, Rothenpieler UW. Re-expression of the developmental gene Pax-2 during experimental acute tubular necrosis in mice. Kidney Int 56: 1423–1431, 1999.[CrossRef][Web of Science][Medline]
  18. Karanova I, Dove L, Resau J, Perantoni A. Conditioned medium from a rat ureteric bud cell line in combination with bFGF induces complete differentiation of isolated metanephric mesenchyme. Development 122: 4159–4167, 1996.[Abstract]
  19. Kim BS, Goligorsky MS. Role of VEGF in kidney development, microvascular maintenance and pathophysiology of renal disease. Korean J Intern Med 18: 65–75, 2003.[Medline]
  20. Kitamoto Y, Tokunaga H, Tomita K. Vascular endothelial growth factor is an essential molecule for mouse kidney development: glomerulogenesis and nephrogenesis. J Clin Invest 99: 2351–2357, 1997.[Web of Science][Medline]
  21. Kopp JB. BMP receptors in kidney. Kidney Int 58: 2237–2238, 2000.[CrossRef][Web of Science][Medline]
  22. Lameire NH, Vanholder R. Pathophysiology of ischaemic acute renal failure. Best Pract Res Clin Anaesthesiol 18: 21–36, 2004.[CrossRef][Medline]
  23. Mehta R. Outcomes research in acute renal failure. Semin Nephrol 23: 283–294, 2003.[CrossRef][Web of Science][Medline]
  24. Nakamura Y, Tensho K, Nakaya H, Nawata M, Okabe T, Wakitani S. Low dose fibroblast growth factor-2 (FGF-2) enhances bone morphogenetic protein-2 (BMP-2)-induced ectopic bone formation in mice. Bone 36: 399–407, 2005.[Medline]
  25. Oberbauer R, Schwarz C, Regele HM, Hansmann C, Meyer TW, Mayer G. Regulation of renal tubular cell apoptosis and proliferation after ischemic injury to a solitary kidney. Lab Clin Med 138: 343–351, 2001.[CrossRef]
  26. Patschan D, Krupincza K, Patschan S, Zhang Z, Hamby C, Goligorsky MS. Dynamics of mobilization and homing of endothelial progenitor cells after acute renal ischemia: modulation by ischemic preconditioning. Am J Physiol Renal Physiol 291: F176–F185, 2006.[Abstract/Free Full Text]
  27. Perantoni AO, Dove LF, Karavanova I. Basic fibroblast growth factor can mediate the early inductive events in renal development. Proc Natl Acad Sci USA 92: 4696–4700, 1995.[Abstract/Free Full Text]
  28. Rabie AB, Lu M. Basic fibroblast growth factor up-regulates the expression of vascular endothelial growth factor during healing of allogeneic bone graft. Arch Oral Biol 49: 1025–1033, 2004.[CrossRef][Web of Science][Medline]
  29. Rothenpieler UW, Dressler GR. Pax-2 is required for mesenchyme-to-epithelium conversion during kidney development. Development 119: 711–720, 1993.[Abstract]
  30. Sakurai H, Barros EJ, Tsukamoto T, Barasch J, Nigam SK. An in vitro tubulogenesis system using cell lines derived from the embryonic kidney shows dependence on multiple soluble growth factors. Proc Natl Acad Sci USA 94: 6279–6284, 1997.[Abstract/Free Full Text]
  31. Schrier RW, Wang W, Poole B, Mitra A. Acute renal failure: definitions, diagnosis, pathogenesis, and therapy. J Clin Invest 114: 5–14, 2004.[CrossRef][Web of Science][Medline]
  32. Singri N, Ahya SN, Levin ML. Acute renal failure. JAMA 289: 747–751, 2003.[Free Full Text]
  33. Stanton B, Koeppen B. The kidney. In: Physiology (5th ed.), edited by Berne R, Levi M, Koeppen B, and Stanton B. St. Louis, MO: Mosby, 2004.
  34. Strutz F, Zeisberg M, Ziyadeh FN, Yang CQ, Kalluri R, Muller GA, Neilson EG. Role of basic fibroblast growth factor-2 in epithelial mesenchymal transformation. Kidney Int 61: 1714–1728, 2002.[CrossRef][Web of Science][Medline]
  35. Villanueva S, Glavic A, Ruiz P, Mayor R. Posteriorization by FGF, Wnt and retinoic acid is required for neural crest induction. Dev Biol 241: 289–301, 2002.[CrossRef][Web of Science][Medline]
  36. Villanueva S, Cespedes C, Vio CP. Ischemic acute renal failure induces the expression of a wide range of nephrogenic proteins. Am J Physiol Regul Integr Comp Physiol 290: R861–R870, 2006.[Abstract/Free Full Text]
  37. Villanueva S, Cespedes C, Gonzalez A, Vio CP. bFGF induces an earlier expression of nephrogenic proteins after ischemic acute renal failure. Am J Physiol Regul Integr Comp Physiol 291: R1677–R1687, 2006.[Abstract/Free Full Text]
  38. Vio CP, An SJ, Cespedes C, McGiff JC, Ferreri NR. Induction of cyclooxygenase-2 in thick ascending limb cells by adrenalectomy. J Am Soc Nephrol 12: 649–658, 2001.[Abstract/Free Full Text]
  39. Vio CP, Cespedes C, Gallardo P, Masferrer JL. Renal identification of cyclooxygenase-2 in a subset of thick ascending limb cells. Hypertension 30: 687–692, 1997.[Abstract/Free Full Text]
  40. Vio CP, Figueroa CD. Evidence for a stimulatory effect of high potassium diet on renal kallikrein. Kidney Int 31: 1327–1334, 1987.[Web of Science][Medline]
  41. Vrljicak P, Myburgh D, Ryan AK, Van Rooijen MA, Mummery CL, Gupta IR. Smad expression during kidney development. Am J Physiol Renal Physiol 286: F625–F633, 2004.[Abstract/Free Full Text]
  42. Wagner KD, Wagner N, Wellmann S, Schley G, Bondke A, Theres H, Scholz H. Oxygen-regulated expression of the Wilms tumor suppressor Wt1 involves hypoxia-inducible factor-1 (HIF-1). FASEB J 17: 1364–1366, 2003.[Abstract/Free Full Text]
  43. Witzgall R, Brown D, Schwarz C, Bonventre JV. Localization of proliferating cell nuclear antigen, vimentin, c-Fos, and clusterin in the postischemic kidney. Evidence for a heterogeneous genetic response among nephron segments, and a large pool of mitotically active and dedifferentiated cells. J Clin Invest 93: 2175–2188, 1994.[Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/3/R819    most recent
00273.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Villanueva, S.
Right arrow Articles by Vio, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Villanueva, S.
Right arrow Articles by Vio, C. P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.