Table 1.

Primer sequences for expression of genes

No.TargetForward (5′-3′)Reverse (5′-3′)
1ICAM-1CAGTCCGCTGTGCTTTGAGACGGAAACGAATACACGGTGAT
2VCAM-1CTGGGAAGCTGGAACGAAGTCAGGGGGCCACTGAATTGAA
3MCP-1GGCTCAGCCAGATGCAGTTAACCTACTCATTGGGATCATCTTGCT
4Ets-1TATCATCCACAAGACGGCGGGGCTTTACATCCAGCATGGC
5TNF-αGCTCTTACTGACTGGCATGAGCGCAGCTCTAGGAGCATGTG
6IL-10GCTCTTACTGACTGGCATGAGCGCAGCTCTAGGAGCATGTG
  • MCP-1, monocyte chemoattractant protein-1.